BIOLÓGIA ANGOL NYELVEN

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "BIOLÓGIA ANGOL NYELVEN"

Transcription

1 ÉRETTSÉGI VIZSGA május 15. BIOLÓGIA ANGOL NYELVEN EMELT SZINTŰ ÍRÁSBELI VIZSGA május 15. 8:00 Az írásbeli vizsga időtartama: 240 perc Pótlapok száma Tisztázati Piszkozati NEMZETI ERŐFORRÁS MINISZTÉRIUM Biológia angol nyelven emelt szint írásbeli vizsga 1211

2 Important information Read the following instructions carefully before you start your work. You have 240 minutes to complete your advanced level examination. Your written paper consists of two parts. For answering correctly the first part (tasks I-IX), which is compulsory for everyone you are awarded 80 points. The second part (task X) contains two versions (A and B). YOU ONLY HAVE TO COMPLETE ONE OF THEM. You can be awarded the total of 20 points FOR ANSWERING ONLY ONE OF THE TWO OPTIONAL TASKS. It means that by answering both you cannot get more points. If you do start answering both optional tasks CROSS OUT THE ONE WITH A PEN WHICH YOU DON NOT WANT TO BE INCLUDED. If you fail to do this the examiners will automatically evaluate the A version. Your questions are either multiple choice or open-ended ones. When answering multiple choice questions you need to write one or two CAPITAL LETTERS into the empty boxes. These are the letters of the correct answer or answers. Make sure that your answers are unambiguous, otherwise they will not be accepted. If you want to correct your answer CROSS OUT THE WRONG ONE AND WRITE THE CORRECT LETTER NEXT TO IT. A D correct A D C acceptable B D wrong When answering open-ended questions, you need to write technical terms, a few words, a whole sentence or several sentences. Mind your GRAMMAR because if your answer is not understandable because of bad grammar, or because it is ambiguous (e.g. it is not clear what the subject of the sentence is), it will not be acceptable even if it contains the correct terms. Each correct answer is awarded 1 point, unless otherwise indicated. Use black or blue pen. Don t write anything into the grey boxes. Good luck for your work. írásbeli vizsga / május 15.

3 I. Ferns and Cycads 9 points The picture on the left shows a maidenhair spleenwort (aranyos fodorka), which is a fern, while the one on the right a cycad (sago palm) which belongs to the gymnosperms. Describe the characteristics of the two plants by writing the appropriate letters into the boxes. A) true for the maidenhair spleenwort B) true for the sago palm C) true for both D) true for neither 1. Its shoots can be seen in the picture. 2. It reproduces by dispersed spores. 3. Its sex cells are formed by meiosis. 4. It has no seeds. 5. It has fruit. 6. It has compound leaves. 7. It has flowers. 8. Its plant body is made up of different tissues. 9. Water solution is conducted in xylem vessels in its stem towards the leaves total írásbeli vizsga / május 15.

4 II. Life in the Mediterranean Sea 9 points The graph shows the seasonal variation of two environmental factors influencing marine life forms in the Mediterranean Sea. The data refer to the surface waters. Along the horizontal axis the initials of the months are shown, while along the vertical axis the values relative to the maximum values are placed. The distribution of plant-like and animal-like planktonic organisms (minute, floating living things) is also shown. After studying the graph answer the following questions. relative value mass of növényi phytoplankton plankton tömege állati mass of plankton zooplankton tömege Figure 1 j f m á m j j a s o n d hőmérséklet temperature növényi concentration tápanyagtartalom of plant nutrients 1. The circular arrows refer to the mixing process of surface and deep waters. Explain the physical causes of this phenomenon (apart from the storms which are more frequent in winter time). 2. The mixing process brings up water rich in phosphorous, nitrogen and heavy metal ions from the depths for the phytoplankton. In what form can plants primarily take up phosphorous and nitrogen? Write down their chemical symbols. (2 points) phosphorous:. nitrogen: 3. Of the metal ions, iron is also required in small quantities by plants and animals alike because iron is one of the components of the enzymes (cytochromes) found in the inner mitochondrial membrane. In which stage of the oxidation process are these enzymes indispensable? írásbeli vizsga / május 15.

5 4. By contrasting Fig. 1 and Fig. 2 give an explanation for the fact that the ions discussed in the above questions accumulate in the non-mixing (stratified) deep water layers far away from the coast rather than on the surface (the sediment carrying effect of rivers can be ignored) The rate of photosynthesis of Figure 2 phytoplankton is also influenced by the temperature and light intensity. Fig. 2 shows the rate of photosynthesis of a marine species as a function of light intensity. (The horizontal axis shows the measure of photosynthetically active incoming radiation while the vertical one the activity of the electron transport chain operating in the chloroplasts.). 5. Explain the fact that the phytoplankton in the Mediterranean Sea is almost equally distributed across all the layers illuminated by sunlight in the winter. However, in the summer it is at a depth of m that it reproduces the fastest. (2 points) In winter:..... In summer:. 6. Give your reasons why the mass of phytoplankton is changing in the surface waters in spring time. (2 points) Reasons for growth:.. Reasons for decline: total írásbeli vizsga / május 15.

