Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects

Save this PDF as:

Size: px
Start display at page:

Download "Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects"


1 Mutation Mutation provides raw material to evolution Different kinds of mutations have different effects

2 Mutational Processes Point mutation single nucleotide changes coding changes (missense mutations) silent-site changes stop codons (nonsense mutations) control region changes Insertion and deletion Frameshift Larger events Duplication Inversion and translocation

3 Causes of Mutation Replication errors Chemical damage can include crosslinked bases, modified bases Radiation damage often single and double-strand breaks Transposition Viral insertion Unequal crossing-over

4 Mutation Rates Table taken from Farnsworth These are rates per locus, not per site; they were estimated by observing phenotypes. E. coli histidine auxotrophy 2x10 6 streptomycin sensitivity 1x10 8 phage T1 resistance 2 3x10 8 Drosophila males brown eyes 3x10 5 eyeless 6x10 5 yellow body 1.2x10 4 Corn colorless kernel 2x10 6 shrunken kernel 1.2x10 6 Human achondroplasia 1x10 5 aniridia 2.9x10 6 retinoblastoma 6 7x10 6 However, organisms such as HIV virus which do not proofread have mutation rates on the order of 10 3 or even higher.

5 Silent, coding, and control mutations The nature of the genetic code means that some mutations will be silent, meaning that they don t change the protein sequence. The structure of the code means that most first-position and all secondposition mutations are coding, whereas most third-position mutations are silent. In general, we expect silent mutations to have no fitness effect. This may not be true if the coding sequence also has control functions; the silent mutation may affect control of the gene.

6 Mutation Rates Silent and coding sites generally have the same underlying mutation rate However, many mutations at coding sites are lost This produces the appearance of a lower mutation rate It s really a higher loss rate


8 The Standard Genetic Code First Position (5' end) U C A G Second Position U C A G UUU Phe UCU Ser UAU Tyr UGU Cys Third Position (3' end) UUC Phe UCC Ser UAC Tyr UGC Cys C UUA Leu UCA Ser UAA Stop UGA Stop A UUG Leu UCG Ser UAG Stop UGG Trp G CUU Leu CCU Pro CAU His CGU Arg U CUC Leu CCC Pro CAC His CGC Arg C CUA Leu CCA Pro CAA Gln CGA Arg A CUG Leu CCG Pro CAG Gln CGG Arg G AUU Ile ACU Thr AAU Asn AGU Ser U AUC Ile ACC Thr AAC Asn AGC Ser C AUA Ile ACA Thr AAA Lys AGA Arg A AUG Met Start ACG Thr AAG Lys AGG Arg G GUU Val GCU Ala GAU Asp GGU Gly U GUC Val GCC Ala GAC Asp GGC Gly C GUA Val GCA Ala GAA Glu GGA Gly A GUG Val GCG Ala GAG Glu GGG Gly G U Start Codon Stop Codon Nonpolar Side Chain

9 Codon bias Each organism uses some codons more often than others This bias varies among species Two possible causes: Mutation process may be asymmetrical Some trnas may be better or more abundant than others, so a gene which uses popular codons may be translated faster If the second idea is correct, this is a case where silent sites are not completely neutral

10 Mutation without selection Mutation rates at a locus are often asymmetrical, with more mutations to the nonfunctional state it is easier to break a gene than repair it. The mutation rate from normal to mutant is often written as µ and the reverse as ν. An equilibrium is reached at: pa = ν ν + µ Usually pa is very small at equilibrium. The evolutionary implication is that genes with no use, and therefore no selection, are expected to deteriorate. However, the process is very slow for normal mutation rates.

11 Mutation without selection Suppose there are 100 sites in a gene which will destroy function if they mutate, and each mutates with a probability of Reverse mutation has to hit the same site, and has to restore the old base pair. µ = 10 7 ν = 0.33x10 9 What happens in one generation? Allele A a Frequency before mutation Frequency after mutation (Note that the effect of reverse mutation is so tiny it can t be seen.)

