Yale Pseudogene Analysis as part of GENCODE Project
|
|
|
- Marilyn Gallagher
- 10 years ago
- Views:
Transcription
1 Sanger Center , 11:20-11:40 Mark B Gerstein Yale Illustra(on from Gerstein & Zheng (2006). Sci Am. (c) Mark Gerstein, 2002, (c) Yale, 1 1Lectures.GersteinLab.org 2007bioinfo.mbb.yale.edu Yale Pseudogene Analysis as part of GENCODE Project
2 Overview Outline Flow Additional Pseudogene Annotation Pseudogene Sets Regular conference calls Sanger / Havana: Jenn, Adam UCSC: Rachel, Mark Discuss difficult pseudogene cases, pipeline improvements and additional pseudogene annotation Questions for you: consis. Labels? Pfam/ensembl usage? trans. set? consensus set? 2 Lectures.GersteinLab.org (c) 2007
3 Overall Flow: Pipeline Runs, Coherent Sets, Annotation, Transfer to Sanger Overall Approach 1. Overall Pipeline runs at Yale and UCSC, yielding raw pseudogenes 2. Extraction of coherent subsets for further analysis and annotation 3. Passing to Sanger for detailed manual analysis and curation 4. Incorporation into final GENCODE annotation 5. Pipeline modification Chronology of Sets 1. Unitary pseudogenes 2. Ribosomal Protein pseudogenes (Hard then easy) 3. Transcribed pseudogenes annotated earlier 4. Strong overlap consensus pseudogenes 5. Pseudogenes associated with SDs 6. GAPDH pseudogenes 3 Lectures.GersteinLab.org (c) 2007
4 Additional Annotation on Pseudogenes: Consistent Labeling (Ontology) 4 Lectures.GersteinLab.org (c) 2007
5 has_pseudogene_family Pseudogene family type_of Protein family contained_in has_parent_protein Protein translated_into retrotranscribed_from mrna transcribed_into Pseudogene duplicated_from Gene Pseudogen e Unitary Processed Duplicated Transcribed Regulatory Domain Ontology Upper Ontology Segmental Duplica;on [Lam et al., NAR DB Issue (in press, '09)] contained_in Sequence Region is_a etc mutated_from Syntenic Region contained_in derives_from 5 Lectures.GersteinLab.org (c) 2007
6 Domain Ontology Pseudogene has a Classified Type is a Proposed HAVANA Unitary Processed Duplicated *Unprocessed Semi Processed Duplicated Processed Feature Origin Polymorphic Transcribed Regulatory Evidence Mitochondria Nucleus Intra-Genome Homology Sequence Homology [Lam et al., NAR DB Issue (in press, '09)] Cross- Genome Homology Regulatory Element Lost Premature Stop Codon Disablement Frameshift Recognition Feature Pseudo- PolyA Tail 6 Lectures.GersteinLab.org (c) 2007
7 Collections to provide further annotation HAVANA Human Pseudogenes Yale UCSC Ribosomal Protein Transcribed 7 Lectures.GersteinLab.org (c) 2007
8 Additional Annotation on Pseudogenes: Families & Histories 8 Lectures.GersteinLab.org (c) 2007
9 SVN Flat Files Table Browser single pgene query tables.pseudogene.org [Karro et al., NAR ('07)] DAS UCSC Genome Browser 12 eukaryotic species Human, mouse, rat, chimp 100,052 pseudogenes 64 prokaryotic species 6,412 pseudogenes 28,237 human pseudogenes 13+ unique human sets 9 Lectures.GersteinLab.org (c) 2007