6 III. Breaking the Genetic Code 11 points Robert Holley, Har Ghobind Khorana and Marshal Nierenberg received the Nobel Prize for breaking the genetic code and compiling the codon dictionary in With meticulously designed experiments they established a link between the triplets of the mrna and the order of amino acids in proteins. 1. At the time the experiments were carried out the existence of triplets was not yet sure and there were several hypotheses put forward about the way amino acids could be coded for. On the basis of what theoretical consideration did the researchers look for base triplets rather than units consisting of two bases? Give your reason to support your answer. 2. One condition of the successful experiment was that artificial protein synthesis could be carried out in a test tube. Which cellular organelle, possible to isolate from bacteria as well, was required for the synthesis? In the first phase of Nierenberg s series of experiments an artificial mrna consisting only of uracil bases (poli-u) was synthesised. With the help of this a polypeptide chain consisting only of the amino acid phenylalanine was created. This was the first word of the codon dictionary deciphered: UUU > Phe (phenylalanine). Subsequently, mixtures of nucleotides containing the nucleotides in different proportions were applied by the researchers, and the proportion of amino acids in the polypeptides obtained was determined. If for example in a solution there are nucleotides containing only uracil (U) and cytosine (C) in a 2 :1 ratio, their frequency is p (U) = 2/3 and q (C) = 1/3. The probability of a particular triplet being formed, supposing that the bases combine randomly, equals the product of their separate/individual probabilities. Accordingly, in the mixture the probability of the base triplet UUC being formed is x (UUC) = p (U) 2 q (C) = (2/3) 2 (1/3) = 4/27. Since the relative frequency of phenylalanine in the polypeptide chain being synthesised was exactly that much, it can be concluded that this base triplet coded for phenylalanine, too. U C A G U C A G UCU ser UAU tyr UCC ser UAC tyr UCA ser UAA STOP UCG ser UAG STOP UUU phe UUC phe UUA leu UUG leu CUU leu CUC leu CUA leu CUG leu AUU ile AUC ile AUA ile AUG met GUU val GUC val GUA val GUG val CCU pro CCC pro CCA pro AAG pro ACU thr ACC thr ACA thr ACG thr GCU ala GCC ala GCA ala GCG ala CAU his CAC his CAA gln CAG gln AAU asn AAC asn AAA lys AAG lys GAU asp GAC asp GAA glu GAG glu UGU cys UGC cys UGA STOP UGG trp CGU arg CGC arg CGA arg CGG arg AGU ser AGC ser AGA arg AGG arg GGU gly GGC gly GGA gly GGG gly U C A G U C A G U C A G U C A G írásbeli vizsga / május 15.

7 Let us suppose that, applying Nierenberg s method in our experiment, the nucleotides containing adenine and uracil dissolved in the mixture occur in a 1/2:1/2 ratio. 3. What else do these nucleotides contain apart from adenine and uracil? (2 points). and. 4. In what type of chemical reaction are nucleotides bound to one another?. 5. How many different triplets can be formed if the bases randomly combine in the experiment? Determine the number of different types of amino acids in the proteins synthesised on the basis of these mrna chains. Explain the difference between the two numerical values.! (4 points) How many different triplets are there? How many different types of amino acids are there?... Reasons for the differences:. 6. Determine the expected ratio of the amino acids isoleucine (ile) and leucine (leu) in the polypeptide chain synthesised in the mixture if it is assumed that there is an equal chance of the two types of the nucleotides being linked to each other in the synthetic mrna. Ratio of leucine to isoleucine:.. 7. Let us suppose that a polypeptide chain of 4 amino acids were produced in the above experiment. Give the number of different combinations in which the amino acids can be linked to one another in the chain total írásbeli vizsga / május 15.

8 IV. Microscopic Investigation 9 points We made a cross section of one of the organs of a dicotyledonous plant and the specimen was viewed under a light microscope. 1. Let us start the investigation under low power of magnification. Several tissues can be seen. Which of the following tissues can be seen? Write the letter of the correct answer into the boxes. (2 points) A) paranchyma B) epithelium C) epidermis D) conducting tissue E) connective tissue 2. Now let us move on to higher magnification. Explain how exactly the magnification of the microscope can be calculated. Under this magnification it can be seen that at the top and the bottom parts of the specimen the cells are arranged into a single layer where they fit closely together. At the top part they look more or less identical, while at the bottom different, bean-shaped cells can be observed as well. 3. Which tissue is being investigated? 4. In the mid-section of our specimen one of the tissues observed has two, differently shaped cell types with chloroplasts visible inside them. What are the characteristics of this tissue? (2 points) A) Some of its cells are loosely packed in a sponge-like arrangement. B) Some of its cells preserved their ability to divide. C) Some of its cells have a columnar arrangement. D) Its cells can be covered with a layer of cuticle. E) Its cells can be covered with hair like structures. 5. In the course of our further investigations in one particular part of a specimen a lot of small, undifferentiated cells with thin cell walls can be seen. Which type of tissue is investigated? 6. Could the specimen be prepared from the leaf of a monocotyledonous plant? Give your reason to support your answer. 7. Could the specimen be the leaflet of a moss plant? Give your reason to support your answer total írásbeli vizsga / május 15.

9 V. Levels of Organisation and Nutritional Types 7 points Write the number of the species or group of living organisms from 1 to 9 into the appropriate spaces of the figure according to their levels of organisation and nutritional types. Each correct answer is 1 point Eukaryotes Heterotrophs Animals with pseudotissue Chemotrophs 1. giant amoeba 2. Chlamydomonas (single-celled green algae) 3. baker s yeast 4. nitrifying bacteria, which rely on the energy deriving from oxidising nitrogen containing inorganic compounds for fixing/reducing atmospheric carbon dioxide. 5. fresh water sponge 6. bacterium causing pneumonia 7. ferns and their relatives (Pteridophytes) total írásbeli vizsga / május 15.

10 VI. Enforced Diet 8 points Life in Cuba took a sudden turn for the worse twenty years ago when the Soviet Union, whose main priority (...) up until then was to keep the regime in Cuba alive, collapsed.(...) The graveness of the collapse is well reflected in the fact that famine became widespread in the country. (...) Due to the shortage of food the average calorie intake of Cubans dropped from 2899 kilocalories, which was regarded as too much anyway, to 1863 kilocalories. In the meantime, due to severe restrictions on fuel, masses of people were compelled to walk and cycle, which doubled the number of physically active inhabitants compared to earlier data. As a result of all this the body mass index of the Cubans fell by 1.5 points between 1990 and (The body mass index is a number indicating the extent of obesity and is obtained by dividing the body mass expressed in kilograms by the square of height in meters.) (...) The weight loss of the population had a profound effect on the incidence rate of several diseases and their mortality rate. In 2002, compared to 1997, the death rate for diabetes fell by 51%, for heart attack by one third and for stroke by one fifth. All this is due to the falling rates of obesity. According to an international survey published in The Lancet medical journal the average blood sugar level of mankind in 2008 was 5.46 millimole per liter (the normal range in a litre is between 4 and 6.1) and this figure had risen by 0.24 millimole since The number of diabetics has increased from 153 million in 1980 to 347 million in 2008 (during this time the population of the world has increased from 4.5 billion to 6.6 billion). Based on newspaper article by Csilla Molnár: Üzemanyag-korlátozás (Magyar Nemzet, jul. 09.) 1. Calculate by how much the average body mass of Cubans decreased between 1990 and Let us suppose that the average height remained constant all along: 170 cm. 2. While the number of diabetics decreased in Cuba, the world average was on the increase. Calculate the percentage by which the rate of diabetics increased in the world between 1980 and Sugar is carried in the blood mainly in the form of glucose. How many grams of glucose on average did the blood of a healthy adult man contain in 2008? A C = 12, A O = 16, A H = 1. írásbeli vizsga / május 15.