12 Mutation without selection

13 Genomic deterioration Note the millions of generations in previous slide Are we damaging our gene pool by using medicine? Such effects would take a very long time 1 million human generations = 20 million years

14 McClintock s genome shock hypothesis Barbara McClintock showed that transposition in maize increases when the plant is stressed drought salt insects Her genome shock theory is that mutation gives the plant a chance to fix a bad situation If this is true, transposons could be beneficial Alternative is that a sick plant loses control of its transposons In this view they are harmful selfish DNA Hard to test this theory

15 How low can mutation rate go? The bacterium Deinococcus radiodurans was discovered growing on irradiated meat. It can withstand 1000 times as much radiation as a human cell. This is enough radiation to break its single chromosome into about 100 pieces. It arrests (stops dividing), repairs its chromosome, and continues. Very few mutations are produced.

16 Very good replication fidelity is possible The full genome of D. radiodurans has been sequenced recently. It has unusually large numbers of DNA-repair genes, but no new repair mechanisms have so far been discovered. The organism may have evolved this capability to deal with DNA damage during extreme drought and sunlight conditions. It is being studied as a cleanup bacterium for mixed chemical and radioactive wastes. It can t help with the radioactivity, but at least it isn t killed and can biodegrade the chemicals.

17 Very good replication fidelity is possible Presumably other cells could repair as well as D. radiodurans, but they don t. Is this because such repair is too expensive, or because having a higher mutation rate is actually an advantage? (I don t know the answer.)

18 Mutation rates in perspective Human genome has 6x10 9 bp. Point mutation rate around 1x10 9 per bp per generation Human population around 7 billion Every point mutation compatible with life exists somewhere Every human has several new point mutations

Hands on Simulation of Mutation

Hands on Simulation of Mutation Hands on Simulation of Mutation Charlotte K. Omoto P.O. Box 644236 Washington State University Pullman, WA 99164-4236 ABSTRACT This exercise is a hands-on simulation of mutations and their

More information

Aipotu Part III: Molecular Biology

Aipotu Part III: Molecular Biology Aipotu Part III: Molecular Biology Introduction: The Biological Phenomenon Under Study In this lab, you will continue to explore the biological mechanisms behind the expression of flower color in a hypothetical

More information

Gene Finding CMSC 423

Gene Finding CMSC 423 Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher

More information

Solution Key Problem Set 3

Solution Key Problem Set 3 Solution Key- 7.016 Problem Set 3 Question 1 The following human pedigree shows the inheritance pattern of a specific disease within a family. Assume that the individuals marrying into the family for all

More information

The Structure and Function of DNA

The Structure and Function of DNA Chapter 0 The Structure and Function of PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey,

More information

In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA.

In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA. In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA. For each student: Science notebook Reproducible Master 6, Cooking Up a Protein

More information

Molecular Facts and Figures

Molecular Facts and Figures Nucleic Acids Molecular Facts and Figures DNA/RNA bases: DNA and RNA are composed of four bases each. In DNA the four are Adenine (A), Thymidine (T), Cytosine (C), and Guanine (G). In RNA the four are

More information

( TUTORIAL. (July 2006)

( TUTORIAL. (July 2006) ( TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA

More information

Beloit College BIOL Emerging Infectious Diseases

Beloit College BIOL Emerging Infectious Diseases Virus classification and life cycle activity For reference Transcription: Krasner p 131 Translation: Krasner p 132-135 Genetic code: Krasner p 135 A virus is an obligate intracellular parasite, meaning

More information

Section 1 Workbook (unit 2) ANSWERS

Section 1 Workbook (unit 2) ANSWERS Section 1 Workbook (unit 2) ANSWERS Complete the following table: nucleotide DNA RN Name: B5. Describe DNA replication 1) Label each base given in the diagram below and describe the 4 primary characteristics

More information

Chapter 1: Bio Primer

Chapter 1: Bio Primer Chapter 1: Bio Primer 1.1 Cell Structure; DNA; RNA; transcription; translation; proteins Prof. Yechiam Yemini (YY) Computer Science Department Columbia University COMS 4761 --2007 Overview Cell structure