![, NAR ('07)] DAS UCSC Genome Browser 12 eukaryotic species Human, mouse, rat,](/docs-images/43/12812863/images/page_9.jpg "chimp 100,052 pseudogenes 64 prokaryotic species 6,412 pseudogenes 28,237")
10 Pseudofam Database Data Sources Ensembl, Pfam, BioMart Pseudopipe Highlighted Features Browse families Statistics Enrichment P-value, etc Search families Pfam ID/Acc Ensembl ID Pseudogene ID Correlate families Genes Pseudogenes Parents [Lam et al., NAR DB Issue (in press, '09)] 10 Lectures.GersteinLab.org (c) 2007
11 Pseudofam Construction Data Generation Alignment Identify pseudogenes by proteins Map parent proteins to protein families Assign pseudogenes to their parent families Align the pseudogenes in pseudogene families Calculate the key statistics and organize the data into database Align pseudogene to parent Transfer alignment from Pfam Combine and adjust the alignments to build the pseudofam alignment [Lam et al., NAR DB Issue (in press, '09)] 11 Lectures.GersteinLab.org (c) 2007
12 Pseudofam Statistics: Enrichment of pseudogenes within a family ("Living vs Dead") Total (10 Eukaryotes) Human [Lam et al., NAR DB Issue (in press, '09)] 12 Lectures.GersteinLab.org (c) 2007
13 Pseudogene Set #2: RP pseudogenes 13 Lectures.GersteinLab.org (c) 2007
14 Human Ribosomal Proteins (RP) 79 Functional RP genes Nakao A, Yoshihama M, Kenmochi N: RPG: the Ribosomal Protein Gene database. Nucleic Acids Res 2004, 32:D [Zhang et al. Genome Research, 2002] 14 Lectures.GersteinLab.org (c) 2007
15 Human Ribosomal Proteins (RP) 79 Functional RP genes ~ 2000 RP Ψgenes 15 [Zhang et al. Genome Research, 2002] 15 Lectures.GersteinLab.org (c) 2007
16 Number of RP pseudogenes (identified by pipeline) Organism Processed Fragments Low confidence Human Chimp Mouse Rat RP pseudogenes constitute the largest family of pseudogenes. Almost all are processed: There are ~90 clearly duplicated ones in the human genome [Balasubramanian et al., Genome Biol. ('09)] 16 Lectures.GersteinLab.org (c) 2007
17 Number of each type of human ribosomal protein processed pseudogenes appears unrelated to expression level or to number in mouse [Balasubramanian et al., Genome Biol. ('09)] 17 Lectures.GersteinLab.org (c) 2007
18 Using Synteny to Improve Annotation of RP pgenes Synteny derived based on local gene orthology [Balasubramanian et al., Genome Biol. ('09)] 18 Lectures.GersteinLab.org (c) 2007
19 Syntenic proc pseudogenes Species1- Species2 Number of syntenic pgenes Human-chimp 1282 Human-mouse 6 Human-rat 11 Rat-mouse 394 [Balasubramanian et al., Genome Biol. ('09)] 19 Lectures.GersteinLab.org (c) 2007
20 A human-mouse syntenic pgene, likely to be coding [Balasubramanian et al., Genome Biol. ('09)] Nakao A, Yoshihama M, Kenmochi N: RPG: the Ribosomal Protein Gene database. Nucleic Acids Res 2004, 32:D Lectures.GersteinLab.org (c) 2007
![('09)] Nakao A, Yoshihama M, Kenmochi N: RPG: the Ribosomal](/docs-images/43/12812863/images/page_20.jpg "Protein Gene database. Nucleic Acids Res 2004, 32:D168-170.")