11 4. In the course of sustained starvation, the body mainly converts its protein reserves into glucose. Name a hormone which promotes this process. (Let us ignore the unexpected stress effect during this time.) 5. Obesity mainly increases the incidence rate of type II diabetes. In this type of disease the permanently much higher level of blood sugar results in a level of insulin slightly higher than the normal. What might be the reason for this? Write the letters of the correct answers into the boxes. (2 point) A) Because of the higher level of blood sugar the insulin secretion of the pancreas is slightly increased. B) Slightly increased level of insulin results in a manifold increase in the blood sugar level. C) High blood sugar level causes the insulin sensitivity of the target cell receptors to increase. D) In spite of high insulin level, the rate of blood sugar uptake is low due to the low number of insulin receptors in the membrane of the target cells. E) In spite of high blood sugar level, the rate of blood sugar uptake is low due to the low number of blood sugar level detecting receptors in the membrane of the target cells. 6. In the case of type II diabetes there is often also an increased level of glucagon in the blood of diabetics. Glucagon has an antagonistic effect to insulin. High levels of insulin, however, decrease the rate of glucagon synthesis. What might cause the level of glucagon to increase in diabetic patients? A) Increased inhibitory effect of high glucose levels. B) Increased inhibitory effect of high insulin levels. C) The receptors inhibiting glucagon synthesis do not work. D) The receptors promoting glucagon synthesis do not work. E) Glucagon has the effect of lowering blood sugar level in diabetics. 7. The 'enforced diet' might not only have beneficial effects. Deficiency diseases can also arise due to low amounts of essential amino acids. Describe what is meant by the term essential amino acid total írásbeli vizsga / május 15.

12 VII. Pedigree Analysis 9 points The family tree shows the inheritance of a dominant disease (let us indicate the allele which causes it with letter A ) and the inheritance of the ABO blood group system (I A, I B and i). The two genes coding for these characteristics are located on the same chromosome. The manifestation of the disease is marked by shading the symbols solid black, while the blood groups are shown by the appropriate letters next to the symbols 1. Find the genotype of the woman marked by I/2 in the family tree. Write the letter of the correct answer into the empty box. A) AA and I B i B) aa and I B i C) Aa and I B i D) Aa and I B I B E) AA and I B I B 2. Give the genotype of the man marked by I/1 by using the same type of symbols as in question If the woman II/1 marries a healthy man with blood group AB, what phenotypes can their children have? (2 points) Which alleles did the man II/2 inherit from his mother and father? (2 points) from his father:.. from his mother: 5. The II/2-II/3 married couple had a child who suffered from the disease and had blood group O. a) Which alleles did she inherit from her mother?... b) Which alleles did she have to get from her father?... c) Name the process which can explain that the father passed on these two alleles at the same time (let us rule out the possibility of a point mutation) total írásbeli vizsga / május 15.

13 VIII. Molecule Identification 8 points The molecules listed below play a range of important roles in living organisms. By applying a method used in plant identification, work out step by step which compounds are indicated by letter A, B.etc. Write the name of the compounds (groups of compounds) into the table. There are two odd ones out among the ones listed below, which do not fit anywhere. The compounds: bile salts haemoglobin phosphatides myosin water carotene urea fibrinogen chlorophyll* insuline 1. a) Peptide. 2. b) Non-peptide a) It occurs in the blood plasma.. 3. b) It is active within the cell a) The change in its structure is an important step in blood A: clotting. b) It plays no role in blood clotting. B: 4. a) It is an enzyme which breaks down ATP. C: b) It is a transport protein D: 5. a) Its biological role is attributed to its peculiar polarity features b) Its biological role can be explained by its system of conjugated double bonds a) In biological systems its molecules are oriented so that its hydrophobic parts point towards each other, while its hydrophilic parts point towards the water... E: b) When functioning, the hydrophobic parts surround a apolar liquid droplet, while its hydrophilic parts point towards the water. F: 7. a) Its molecule also contains Mg 2+ ion G: b) It contains no Mg 2+.. H: *chlorophyll = the molecule which is responsible for absorbing light in photosynthesis. A B C D E F G H total írásbeli vizsga / május 15.

14 IX. Vessels and Organs 10 points C liver gall bladder A The figure shows the schematic picture of the blood supply of the kidney and the liver. After studying the picture answer the following questions! 1. What is the name of the part indicated by letter E? D kidney B E Y = true for all X = true for none For which duct shown in the figure are the following statements true? Answer with the letters of the figure above. If the statement is true for none, write X into the box. If it is true for all, write Y. 2. The blood flowing through this part left the right ventricle last on its way out of the heart. 3. The blood flowing through this part is carried to the left atrium first as it gets to the heart. 4. Urine is flowing through this part. 5. This part contains a digestive enzyme. 6. It contains steroids (compound with steroid frame). írásbeli vizsga / május 15.

15 7. Decide which of the following statements are true. Write the letters of the correct statements into the boxes. (4 points) A) Letter A and B indicate one artery each. B) Letter C points to a vein. C) The ph value of the liquid flowing in part A is higher than in part B because the higher concentration of carbon dioxide in part B shifts the ph towards the acidic extreme. D) The sugar concentration of the liquid flowing in part A in a running man can be higher than in part B because some of the sugar is taken up by the tissue cells from the blood flowing through the tissue. E) The liquid flowing in the duct indicated by letter D has an acidic ph because it contains bile acids/salts. F) Following a tough jogging, the lactic acid content of the liquid flowing through part B is lower than in part C because in the skeletal muscles the lactic acid is converted into glucose. G) Blood is carried into the liver through both an artery and a vein total írásbeli vizsga / május 15.

16 Optional tasks Write the letter of the chosen task into the box. (A or B) X. A Body Fluids 20 points The human blood 7 points A) A, Rh-positive blood group B) B, Rh-negative blood group C) True for both D) True for neither Write the letter of the correct answer into the box next to each statement. There is only one correct answer to each question. 1. Blood group antigens are found in the blood plasma. 2. It coagulates when exposed to a blood serum deriving from an O, Rhnegative blood. 3. A mother with such blood group can have Rh incompatibility developing in the course of her first pregnancy. 4. A mother with such blood group can have Rh incompatibility developing in the course of her second pregnancy. 5. On the surface of their red blood cells there are only two types of antigens with regard to the ABO and Rh blood group system. 6. In case of emergency its red blood cells can be transferred into a person with blood group AB, Rh-negative. 7. Its blood group can be determined by a double homozygous genotype, too. Tissue circulation 13 points Discuss the human tissue fluid in the form of a brief essay. In your answer include the following points: From what, where and how (as a result of which physical and chemical circumstances/conditions) is it formed? What is the characteristic feature of its composition straight after it is formed and how is it changing later on? What is the function of the tissue fluid? Where does it flow from the tissues and which physical and chemical factors are the main driving forces of its streaming? Esszé total írásbeli vizsga / május 15.