More information

Gene Finding. Slides by Carl Kingsford

Gene Finding. Slides by Carl Kingsford Gene Finding Slides by Carl Kingsford Genome of the Cow a sequence of 2.86 billion letters enough letters to fill a million pages of a typical book. TATGGAGCCAGGTGCCTGGGGCAACAAGACTGTGGTCACTGAATTCATCCTTCTTGGTCTAACAGAGAACATAG

More information

Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus

Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus Cao, H.W. and Zhang, H.* College of Biological Science and Technology, HeiLongJiang BaYi Agricultural University, DaQing 163319, China. *

More information

Cambridge International Examinations Cambridge International Advanced Level

Cambridge International Examinations Cambridge International Advanced Level Cambridge International Examinations Cambridge International Advanced Level CHEMISTRY 9701/42 Paper 4 Structured Questions May/June 2014 2 hours Candidates answer on the Question Paper. Additional Materials:

More information

Protein Synthesis Simulation

Protein Synthesis Simulation Protein Synthesis Simulation Name(s) Date Period Benchmark: SC.912.L.16.5 as AA: Explain the basic processes of transcription and translation, and how they result in the expression of genes. (Assessed

More information

Review of Central Dogma; Simple Mendelian Inheritance

Review of Central Dogma; Simple Mendelian Inheritance . Genome 371 Spring, 2005 Review of Central Dogma; Simple Mendelian Inheritance Problem Set #1 (not for credit): Problems 1-18 test your knowledge of the central dogma. The remaining problems are related

More information

Cathryn Kurkjian, PhD Postdoctoral Trainee University of North Carolina, Chapel Hill.

Cathryn Kurkjian, PhD Postdoctoral Trainee University of North Carolina, Chapel Hill. [Type here] [Type here] [Type here], PhD Postdoctoral Trainee University of North Carolina, Chapel Hill Email: Twitter: @Cate_Kurkjian Image from:

More information DNA Bracelets DNA Bracelets DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct

More information

Gene Translation:RNA -> Protein

Gene Translation:RNA -> Protein Gene Translation:RN -> Protein How does a particular sequence of nucleotides specify a particular sequence of amino acids? The answer: by means of transfer RN molecules, each specific for one amino acid

More information

Synonymous Codon Usage in Lactococcus lactis: Mutational Bias Versus Translational Selection

Synonymous Codon Usage in Lactococcus lactis: Mutational Bias Versus Translational Selection Journal of Biomolecular Structure & Dynamics, ISSN 0739-1102 Volume 21, Issue Number 4, (2004) Adenine Press (2004) Abstract Synonymous Codon Usage in Lactococcus lactis: Mutational Bias Versus Translational

More information

Hiding Data in DNA. 1 Introduction

Hiding Data in DNA. 1 Introduction Hiding Data in DNA Boris Shimanovsky *, Jessica Feng +, and Miodrag Potkonjak + * XAP Corporation + Dept. Computer Science, Univ. of California, Los Angeles Abstract. Just like disk or RAM, DNA and RNA

More information

Biological One-way Functions

Biological One-way Functions Biological One-way Functions Qinghai Gao, Xiaowen Zhang 2, Michael Anshel 3 Dept. Security System, Farmingdale State College / SUNY,

More information

Introduction to Molecular Genetics

Introduction to Molecular Genetics Introduction to Molecular Genetics I. Introduction: A. ave you thought much about why you are like your parents, and your kids are (will be) like you? 1. Inherited traits result from the transfer of specific

More information

Students complete all index cards. 10 min. Completion of the anticipation guide.

Students complete all index cards. 10 min. Completion of the anticipation guide. 1 Tuesday, June 9 Objective Domain: Cells and Heredity Students explain the process of inheritance of genetic traits. Students differentiate between DNA and RNA, recognizing the role of each in heredity.