21 Set #3: Transcribed Pseudogenes Annotated Earlier 21 Lectures.GersteinLab.org (c) 2007
22 Harrison '05 set of Transcribed Pseudogenes 233 Transcribed from ~8000 Processed Pseudogenes Evidence for Transcription 8% Refseq mrnas 32% Unigene consensus sequences 72% dbest expressed sequence tags 32% Oligonucleotide microarray data (extra support) Highly decayed Fraction with Ka/Ks 0.5 is 54% Harrison et al. (2005) NAR Lectures.GersteinLab.org (c) 2007
23 Set #4: Strong Consensus Pseudogenes 23 Lectures.GersteinLab.org (c) 2007
24 Consensus Pseudogenes Yale & UCSC agreement Yale, UCSC & HAVANA agreement HAVANA disagreement 24 Lectures.GersteinLab.org (c) 2007
25 Overlap Initially, 50 nucleotide overlap Why so low? What about percentage overlap? 25 Lectures.GersteinLab.org (c) 2007
26 26 Lectures.GersteinLab.org (c) 2007
27 27 Lectures.GersteinLab.org (c) 2007
28 28 Lectures.GersteinLab.org (c) 2007
29 High Quality Overlaps? 29 Lectures.GersteinLab.org (c) 2007
30 30 Lectures.GersteinLab.org (c) 2007
31 gencode.gersteinlab.org/consensus Django-based Filter by genomic coordinates, source Yale & UCSC Consensus track Flagged pseudogenes Verification status 31 Lectures.GersteinLab.org (c) 2007
32 Set #5: SD pseudogenes 32 Lectures.GersteinLab.org (c) 2007
33 Segmental Duplications (SDs) SDs are regions of the genome with 90% sequence identity and 1kb in length Clues about pseudogene formation from pseudogenes located in SDs, for example, annotation of duplicated-processed pseudogenes 33 Lectures.GersteinLab.org (c) 2007
34 Pseudogene families and Segmental Duplications (SDs) SDs comprise ~5-6% of the human genome but contain ~17.8% genes, 45.7% duplicated pgenes and 21.6% processed pgenes Relative values of correlation coefficients in the plots above consistent with the observation that SDs contain more pgenes than parent genes [Lam et al., NAR DB Issue (in press, '09)] 34 Lectures.GersteinLab.org (c) 2007
35 Summary Sets RP, transcribed 05, consensus, SD... Additional Annotation families & labels 35 Lectures.GersteinLab.org (c) 2007
36 Credits Yale: S Balasubramanian, P Cayting, H Lam, Y Liu, G Fang, N Carriero, R Robilotto, E Khurana Alums: D Zheng, P Harrison, Z Zhang Sanger: A Frankish, J Harrow UCSC: R Harte, M Diekhans 36 Lectures.GersteinLab.org (c) 2007
37 Extra 37 Lectures.GersteinLab.org (c) 2007
38 Collections Combination of multiple sets Human50, UCSC, GAPDH, Transcribed, Unitary, etc. Also can have attributes View by set or as a whole 38 Lectures.GersteinLab.org (c) 2007
39 Pseudofam & Pseudogene.org Integration PseudoPipe svn annotations via shared ID 39 Lectures.GersteinLab.org (c) 2007
40 gencode.gersteinlab.org/consensus 40 Lectures.GersteinLab.org (c) 2007
Final Project Report
CPSC545 by Introduction to Data Mining Prof. Martin Schultz & Prof. Mark Gerstein Student Name: Yu Kor Hugo Lam Student ID : 904907866 Due Date : May 7, 2007 Introduction Final Project Report Pseudogenes
Module 3. Genome Browsing. Using Web Browsers to View Genome Annota4on. Kers4n Howe Wellcome Trust Sanger Ins4tute zfish- [email protected].
Module 3 Genome Browsing Using Web Browsers to View Genome Annota4on Kers4n Howe Wellcome Trust Sanger Ins4tute zfish- [email protected] Introduc.on Genome browsing The Ensembl gene set Guided examples
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Genome Viewing. Module 2. Using Genome Browsers to View Annotation of the Human Genome
Module 2 Genome Viewing Using Genome Browsers to View Annotation of the Human Genome Bert Overduin, Ph.D. PANDA Coordination & Outreach EMBL - European Bioinformatics Institute Wellcome Trust Genome Campus
GenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
Introduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
Searching Nucleotide Databases
Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames
Frequently Asked Questions Next Generation Sequencing
Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided
Module 1. Sequence Formats and Retrieval. Charles Steward
The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.
Human-Mouse Synteny in Functional Genomics Experiment
Human-Mouse Synteny in Functional Genomics Experiment Ksenia Krasheninnikova University of the Russian Academy of Sciences, JetBrains [email protected] September 18, 2012 Ksenia Krasheninnikova
Gene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium
Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium I. Introduction: Sequence based assays of transcriptomes (RNA-seq) are in wide use because of their favorable
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: [email protected].