17 X. B Nature Conservation and Genetics 20 points Extinction threshold 9 points The following text is about the dangers threatening small populations. Fill in the gaps with suitable expressions. In populations decreasing in size mating between closely related individuals, in other word (1)... and the random elimination of different gene variants, the process referred to as (2)... will sooner or later inevitably occur. The mating of relatives decreases the biological fitness of each particular individual, whereas a decrease in genetic diversity causes the adaptability of the population to decline. In such populations the mortality rate is (3)... and the number of births per capita (birth rate) is (4)... As a result, the population is getting smaller and smaller and the accelerating process can lead to extinction. 5. Give your reason why the mating between close relatives can lead to a decrease in biological fitness of the offspring. (2 points) 6. Explain why the decrease in genetic diversity causes the adaptability of the population to decline. (2 points) 7. Name one factor which increases the genetic diversity of the population while the average biological fitness of the individual is not decreasing. írásbeli vizsga / május 15.

18 Means of nature conservation essay 11points Discuss the basic principles, the means and aims of protecting our natural assets. In your essay include the following points: The basic idea of biological diversity (on a genetic and ecosystem level), its economic and medical significance. At least three anthropological effects, which result in populations decreasing in size or the extinction of species. Concrete objectives of two international agreements in nature conservation. Connection between consumer habits in Hungary and species richness in ecosystems in distant lands. An example for active and sustainable nature conservation (positive effects of regular human intervention). You can write your essay on page Essay total Essay: írásbeli vizsga / május 15.

19 írásbeli vizsga / május 15.

20 Maximum score I. Ferns and Cycads 9 II. Life in the Mediterranean Sea 9 III. Breaking the Genetic Code 11 IV. Microscopic Investigation 9 V. Levels of Organisation and Nutritional Types 7 VI. Enforced Diet 8 VII. Pedigree Analysis 9 VIII. Molecule Identification 8 IX. Vessels and Organs 10 Total score of the test: 80 X. Optional essay or problem solving task 20 Total score of the written examination: 100 Achieved score marking teacher Date:.. Feladatsor / Test Választható esszé vagy problémafeladat / Optional essay or problem solving task elért pontszám egész számra kerekítve / achieved score rounded to an integer programba beírt egész pontszám / integer score written into the programe javító tanár / marking teacher jegyző / administrator Dátum/Date:.. Dátum/Date.. írásbeli vizsga / május 15.

Hands on Simulation of Mutation

Hands on Simulation of Mutation Hands on Simulation of Mutation Charlotte K. Omoto P.O. Box 644236 Washington State University Pullman, WA 99164-4236 omoto@wsu.edu ABSTRACT This exercise is a hands-on simulation of mutations and their

More information

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects Mutation Mutation provides raw material to evolution Different kinds of mutations have different effects Mutational Processes Point mutation single nucleotide changes coding changes (missense mutations)

More information

The Structure and Function of DNA

The Structure and Function of DNA Chapter 0 The Structure and Function of PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey,

More information

Gene Finding CMSC 423

Gene Finding CMSC 423 Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher

More information

Aipotu Part III: Molecular Biology

Aipotu Part III: Molecular Biology Aipotu Part III: Molecular Biology Introduction: The Biological Phenomenon Under Study In this lab, you will continue to explore the biological mechanisms behind the expression of flower color in a hypothetical

More information

Solution Key Problem Set 3

Solution Key Problem Set 3 Solution Key- 7.016 Problem Set 3 Question 1 The following human pedigree shows the inheritance pattern of a specific disease within a family. Assume that the individuals marrying into the family for all

More information

Molecular Facts and Figures

Molecular Facts and Figures Nucleic Acids Molecular Facts and Figures DNA/RNA bases: DNA and RNA are composed of four bases each. In DNA the four are Adenine (A), Thymidine (T), Cytosine (C), and Guanine (G). In RNA the four are

More information

In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA.

In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA. In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA. For each student: Science notebook Reproducible Master 6, Cooking Up a Protein

More information

Section 1 Workbook (unit 2) ANSWERS

Section 1 Workbook (unit 2) ANSWERS Section 1 Workbook (unit 2) ANSWERS Complete the following table: nucleotide DNA RN Name: B5. Describe DNA replication 1) Label each base given in the diagram below and describe the 4 primary characteristics

More information

Beloit College BIOL Emerging Infectious Diseases

Beloit College BIOL Emerging Infectious Diseases Virus classification and life cycle activity For reference Transcription: Krasner p 131 Translation: Krasner p 132-135 Genetic code: Krasner p 135 A virus is an obligate intracellular parasite, meaning

More information

(http://genomes.urv.es/caical) TUTORIAL. (July 2006)

(http://genomes.urv.es/caical) TUTORIAL. (July 2006) (http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA

More information

Chapter 1: Bio Primer

Chapter 1: Bio Primer Chapter 1: Bio Primer 1.1 Cell Structure; DNA; RNA; transcription; translation; proteins Prof. Yechiam Yemini (YY) Computer Science Department Columbia University COMS 4761 --2007 Overview Cell structure

More information

Protein Synthesis Simulation

Protein Synthesis Simulation Protein Synthesis Simulation Name(s) Date Period Benchmark: SC.912.L.16.5 as AA: Explain the basic processes of transcription and translation, and how they result in the expression of genes. (Assessed

More information

Students complete all index cards. 10 min. Completion of the anticipation guide.

Students complete all index cards. 10 min. Completion of the anticipation guide. 1 Tuesday, June 9 Objective Domain: Cells and Heredity Students explain the process of inheritance of genetic traits. Students differentiate between DNA and RNA, recognizing the role of each in heredity.