More information

Grundlagen der Bioinformatik, SS 08, D. Huson, April 21,

Grundlagen der Bioinformatik, SS 08, D. Huson, April 21, Grundlagen der Bioinformatik, SS 08, D. Huson, April 21, 2008 7 2 Introduction to Molecular Biology We will start with a very short repetition of the basics of molecular biology, including a summary of

More information

DELIVERY GUIDE Topic: You and your genes

DELIVERY GUIDE Topic: You and your genes DELIVERY GUIDE Topic: You and your genes June 2015 GCSE (9 1) Twenty First Century Biology B GCSE REFORM Oxford Cambridge and RSA We will inform centres about any changes to the specification. We will

More information

Answers and Solutions to Text Problems

Answers and Solutions to Text Problems 22 Answers and Solutions to Text roblems 22.1 DA contains two purines, adenine (A) and guanine (G) and two pyrimidines, cytosine (C) and thymine (T). RA contains the same bases, except thymine (T) is replaced

More information

Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook)

Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook) Name Date Per Look at the diagrams, then answer the questions. Gene Mutations affect a single gene by changing its base sequence, resulting in an incorrect, or nonfunctional, protein being made. (a) A

More information

DNA pol RNA pol ARS trna Ribosome DNA mrna Protein Transcription Translation Replication A B Acceptor stem D-loop T C loop Anticodon loop Variable loop Relative trna gene copy number 0.0 0.2 0.4

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

Insulin mrna to Protein Kit

Insulin mrna to Protein Kit Insulin mrna to Protein Kit A 3DMD Paper BioInformatics and Mini-Toober Folding Activity Teacher Key and Teacher Notes www. Insulin mrna to Protein Kit Contents Becoming Familiar with the Data... 3 Identifying

More information

Woods Biol Hmwk DNA & Genetic Engineering (key) Pg. 1

Woods Biol Hmwk DNA & Genetic Engineering (key) Pg. 1 Woods Biol Hmwk-6 10-1 DNA & Genetic Engineering (key) Pg. 1 NOTE: Unless otherwise indicated in the problem, DNA will be from the Template strand. Figure 1: Look carefully at Fig s 1 & 2 to determine

More information


UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS UIT (12) MLECULE F LIFE: UCLEIC ACID ucleic acids are extremely large molecules that were first isolated from the nuclei of cells. Two kinds of nucleic acids are found in cells: RA (ribonucleic acid) is

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:

More information


CHAPTER 16: ANSWERS TO SELECTED PROBLEMS CATER 16: ASWERS T SELECTED RBLEMS SAMLE RBLEMS ( Try it yourself ) 16.1 Connecting the base guanine (shown in Table 16.1) with ribose and phosphate gives the structure of GM. C 2 2 16.2 The complementary

More information

Transcription, Translation & Protein Synthesis

Transcription, Translation & Protein Synthesis Transcription, Translation & Protein Synthesis Do you remember what proteins are made of? Hundreds of Amino Acids link together to make one Protein There are 20 types of amino acids, some we can make,

More information

Keywords: synonymous codon usage, mutational bias, multivariate statistical analysis, optimal codons. ABSTRACT

Keywords: synonymous codon usage, mutational bias, multivariate statistical analysis, optimal codons. ABSTRACT Statistical Analysis of codon usage in extremely halophilic bacterium, Salinibacter ruber DSM 13855 Sanjukta RK 1, Farooqi MS 1*, Sharma N 1, Rai N 2, Mishra DC 1, Rai A 1, Singh DP 3 and Chaturvedi KK

More information

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations Introduction: In biology, mutations are changes to the base

More information

Protein Synthesis. Contents. Introduction. DNA Transcription

Protein Synthesis. Contents. Introduction. DNA Transcription Protein Synthesis Contents Introduction... 1 DNA Transcription... 1 The Primary Transcript... 4 Translation... 7 Protein Structure... 11 References... 11 Resources... 11 Introduction The genetic message

More information

Codon Usage Bias and Determining Forces in Taenia solium Genome

Codon Usage Bias and Determining Forces in Taenia solium Genome ISSN (Print) 23-41 ISSN (Online) 1738-6 ORIGINAL ARTICLE Korean J Parasitol Vol. 53, No. 6: 689-697, December 215 Codon Usage Bias and Determining Forces in Taenia

More information



More information

Unit 6 Study Guide Protein Name pg I can tell the difference between mrna, trna, and rrna.