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: [email protected] What is Gene Expression & Gene Regulation? 1. Gene Expression
Protein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want
1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very
Introduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]
Analysis of ChIP-seq data in Galaxy
Analysis of ChIP-seq data in Galaxy November, 2012 Local copy: https://galaxy.wi.mit.edu/ Joint project between BaRC and IT Main site: http://main.g2.bx.psu.edu/ 1 Font Conventions Bold and blue refers
Bioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
org.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers.
org.rn.eg.db December 16, 2015 org.rn.egaccnum Map Entrez Gene identifiers to GenBank Accession Numbers org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank
A Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
Transcription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
Simplifying Data Interpretation with Nexus Copy Number
Simplifying Data Interpretation with Nexus Copy Number A WHITE PAPER FROM BIODISCOVERY, INC. Rapid technological advancements, such as high-density acgh and SNP arrays as well as next-generation sequencing
Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison
Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]
The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:
Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How
SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE
AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,
Choices, choices, choices... Which sequence database? Which modifications? What mass tolerance?
Optimization 1 Choices, choices, choices... Which sequence database? Which modifications? What mass tolerance? Where to begin? 2 Sequence Databases Swiss-prot MSDB, NCBI nr dbest Species specific ORFS
Novel Transcribed Regions in the Human Genome
Novel Transcribed Regions in the Human Genome J. ROZOWSKY,* J. WU, Z. LIAN, U. NAGALAKSHMI, J.O. KORBEL,* P. KAPRANOV,** D. ZHENG,* S. DYKE,** P. NEWBURGER, P. MILLER,, T.R. GINGERAS,** S. WEISSMAN, M.
Lecture 11 Data storage and LIMS solutions. Stéphane LE CROM [email protected]
Lecture 11 Data storage and LIMS solutions Stéphane LE CROM [email protected] Various steps of a DNA microarray experiment Experimental steps Data analysis Experimental design set up Chips on catalog
BioBoot Camp Genetics
BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:
From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
Focusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
Nebula A web-server for advanced ChIP-seq data analysis. Tutorial. by Valentina BOEVA
Nebula A web-server for advanced ChIP-seq data analysis Tutorial by Valentina BOEVA Content Upload data to the history pp. 5-6 Check read number and sequencing quality pp. 7-9 Visualize.BAM files in UCSC
PreciseTM Whitepaper
Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis
The world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
Genetics Test Biology I
Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.
Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at
Woods Hole Zebrafish Genetics and Development Bioinformatics/Genomics Lab Ian Woods Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at http://faculty.ithaca.edu/iwoods/docs/wh/
DNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary
Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page
Linear Sequence Analysis. 3-D Structure Analysis
Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical properties Molecular weight (MW), isoelectric point (pi), amino acid content, hydropathy (hydrophilic
New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.
New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System
PRACTICE TEST QUESTIONS
PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh
Guide for Bioinformatics Project Module 3
Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first
Converting GenMAPP MAPPs between species using homology
Converting GenMAPP MAPPs between species using homology 1 Introduction and Background 2 1.1 Fundamental principles of the GenMAPP Gene Database 2 1.1.1 Gene Database data types 2 1.1.2 GenMAPP System Codes
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
RNA & Protein Synthesis
RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis
The Steps. 1. Transcription. 2. Transferal. 3. Translation
Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order
GMQL Functional Comparison with BEDTools and BEDOPS
GMQL Functional Comparison with BEDTools and BEDOPS Genomic Computing Group Dipartimento di Elettronica, Informazione e Bioingegneria Politecnico di Milano This document presents a functional comparison
Genomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
GeneProf and the new GeneProf Web Services
GeneProf and the new GeneProf Web Services Florian Halbritter [email protected] Stem Cell Bioinformatics Group (Simon R. Tomlinson) [email protected] December 10, 2012 Florian Halbritter
Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein
Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of
Integrating DNA Motif Discovery and Genome-Wide Expression Analysis. Erin M. Conlon
Integrating DNA Motif Discovery and Genome-Wide Expression Analysis Department of Mathematics and Statistics University of Massachusetts Amherst Statistics in Functional Genomics Workshop Ascona, Switzerland
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data The Illumina TopHat Alignment and Cufflinks Assembly and Differential Expression apps make RNA data analysis accessible to any user, regardless
Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
Comparing Methods for Identifying Transcription Factor Target Genes
Comparing Methods for Identifying Transcription Factor Target Genes Alena van Bömmel (R 3.3.73) Matthew Huska (R 3.3.18) Max Planck Institute for Molecular Genetics Folie 1 Transcriptional Regulation TF
RNA and Protein Synthesis
Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
Geospiza s Finch-Server: A Complete Data Management System for DNA Sequencing
KOO10 5/31/04 12:17 PM Page 131 10 Geospiza s Finch-Server: A Complete Data Management System for DNA Sequencing Sandra Porter, Joe Slagel, and Todd Smith Geospiza, Inc., Seattle, WA Introduction The increased
BUDAPEST: Bioinformatics Utility for Data Analysis of Proteomics using ESTs
BUDAPEST: Bioinformatics Utility for Data Analysis of Proteomics using ESTs Richard J. Edwards 2008. Contents 1. Introduction... 2 1.1. Version...2 1.2. Using this Manual...2 1.3. Why use BUDAPEST?...2
AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE
ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS
Concluding lesson. Student manual. What kind of protein are you? (Basic)
Concluding lesson Student manual What kind of protein are you? (Basic) Part 1 The hereditary material of an organism is stored in a coded way on the DNA. This code consists of four different nucleotides:
Data Analysis & Management of High-throughput Sequencing Data. Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute
Data Analysis & Management of High-throughput Sequencing Data Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute Current Issues Current Issues The QSEQ file Number files per
Analyzing microrna Data and Integrating mirna with Gene Expression Data in Partek Genomics Suite 6.6
Analyzing microrna Data and Integrating mirna with Gene Expression Data in Partek Genomics Suite 6.6 Overview This tutorial outlines how microrna data can be analyzed within Partek Genomics Suite. Additionally,
2006 7.012 Problem Set 3 KEY
2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
Quantitative proteomics background
Proteomics data analysis seminar Quantitative proteomics and transcriptomics of anaerobic and aerobic yeast cultures reveals post transcriptional regulation of key cellular processes de Groot, M., Daran
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
Genetomic Promototypes
Genetomic Promototypes Mirkó Palla and Dana Pe er Department of Mechanical Engineering Clarkson University Potsdam, New York and Department of Genetics Harvard Medical School 77 Avenue Louis Pasteur Boston,
Using Databases in R
Using Databases in R Marc Carlson Fred Hutchinson Cancer Research Center May 20, 2010 Introduction Example Databases: The GenomicFeatures Package Basic SQL Using SQL from within R Outline Introduction
CRAC: An integrated approach to analyse RNA-seq reads Additional File 3 Results on simulated RNA-seq data.
: An integrated approach to analyse RNA-seq reads Additional File 3 Results on simulated RNA-seq data. Nicolas Philippe and Mikael Salson and Thérèse Commes and Eric Rivals February 13, 2013 1 Results
Intro to Bioinformatics
Intro to Bioinformatics Marylyn D Ritchie, PhD Professor, Biochemistry and Molecular Biology Director, Center for Systems Genomics The Pennsylvania State University Sarah A Pendergrass, PhD Research Associate
Computational Methodologies for Transcript Analysis in the. Age of Next-Generation DNA Sequencing
Abstract Computational Methodologies for Transcript Analysis in the Age of Next-Generation DNA Sequencing Lukas Habegger 2012 A cellʼs transcriptome is characterized by the full repertoire of its condition-specific
Sample Questions for Exam 3
Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.
Distributed Data Mining in Discovery Net. Dr. Moustafa Ghanem Department of Computing Imperial College London
Distributed Data Mining in Discovery Net Dr. Moustafa Ghanem Department of Computing Imperial College London 1. What is Discovery Net 2. Distributed Data Mining for Compute Intensive Tasks 3. Distributed
Global and Discovery Proteomics Lecture Agenda
Global and Discovery Proteomics Christine A. Jelinek, Ph.D. Johns Hopkins University School of Medicine Department of Pharmacology and Molecular Sciences Middle Atlantic Mass Spectrometry Laboratory Global
Modeling DNA Replication and Protein Synthesis
Skills Practice Lab Modeling DNA Replication and Protein Synthesis OBJECTIVES Construct and analyze a model of DNA. Use a model to simulate the process of replication. Use a model to simulate the process