More information

Cambridge International Examinations Cambridge International Advanced Level

Cambridge International Examinations Cambridge International Advanced Level Cambridge International Examinations Cambridge International Advanced Level CHEMISTRY 9701/42 Paper 4 Structured Questions May/June 2014 2 hours Candidates answer on the Question Paper. Additional Materials:

More information

Hiding Data in DNA. 1 Introduction

Hiding Data in DNA. 1 Introduction Hiding Data in DNA Boris Shimanovsky *, Jessica Feng +, and Miodrag Potkonjak + * XAP Corporation + Dept. Computer Science, Univ. of California, Los Angeles Abstract. Just like disk or RAM, DNA and RNA

More information

Gene Translation:RNA -> Protein

Gene Translation:RNA -> Protein Gene Translation:RN -> Protein How does a particular sequence of nucleotides specify a particular sequence of amino acids? The answer: by means of transfer RN molecules, each specific for one amino acid

More information

Cathryn Kurkjian, PhD Postdoctoral Trainee University of North Carolina, Chapel Hill.

Cathryn Kurkjian, PhD Postdoctoral Trainee University of North Carolina, Chapel Hill. [Type here] [Type here] [Type here], PhD Postdoctoral Trainee University of North Carolina, Chapel Hill Email: kurkjiancj@gmail.com Twitter: @Cate_Kurkjian Image from: http://icsjournal.org/2015/03/02/dna-building-blocks-of-nanotechnology/

More information

Insulin mrna to Protein Kit

Insulin mrna to Protein Kit Insulin mrna to Protein Kit A 3DMD Paper BioInformatics and Mini-Toober Folding Activity Teacher Key and Teacher Notes www. Insulin mrna to Protein Kit Contents Becoming Familiar with the Data... 3 Identifying

More information

Gene Finding. Slides by Carl Kingsford

Gene Finding. Slides by Carl Kingsford Gene Finding Slides by Carl Kingsford Genome of the Cow a sequence of 2.86 billion letters enough letters to fill a million pages of a typical book. TATGGAGCCAGGTGCCTGGGGCAACAAGACTGTGGTCACTGAATTCATCCTTCTTGGTCTAACAGAGAACATAG

More information

Review of Central Dogma; Simple Mendelian Inheritance

Review of Central Dogma; Simple Mendelian Inheritance . Genome 371 Spring, 2005 Review of Central Dogma; Simple Mendelian Inheritance Problem Set #1 (not for credit): Problems 1-18 test your knowledge of the central dogma. The remaining problems are related

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus

Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus Cao, H.W. and Zhang, H.* College of Biological Science and Technology, HeiLongJiang BaYi Agricultural University, DaQing 163319, China. *

More information

Biological One-way Functions

Biological One-way Functions Biological One-way Functions Qinghai Gao, Xiaowen Zhang 2, Michael Anshel 3 gaoj@farmingdale.edu zhangx@mail.csi.cuny.edu csmma@cs.ccny.cuny.edu Dept. Security System, Farmingdale State College / SUNY,

More information

BIOLÓGIA ANGOL NYELVEN

BIOLÓGIA ANGOL NYELVEN Biológia angol nyelven középszint 1121 ÉRETTSÉGI VIZSGA 2014. május 14. BIOLÓGIA ANGOL NYELVEN KÖZÉPSZINTŰ ÍRÁSBELI ÉRETTSÉGI VIZSGA JAVÍTÁSI-ÉRTÉKELÉSI ÚTMUTATÓ EMBERI ERŐFORRÁSOK MINISZTÉRIUMA Instructions

More information

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination

More information

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct

More information

trna and Protein Building Lab Date Period

trna and Protein Building Lab Date Period trna and Protein Building Lab Name Date Period Purpose: RNA produced in the nucleus of a cell moves out of the nucleus to the cell s ribosomes. This RNA is a specific sequence of bases copied from the

More information

B5 B8 ANWERS DNA & ) DNA

B5 B8 ANWERS DNA & ) DNA Review sheet for test B5 B8 ANWERS DNA review 1. What bonds hold complementary bases between 2 strands of DNA together? Hydrogen bonds 2. What bonds exist between sugars and phosphates? Covalent bonds

More information

Introduction to Molecular Genetics

Introduction to Molecular Genetics Introduction to Molecular Genetics I. Introduction: A. ave you thought much about why you are like your parents, and your kids are (will be) like you? 1. Inherited traits result from the transfer of specific

More information

REVISING DNA AND PROTEIN SYNTHESIS (LIVE) 01 JULY 2015 Exam Questions

REVISING DNA AND PROTEIN SYNTHESIS (LIVE) 01 JULY 2015 Exam Questions REVISING DNA AND PROTEIN SYNTHESIS (LIVE) 01 JULY 2015 Exam Questions Question 1 (Adapted from Feb/March 2015 Paper 2 DBE, Question 1.4) The diagram below represents DNA replication. 1.1 Identify the following:

More information

Respiration occurs in the mitochondria in cells.

Respiration occurs in the mitochondria in cells. B3 Question Which process occurs in the mitochondria in cells? Why do the liver and muscle cells have large number of mitochondria? What is the function of the ribosomes? Answer Respiration occurs in the

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information

BIOLOGY ORDINARY LEVEL SAMPLE

BIOLOGY ORDINARY LEVEL SAMPLE M43 Write your Examination Number here Coimisiún na Scrúduithe Stáit State Examinations Commission LEAVING CERTIFICATE EXAMINATION BIOLOGY ORDINARY LEVEL SAMPLE 3 hours Section A Answer any five questions

More information

Answers and Solutions to Text Problems

Answers and Solutions to Text Problems 22 Answers and Solutions to Text roblems 22.1 DA contains two purines, adenine (A) and guanine (G) and two pyrimidines, cytosine (C) and thymine (T). RA contains the same bases, except thymine (T) is replaced

More information

Concept 5.4: Proteins include a diversity of structures, resulting in a wide range of functions

Concept 5.4: Proteins include a diversity of structures, resulting in a wide range of functions Concept 5.4: Proteins include a diversity of structures, resulting in a wide range of functions Proteins account for more than 50% of the dry mass of most cells Some proteins speed up chemical reactions

More information

Woods Biol Hmwk DNA & Genetic Engineering (key) Pg. 1

Woods Biol Hmwk DNA & Genetic Engineering (key) Pg. 1 Woods Biol Hmwk-6 10-1 DNA & Genetic Engineering (key) Pg. 1 NOTE: Unless otherwise indicated in the problem, DNA will be from the Template strand. Figure 1: Look carefully at Fig s 1 & 2 to determine