Unit 6 Study Guide Protein Name pg I can tell the difference between mrna, trna, and rrna. Unit 6 Study Guide Protein Name pg. 1 1. I can tell the difference between mrna, trna, and rrna. Messenger RNA (mrna) acts as a copy of the instructions for making a protein. mrna carries these instructions

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:.

More information


B5 B8 ANWERS DNA & ) DNA Review sheet for test B5 B8 ANWERS DNA review 1. What bonds hold complementary bases between 2 strands of DNA together? Hydrogen bonds 2. What bonds exist between sugars and phosphates? Covalent bonds

More information

Ribosomal Protein Synthesis

Ribosomal Protein Synthesis 1 1 Ribosomal Protein Synthesis Prof. Dr. Wolfgang Wintermeyer 1, Prof. Dr. Marina V. Rodnina 2 1 Institut f r Molekularbiologie, Universit t Witten/Herdecke, Stockumer Stra e 10, 58448 Witten, Germany;

More information

DNA and Protein Synthesis Grade 10

DNA and Protein Synthesis Grade 10 Ohio Standards Connection: Life Sciences Benchmark C Explain the genetic mechanisms and molecular basis of inheritance. Indicator 5 Illustrate the relationship of the structure and function of DNA to protein

More information

Translation Activity Guide

Translation Activity Guide Translation Activity Guide Teacher Key β-globin Translation Translation occurs in the cytoplasm of the cell and is defined as the synthesis of a protein (polypeptide) using information encoded in an mrna

More information

Mutations and Genetic Variability. 1. What is occurring in the diagram below?

Mutations and Genetic Variability. 1. What is occurring in the diagram below? Mutations and Genetic Variability 1. What is occurring in the diagram below? A. Sister chromatids are separating. B. Alleles are independently assorting. C. Genes are replicating. D. Segments of DNA are

More information

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized: Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How

More information

Roadmap. Optimal mutation rate

Roadmap. Optimal mutation rate Roadmap Optimal mutation rate Dominance and its implications Why is an allele dominant or recessive? Overdominance (heterozygote advantage) Underdominance (heterozygote inferiority) One minute responses

More information

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

Ruth Sundeen. Lesson 9 Part 1. Help Your Students Learn. Greetings and felicitations from Mrs. Ruth!

Ruth Sundeen. Lesson 9 Part 1. Help Your Students Learn. Greetings and felicitations from Mrs. Ruth! Ruth Sundeen Lesson 9 Part 1 Help Your Students Learn Ages: Eighth grade to high school senior Topics: Protein Synthesis Enzymes Experiment to demonstrate fragility of enzymes Greetings and felicitations

More information

Mutation, Repair, and Recombination

Mutation, Repair, and Recombination 16 Mutation, Repair, and Recombination WORKING WITH THE FIGURES 1. In Figure 16-3a, what is the consequence of the new 5 splice site on the open reading frame? In 16-3b, how big could the intron be to

More information

Solutions to Problem Set 5

Solutions to Problem Set 5 Question 1 Solutions to 7.014 Problem Set 5 a) Which of the following molecules functions directly to transfer information from the nucleus to the cytoplasm? ircle all that apply. DN mrn trn transporter

More information


CHALLENGES IN THE HUMAN GENOME PROJECT REPRINT: originally published as: Robbins, R. J., 1992. Challenges in the human genome project. IEEE Engineering in Biology and Medicine, (March 1992):25 34. CHALLENGES IN THE HUMAN GENOME PROJECT PROGRESS

More information

DNA: Molecule of Life

DNA: Molecule of Life DNA: Molecule of Life History DNA Structure Protein Synthesis Gene Regulation History of DNA H I S T O By the 1940 s, scientists knew that chromosomes consisted of both DNA and protein but did not know

More information

On the evolution of codon usage bias

On the evolution of codon usage bias University of Tennessee, Knoxville Trace: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 5-2011 On the evolution of codon usage bias Premal R. Shah Recommended

More information

Molecular Biology Basic Concepts

Molecular Biology Basic Concepts Molecular Biology Basic Concepts Prof. Dr. Antônio Augusto Fröhlich Charles Ivan Wust LISHA - UFSC {guto charles}{guto charles} September 2003 September 2003

More information

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme. Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.

More information

trna and Protein Building Lab Date Period

trna and Protein Building Lab Date Period trna and Protein Building Lab Name Date Period Purpose: RNA produced in the nucleus of a cell moves out of the nucleus to the cell s ribosomes. This RNA is a specific sequence of bases copied from the

More information

Codon usage bias is correlated with gene expression levels in the fission yeast Schizosaccharomyces pombe

Codon usage bias is correlated with gene expression levels in the fission yeast Schizosaccharomyces pombe Codon usage bias is correlated with gene expression levels Blackwell Y Hiraoka usage Publishing et al. bias in fission Inc yeast in the fission yeast Schizosaccharomyces pombe Yasushi Hiraoka 1,2,3, *,

More information


The p53 MUTATION HANDBOOK The p MUTATION HANDBOOK Version 1. /7 Thierry Soussi Christophe Béroud, Dalil Hamroun Jean Michel Rubio Nevado http://p/ The p Mutation HandBook By T Soussi, J.M. Rubio-Nevado, D. Hamroun and C.

More information


REVISING DNA AND PROTEIN SYNTHESIS (LIVE) 01 JULY 2015 Exam Questions REVISING DNA AND PROTEIN SYNTHESIS (LIVE) 01 JULY 2015 Exam Questions Question 1 (Adapted from Feb/March 2015 Paper 2 DBE, Question 1.4) The diagram below represents DNA replication. 1.1 Identify the following:

More information

Lecture #19 10/19/01 Dr. Wormington

Lecture #19 10/19/01 Dr. Wormington Lecture #19 10/19/01 Dr. Wormington Additional Features of the Genetic Code Codon Redundancy or Degeneracy Reflects the Relative Prevalence of an Amino Acid e.g., Ser & Leu each have 6 codons whereas Tyr

More information

2006 7.012 Problem Set 3 KEY

2006 7.012 Problem Set 3 KEY 2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each

More information

Lesson Overview. Fermentation. Lesson Overview 13.1 RNA

Lesson Overview. Fermentation. Lesson Overview 13.1 RNA Lesson Overview 13.1 RNA Similarities between DNA & RNA They are both nucleic acids They both have: a 5-carbon sugar, a phosphate group, a nitrogenous base. Comparing RNA and DNA There are three important

More information

Chapter 22. Nucleic Acids 22.1 Types of Nucleic Acids 22.2 Nucleotides: Building Blocks of Nucleic Acids 22.3 Primary Nucleic Acid Structure 22.

Chapter 22. Nucleic Acids 22.1 Types of Nucleic Acids 22.2 Nucleotides: Building Blocks of Nucleic Acids 22.3 Primary Nucleic Acid Structure 22. Chapter 22. Nucleic Acids 22.1 Types of Nucleic Acids 22.2 Nucleotides: Building Blocks of Nucleic Acids 22.3 Primary Nucleic Acid Structure 22.4 The DNA Double Helix 22.5 Replication of DNA Molecules

More information

7-9/99 Neuman Chapter 23. Structures of Nucleic Acids Replication, Transcription, and Translation Nucleotide Biosynthesis and Degradation

7-9/99 Neuman Chapter 23. Structures of Nucleic Acids Replication, Transcription, and Translation Nucleotide Biosynthesis and Degradation 23: Nucleic Acids Structures of Nucleic Acids Replication, Transcription, and Translation Nucleotide Biosynthesis and Degradation Preview Nucleic acids (DNA and RNA) perform a variety of crucial functions

More information

The University of the State of New York REGENTS HIGH SCHOOL EXAMINATION LIVING ENVIRONMENT. Tuesday, January 25, 2011 9:15 a.m. to 12:15 p.m.

The University of the State of New York REGENTS HIGH SCHOOL EXAMINATION LIVING ENVIRONMENT. Tuesday, January 25, 2011 9:15 a.m. to 12:15 p.m. LIVING ENVIRONMENT The University of the State of New York REGENTS HIGH SCHOOL EXAMINATION LIVING ENVIRONMENT Tuesday, January 25, 2011 9:15 a.m. to 12:15 p.m., only Student Name School Name Notice...