More information

DELIVERY GUIDE Topic: You and your genes

DELIVERY GUIDE Topic: You and your genes DELIVERY GUIDE Topic: You and your genes June 2015 GCSE (9 1) Twenty First Century Biology B GCSE REFORM Oxford Cambridge and RSA We will inform centres about any changes to the specification. We will

More information

UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS

UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS UIT (12) MLECULE F LIFE: UCLEIC ACID ucleic acids are extremely large molecules that were first isolated from the nuclei of cells. Two kinds of nucleic acids are found in cells: RA (ribonucleic acid) is

More information

Synonymous Codon Usage in Lactococcus lactis: Mutational Bias Versus Translational Selection

Synonymous Codon Usage in Lactococcus lactis: Mutational Bias Versus Translational Selection Journal of Biomolecular Structure & Dynamics, ISSN 0739-1102 Volume 21, Issue Number 4, (2004) Adenine Press (2004) Abstract Synonymous Codon Usage in Lactococcus lactis: Mutational Bias Versus Translational

More information

Translation Activity Guide

Translation Activity Guide Translation Activity Guide Teacher Key β-globin Translation Translation occurs in the cytoplasm of the cell and is defined as the synthesis of a protein (polypeptide) using information encoded in an mrna

More information

Grundlagen der Bioinformatik, SS 08, D. Huson, April 21,

Grundlagen der Bioinformatik, SS 08, D. Huson, April 21, Grundlagen der Bioinformatik, SS 08, D. Huson, April 21, 2008 7 2 Introduction to Molecular Biology We will start with a very short repetition of the basics of molecular biology, including a summary of

More information

Ruth Sundeen. Lesson 9 Part 1. Help Your Students Learn. Greetings and felicitations from Mrs. Ruth!

Ruth Sundeen. Lesson 9 Part 1. Help Your Students Learn. Greetings and felicitations from Mrs. Ruth! Ruth Sundeen Lesson 9 Part 1 Help Your Students Learn Ages: Eighth grade to high school senior Topics: Protein Synthesis Enzymes Experiment to demonstrate fragility of enzymes Greetings and felicitations

More information

Cells, tissues and organs

Cells, tissues and organs Chapter 8: Cells, tissues and organs Cells: building blocks of life Living things are made of cells. Many of the chemical reactions that keep organisms alive (metabolic functions) take place in cells.

More information

BIOLOGY HIGHER LEVEL SAMPLE

BIOLOGY HIGHER LEVEL SAMPLE M44 Write your Examination Number here Coimisiún na Scrúduithe Stáit State Examinations Commission LEAVING CERTIFICATE EXAMINATION BIOLOGY HIGHER LEVEL SAMPLE 3 hours Section A Answer any five questions

More information

The Processes of Life. Bicester Community College Science Department

The Processes of Life. Bicester Community College Science Department B4 The Processes of Life B4 Key Questions How do chemical reactions take place in living things? How do plants make food? How do living organisms obtain energy? How do chemical reactions take place in

More information

DNA: Molecule of Life

DNA: Molecule of Life DNA: Molecule of Life History DNA Structure Protein Synthesis Gene Regulation History of DNA H I S T O By the 1940 s, scientists knew that chromosomes consisted of both DNA and protein but did not know

More information

DNA pol RNA pol ARS trna Ribosome DNA mrna Protein Transcription Translation Replication A B Acceptor stem D-loop T C loop Anticodon loop Variable loop Relative trna gene copy number 0.0 0.2 0.4

More information

The chemical reactions inside cells are controlled by enzymes. Cells may be specialised to carry out a particular function.

The chemical reactions inside cells are controlled by enzymes. Cells may be specialised to carry out a particular function. 12.1 What are animals and plants built from? All living things are made up of cells. The structures of different types of cells are related to their functions. to relate the structure of different types

More information

B2 1 Cells, Tissues and Organs

B2 1 Cells, Tissues and Organs B2 Cells, Tissues and Organs 5 minutes 5 marks Page of 7 Q. The diagram shows a bacterium. On the drawing, name the structures labelled A, B, C and D. (Total 4 marks) Q2. (a) The diagrams show cells containing

More information

1. The diagram below represents a biological process

1. The diagram below represents a biological process 1. The diagram below represents a biological process 5. The chart below indicates the elements contained in four different molecules and the number of atoms of each element in those molecules. Which set

More information

Guidance Module overview and maps

Guidance Module overview and maps This module is equivalent in extent to three of the earlier modules B1 B3 or B4 B6. There are three broad aims: to extend the coverage of key biological science (e.g. photosynthesis), and to develop a

More information

Transcription, Translation & Protein Synthesis

Transcription, Translation & Protein Synthesis Transcription, Translation & Protein Synthesis Do you remember what proteins are made of? Hundreds of Amino Acids link together to make one Protein There are 20 types of amino acids, some we can make,

More information

Cellular Respiration: Practice Questions #1

Cellular Respiration: Practice Questions #1 Cellular Respiration: Practice Questions #1 1. Which statement best describes one of the events taking place in the chemical reaction? A. Energy is being stored as a result of aerobic respiration. B. Fermentation

More information

Unit 6 Study Guide Protein Name pg I can tell the difference between mrna, trna, and rrna.

Unit 6 Study Guide Protein Name pg I can tell the difference between mrna, trna, and rrna. Unit 6 Study Guide Protein Name pg. 1 1. I can tell the difference between mrna, trna, and rrna. Messenger RNA (mrna) acts as a copy of the instructions for making a protein. mrna carries these instructions

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Unit 5 Photosynthesis and Cellular Respiration

Unit 5 Photosynthesis and Cellular Respiration Unit 5 Photosynthesis and Cellular Respiration Advanced Concepts What is the abbreviated name of this molecule? What is its purpose? What are the three parts of this molecule? Label each part with the

More information

Amino Acids, Peptides, Proteins

Amino Acids, Peptides, Proteins Amino Acids, Peptides, Proteins Functions of proteins: Enzymes Transport and Storage Motion, muscle contraction Hormones Mechanical support Immune protection (Antibodies) Generate and transmit nerve impulses

More information

Topic 3: Nutrition, Photosynthesis, and Respiration

Topic 3: Nutrition, Photosynthesis, and Respiration 1. Base your answer to the following question on the chemical reaction represented below and on your knowledge of biology. If this reaction takes place in an organism that requires sunlight to produce

More information

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme. Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.