More information

NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document.

NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document. Chapter 8 Study Guide What is the study of genetics, and what topics does it focus on? What is a genome? NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document. Describe

More information

DNA Lecture II Protein Synthesis Notes. Using the Code of Life DNA & RNA. Page #1 (Stratton 2010) Name: 2. : production of proteins

DNA Lecture II Protein Synthesis Notes. Using the Code of Life DNA & RNA. Page #1 (Stratton 2010) Name: 2. : production of proteins Page #1 Using the Code of Life DNA & RNA Slide #2 Two process involve DNA : making an copy of DNA a. purpose: b. occurs: c. uses: DNA : production of proteins a. purpose: & b. occurs: between nucleus &

More information

Bio 102 Practice Problems Genetic Code and Mutation

Bio 102 Practice Problems Genetic Code and Mutation Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Choose the one best answer: Beadle and Tatum mutagenized Neurospora to find

More information

Lecture 5 Mutation and Genetic Variation

Lecture 5 Mutation and Genetic Variation 1 Lecture 5 Mutation and Genetic Variation I. Review of DNA structure and function you should already know this. A. The Central Dogma DNA mrna Protein where the mistakes are made. 1. Some definitions based

More information

Investigating the link between trna and mrna abundance in mammals

Investigating the link between trna and mrna abundance in mammals This dissertation is submitted for the degree of Doctor of Philosophy Investigating the link between trna and mrna abundance in mammals Konrad Ludwig Moritz Rudolph May 2015 St Edmund s College, University

More information

Math 30-1: Permutations and Combinations PRACTICE EXAM

Math 30-1: Permutations and Combinations PRACTICE EXAM A. B. C. D. Math 30-1: Permutations and Combinations PRACTICE EXAM n! 1. The expression is equivalent to: (n - 2)! 2. A Grade 12 student is taking Biology, English, Math, and Physics in her first term.

More information

LECTURE 6 Gene Mutation (Chapter 16.1-16.2)

LECTURE 6 Gene Mutation (Chapter 16.1-16.2) LECTURE 6 Gene Mutation (Chapter 16.1-16.2) 1 Mutation: A permanent change in the genetic material that can be passed from parent to offspring. Mutant (genotype): An organism whose DNA differs from the

More information

Mutations. Section 6.3

Mutations. Section 6.3 Section 6.3 Mutations Objectives Identify different changes to DNA within both genes and chromosomes Evaluate effects of changes to DNA on proteins produced and organisms overall survival New Vocabulary

More information


BIOLÓGIA ANGOL NYELVEN ÉRETTSÉGI VIZSGA 2012. május 15. BIOLÓGIA ANGOL NYELVEN EMELT SZINTŰ ÍRÁSBELI VIZSGA 2012. május 15. 8:00 Az írásbeli vizsga időtartama: 240 perc Pótlapok száma Tisztázati Piszkozati NEMZETI ERŐFORRÁS

More information

Central Dogma of Genetics

Central Dogma of Genetics Central Dogma of Genetics Within each cell the genetic information flows from DNA to RNA to protein. This flow of information is unidirectional and irreversible. The information carried within the DNA

More information

Bio 102 Practice Problems Genetic Code and Mutation

Bio 102 Practice Problems Genetic Code and Mutation Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine

More information

Unit 6 ~ Learning Guide

Unit 6 ~ Learning Guide Unit 6 ~ Learning Guide Name: INSTRUCTIONS Complete the following notes and questions as you work through the related lessons. You are required to have this package completed BEFORE you write your unit

More information

Umm AL Qura University MUTATIONS. Dr Neda M Bogari

Umm AL Qura University MUTATIONS. Dr Neda M Bogari Umm AL Qura University MUTATIONS Dr Neda M Bogari CONTACTS From DNA to Mutations MUTATION Definition: Permanent change in nucleotide sequence. It can

More information

Exercise 7: DNA and Protein Synthesis

Exercise 7: DNA and Protein Synthesis Exercise 7: DNA and Protein Synthesis Introduction DNA is the code of life, and it is the blueprint for all living things. DNA is contained in all cells, and it is replicated every time a cell divides.