More information

pathway that involves taking in heat from the environment at each step. C.

pathway that involves taking in heat from the environment at each step. C. Study Island Cell Energy Keystone Review 1. Cells obtain energy by either capturing light energy through photosynthesis or by breaking down carbohydrates through cellular respiration. In both photosynthesis

More information

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page

More information

Protein Physics. A. V. Finkelstein & O. B. Ptitsyn LECTURE 1

Protein Physics. A. V. Finkelstein & O. B. Ptitsyn LECTURE 1 Protein Physics A. V. Finkelstein & O. B. Ptitsyn LECTURE 1 PROTEINS Functions in a Cell MOLECULAR MACHINES BUILDING BLOCKS of a CELL ARMS of a CELL ENZYMES - enzymatic catalysis of biochemical reactions

More information

PRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY

PRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY Name PRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY Cell Structure Identify animal, plant, fungal and bacterial cell ultrastructure and know the structures functions. Plant cell Animal cell

More information

BIOLÓGIA ANGOL NYELVEN

BIOLÓGIA ANGOL NYELVEN ÉRETTSÉGI VIZSGA 2010. május 12. BIOLÓGIA ANGOL NYELVEN EMELT SZINTŰ ÍRÁSBELI VIZSGA 2010. május 12. 8:00 Az írásbeli vizsga időtartama: 240 perc Pótlapok száma Tisztázati Piszkozati OKTATÁSI ÉS KULTURÁLIS

More information

Exercise 7: DNA and Protein Synthesis

Exercise 7: DNA and Protein Synthesis Exercise 7: DNA and Protein Synthesis Introduction DNA is the code of life, and it is the blueprint for all living things. DNA is contained in all cells, and it is replicated every time a cell divides.

More information

BIOLOGY 2a SUMMARY SHEET

BIOLOGY 2a SUMMARY SHEET BIOLOGY 2a SUMMARY SHEET B2.1.1 CELLS Most human and animal cells have the following parts. NUCLEUS controls the activities of the cell CYTOPLASM where most of the chemical reactions take place CELL MEMBRANE

More information

Honors Biology Practice Questions #1. Name. 6. Seastars have a diploid number of 24 chromosomes. The haploid number would be

Honors Biology Practice Questions #1. Name. 6. Seastars have a diploid number of 24 chromosomes. The haploid number would be Honors Biology Practice Questions #1 1. Donkeys have 68 chromosomes in each body cell. If a donkey cell undergoes meiosis, how many chromosomes should be in each gamete? A. 18 B. 34 C. 68 D. 132 2. A sperm

More information

AS Biology Unit 2 Key Terms and Definitions. Make sure you use these terms when answering exam questions!

AS Biology Unit 2 Key Terms and Definitions. Make sure you use these terms when answering exam questions! AS Biology Unit 2 Key Terms and Definitions Make sure you use these terms when answering exam questions! Chapter 7 Variation 7.1 Random Sampling Sampling a population to eliminate bias e.g. grid square

More information

Given these characteristics of life, which of the following objects is considered a living organism? W. X. Y. Z.

Given these characteristics of life, which of the following objects is considered a living organism? W. X. Y. Z. Cell Structure and Organization 1. All living things must possess certain characteristics. They are all composed of one or more cells. They can grow, reproduce, and pass their genes on to their offspring.

More information

Exampro GCSE Biology. B3.3 Homeostasis. Name: Class: Foundation tier. Author: Date: Time: 80. Marks: 80. Comments: Page 1 of 35

Exampro GCSE Biology. B3.3 Homeostasis. Name: Class: Foundation tier. Author: Date: Time: 80. Marks: 80. Comments: Page 1 of 35 Exampro GCSE Biology B3.3 Homeostasis Foundation tier Name: Class: Author: Date: Time: 80 Marks: 80 Comments: Page of 35 Q. People with kidney disease may be treated by dialysis. The diagram shows a dialysis

More information

Keystone Review Practice Test Module B Continuity and Unity of Life

Keystone Review Practice Test Module B Continuity and Unity of Life Keystone Review Practice Test Module B Continuity and Unity of Life 1. Which event most likely occurs next in mitosis? a. The chromatin condenses. b. The nuclear envelope dissolves. c. The chromosomes

More information

PiXL AQA Knowledge Test ANSWERS Unit 2 Biology 2 B2 GCSE Additional Science for certification June 2014 onwards

PiXL AQA Knowledge Test ANSWERS Unit 2 Biology 2 B2 GCSE Additional Science for certification June 2014 onwards AQA Knowledge test ANSWERS Unit 2 Biology B2.1_Cells and Simple cell transport B2.1.1 Cells and cell structure 1. What are the main parts of animal cells? Nucleus, cytoplasm, cell membrane, mitochondria,

More information

DNA Lecture II Protein Synthesis Notes. Using the Code of Life DNA & RNA. Page #1 (Stratton 2010) Name: 2. : production of proteins

DNA Lecture II Protein Synthesis Notes. Using the Code of Life DNA & RNA. Page #1 (Stratton 2010) Name: 2. : production of proteins Page #1 Using the Code of Life DNA & RNA Slide #2 Two process involve DNA : making an copy of DNA a. purpose: b. occurs: c. uses: DNA : production of proteins a. purpose: & b. occurs: between nucleus &

More information

Photosynthesis & Cellular Respiration. Hot Seat

Photosynthesis & Cellular Respiration. Hot Seat Photosynthesis & Cellular Respiration Hot Seat Hot Seat Instructions You are competing against classmates in your row (across the classroom). The hot seat is the seat in each row closest to the outside

More information

10.1 The function of Digestion pg. 402

10.1 The function of Digestion pg. 402 10.1 The function of Digestion pg. 402 Macromolecules and Living Systems The body is made up of more than 60 % water. The water is found in the cells cytoplasm, the interstitial fluid and the blood (5

More information

Cellular Energy. 1. Photosynthesis is carried out by which of the following?

Cellular Energy. 1. Photosynthesis is carried out by which of the following? Cellular Energy 1. Photosynthesis is carried out by which of the following? A. plants, but not animals B. animals, but not plants C. bacteria, but neither animals nor plants D. all living organisms 2.