More information

Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae

Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae Journal of Cell and Molecular Research (2011) 3 (1), 1-11 Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae Fatemeh Moosavi 1, Hassan Mohabatkar

More information

The Puzzle of Life A Lesson Plan for Life S cien ce Teach ers From: The G reat Lakes S cien ce C ent er, C lev elan d, OH

The Puzzle of Life A Lesson Plan for Life S cien ce Teach ers From: The G reat Lakes S cien ce C ent er, C lev elan d, OH Introduction: The Puzzle of Life A Lesson Plan for Life S cien ce Teach ers From: The G reat Lakes S cien ce C ent er, C lev elan d, OH In the Puzzle of Life activity, students will demonstrate how the

More information

Translation. The process of converting the mrna base sequence into amino acid chains or proteins; occurs in the cytoplasm of the cell on ribosomes

Translation. The process of converting the mrna base sequence into amino acid chains or proteins; occurs in the cytoplasm of the cell on ribosomes The process of converting the mrna base sequence into amino acid chains or proteins; occurs in the cytoplasm of the cell on ribosomes The process of converting the mrna base sequence into amino acid chains

More information

From Gene to Protein Transcription and Translation i

From Gene to Protein Transcription and Translation i From Gene to Protein Transcription and Translation i How do the genes in our DNA influence our characteristics? For example, how can a gene determine whether a person is an albino with very pale skin and

More information

Academic Nucleic Acids and Protein Synthesis Test

Academic Nucleic Acids and Protein Synthesis Test Academic Nucleic Acids and Protein Synthesis Test Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. Each organism has a unique combination

More information

Binary Coding, mrna Information and Protein Structure

Binary Coding, mrna Information and Protein Structure Journal of Computing and Information Technology - CIT 12, 2004, 2, 73 81 73 Binary Coding, mrna Information and Protein Structure Nikola Štambuk 1,Paško Konjevoda 1 and Nikola Gotovac 2 1 Ruder Bošković

More information

Mutations & DNA Technology Worksheet

Mutations & DNA Technology Worksheet Mutations & DNA Technology Worksheet Name Section A: Mutations Mutations are changes in DNA. Somatic mutations occur in non-reproductive cells and won't be passed onto offspring. Mutations that occur in

More information

Chapter 9. Applications of probability. 9.1 The genetic code

Chapter 9. Applications of probability. 9.1 The genetic code Chapter 9 Applications of probability In this chapter we use the tools of elementary probability to investigate problems of several kinds. First, we study the language of life by focusing on the universal

More information

From DNA to Proteins

From DNA to Proteins CHAPTER 8 From DNA to Proteins KEY CONCEPTS 8.1 Identifying DNA as the Genetic Material DNA was identified as the genetic material through a series of experiments. 8.2 Structure of DNA DNA structure is

More information

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination

More information

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain?

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain? Networked Systems, COMPGZ01, 2012 Answer TWO questions from Part ONE on the answer booklet containing lined writing paper, and answer ALL questions in Part TWO on the multiple-choice question answer sheet.

More information

Genetics. Chapter 9. Chromosome. Genes Three categories. Flow of Genetics/Information The Central Dogma. DNA RNA Protein

Genetics. Chapter 9. Chromosome. Genes Three categories. Flow of Genetics/Information The Central Dogma. DNA RNA Protein Chapter 9 Topics - Genetics - Flow of Genetics/Information - Regulation - Mutation - Recombination gene transfer Genetics Genome - the sum total of genetic information in a organism Genotype - the A's,

More information

Microbial Genetics (Chapter 8) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College. Eastern Campus

Microbial Genetics (Chapter 8) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College. Eastern Campus Microbial Genetics (Chapter 8) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology An Introduction

More information

DNA TM Review And EXAM Review. Ms. Martinez

DNA TM Review And EXAM Review. Ms. Martinez DNA TM Review And EXAM Review Ms. Martinez 1. Write out the full name for DNA molecule. Deoxyribonucleic acid 2. What are chromosomes? threadlike strands made of DNA and PROTEIN 3. What does DNA control

More information