More information

B2.1 Cells and simple cell transport. B2.2 Tissues, organs and organ systems

B2.1 Cells and simple cell transport. B2.2 Tissues, organs and organ systems B2.1.1 Cells and simple cell transport B2.1 Cells and simple cell transport Know that most human and animal cells have the following parts: a nucleus, which controls the activities of the cell; cytoplasm,

More information

Shu-Ping Lin, Ph.D. E-mail: splin@dragon.nchu.edu.tw

Shu-Ping Lin, Ph.D. E-mail: splin@dragon.nchu.edu.tw Amino Acids & Proteins Shu-Ping Lin, Ph.D. Institute te of Biomedical Engineering ing E-mail: splin@dragon.nchu.edu.tw Website: http://web.nchu.edu.tw/pweb/users/splin/ edu tw/pweb/users/splin/ Date: 10.13.2010

More information

CHAPTER 4. Section 1 Do we get energy from food?

CHAPTER 4. Section 1 Do we get energy from food? Section 1 Do we get energy from food? CHAPTER 4 Food contains energy but it has to be broken down in order to be used. That means that energy comes from food but not directly. All cells, including plant

More information

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain?

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain? Networked Systems, COMPGZ01, 2012 Answer TWO questions from Part ONE on the answer booklet containing lined writing paper, and answer ALL questions in Part TWO on the multiple-choice question answer sheet.

More information

ECO-1.1: I can describe the processes that move carbon and nitrogen through ecosystems.

ECO-1.1: I can describe the processes that move carbon and nitrogen through ecosystems. Cycles of Matter ECO-1.1: I can describe the processes that move carbon and nitrogen through ecosystems. ECO-1.2: I can explain how carbon and nitrogen are stored in ecosystems. ECO-1.3: I can describe

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

Life Sciences Paper 1

Life Sciences Paper 1 Learning Channel (Pty) Ltd 3rd Floor, The Mills 66 Carr Street Newtown Johannesburg (011) 639-0179 Website: www.learn.co.za National Senior Certificate Grade 12 Life Sciences Paper 1 Other products for

More information

Protein Synthesis. Contents. Introduction. DNA Transcription

Protein Synthesis. Contents. Introduction. DNA Transcription Protein Synthesis Contents Introduction... 1 DNA Transcription... 1 The Primary Transcript... 4 Translation... 7 Protein Structure... 11 References... 11 Resources... 11 Introduction The genetic message

More information

Attributes of Living Organisms

Attributes of Living Organisms The Nature of Life Outline Attributes of Living Organisms Chemical and Physical Bases of Life Molecules Bonds and Ions Acids and Bases Elements in Cells Carbohydrates, Lipids, Proteins Enzymes Nucleic

More information

CHAPTER 16: ANSWERS TO SELECTED PROBLEMS

CHAPTER 16: ANSWERS TO SELECTED PROBLEMS CATER 16: ASWERS T SELECTED RBLEMS SAMLE RBLEMS ( Try it yourself ) 16.1 Connecting the base guanine (shown in Table 16.1) with ribose and phosphate gives the structure of GM. C 2 2 16.2 The complementary

More information

A. Definition of biology - Biology is the study of life.

A. Definition of biology - Biology is the study of life. Introduction to Biology and Chemistry Outline I. Introduction to biology A. Definition of biology - Biology is the study of life. B. Characteristics of Life 1. Form and size are characteristic. e.g. A

More information

the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids

the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids and their sub-units; the role of lipids in the plasma

More information

2. Which type of macromolecule contains high-energy bonds and is used for long-term energy storage?

2. Which type of macromolecule contains high-energy bonds and is used for long-term energy storage? Energy Transport Study Island 1. During the process of photosynthesis, plants use energy from the Sun to convert carbon dioxide and water into glucose and oxygen. These products are, in turn, used by the

More information

Lesson Overview. Fermentation. Lesson Overview 13.1 RNA

Lesson Overview. Fermentation. Lesson Overview 13.1 RNA Lesson Overview 13.1 RNA Similarities between DNA & RNA They are both nucleic acids They both have: a 5-carbon sugar, a phosphate group, a nitrogenous base. Comparing RNA and DNA There are three important

More information

Life. In nature, we find living things and non living things. Living things can move, reproduce, as opposed to non living things.

Life. In nature, we find living things and non living things. Living things can move, reproduce, as opposed to non living things. Computat onal Biology Lecture 1 Life In nature, we find living things and non living things. Living things can move, reproduce, as opposed to non living things. Both are composed of the same atoms and

More information

2. What kind of energy is stored in food? A. chemical energy B. heat energy C. kinetic energy D. light energy

2. What kind of energy is stored in food? A. chemical energy B. heat energy C. kinetic energy D. light energy Assessment Bank Matter and Energy in Living Things SC.8.L.18.4 1. What is energy? A. anything that takes up space B. anything that has mass C. the ability to conduct current D. the ability to do work 2.

More information

GCSE Additional Science

GCSE Additional Science GCSE Additional Science Module B4 The processes of life: What you should know Name: Science Group: Teacher: R.A.G. each of the statements to help focus your revision: R = Red: I don t know this A = Amber:

More information

Page 1. Name: 1) The diagram below represents one possible immune response that can occur in the human body.

Page 1. Name: 1) The diagram below represents one possible immune response that can occur in the human body. Name: 8931-1 - Page 1 1) The diagram below represents one possible immune response that can occur in the human body. 5) One similarity between cell receptors and antibodies is that both A) are involved

More information

MCAS Biology. Review Packet

MCAS Biology. Review Packet MCAS Biology Review Packet 1 Name Class Date 1. Define organic. THE CHEMISTRY OF LIFE 2. All living things are made up of 6 essential elements: SPONCH. Name the six elements of life. S N P C O H 3. Elements

More information

Biochemistry of Cells

Biochemistry of Cells Biochemistry of Cells 1 Carbon-based Molecules Although a cell is mostly water, the rest of the cell consists mostly of carbon-based molecules Organic chemistry is the study of carbon compounds Carbon

More information

Topic 1 revision. The building blocks of life. Class revision with exam questions

Topic 1 revision. The building blocks of life. Class revision with exam questions B2 Topic 1 revision The building blocks of life Class revision with exam questions Animal cells What is aerobic respiration? Aerobic respiration is the process of releasing energy through the oxidation

More information

SCORING KEY AND RATING GUIDE

SCORING KEY AND RATING GUIDE FOR TEACHERS ONLY The University of the State of New York Le REGENTS HIGH SCHOOL EXAMINATION LIVING ENVIRONMENT Tuesday, August 13, 2002 12:30 to 3:30 p.m., only SCORING KEY AND RATING GUIDE Directions

More information