Analysis of ChIP-seq data in Galaxy
|
|
|
- Hugh Norris
- 10 years ago
- Views:
Transcription
1 Analysis of ChIP-seq data in Galaxy November, 2012 Local copy: Joint project between BaRC and IT Main site: 1
2 Font Conventions Bold and blue refers to tools on the left hand window Bold and green refers to tabs and menus on the top (Analyze data, Shared Data, etc) Slides with Red Headers describe the handson exercises Red and italic refers to menus and history names used on the hands-on 2
3 ChIP-seq Park, P. J., ChIP-seq: advantages and challenges of a maturing technology, Nat Rev Genet. Oct;10(10): (2009) 3
4 General workflow for ChIP-seq analysis Fastq files from the sequencing facility Check the quality of your reads (NGS: QC and manipulation -> FastQC) Step 1: Map the reads to the genome (BOWTIE) Step 2: Identify peaks (MACS) Step 3: Post processing: Annotate peaks i.e. find genes overlapping or close to the peaks Park, P. J., ChIP-seq: advantages and challenges of a maturing technology, Nat Rev Genet. Oct;10(10): (2009) 4
5 Hands-On Exercises Data upload (get files needed for analysis) Raw data: fastq files (ChIP and WCE) Intermediate files: output files of the first analysis steps Annotation files: genes and upstream regions, we will use them to get a set of genes that overlap or are close to the peaks ChIP-seq analysis. Map with bowtie Identify peaks bound with MACS Find genes that overlap or are close to the peaks 5
6 The Galaxy Interface A web based platform for analysis of large genomic datasets Type in your browser address. You will be prompted for your name and password (these are the same that you use for your ) No need of programming experience. Integrates many bioinformatics tools within one interface. Keeps track of all the steps performed in an analysis. Even if you delete the datasets, the history keeps the tools used. LOCAL COPY Faster Customizable 250Gb of storage Data is private Jobs are sent to the cluster 6
7 Galaxy Interface: Analyze Data Data analysis Processed data Green: job is finished Yellow: job is running Gray: job is in queue Red: there is a problem Tools window Data display and tool s dialog window History window: All analysis steps are saved. Data is not overwritten. History window: Can create workflow to repeat an analysis. 7
8 How to find your previous histories History menu 8
9 Getting Data: Upload File Upload File File Format Upload or paste file Execute Genome Assembly 9
10 Getting Data: Uploading Large Files Step 1: copy your file to using a sftp client 22 CyberDuck /nfs/galaxy/uploads/[email protected] 10
11 Getting Data: Uploading Large Files Step 2: Select and upload the file within galaxy Upload Fie Execute Genome Assembly 11
12 Hands-on: Data Upload This is an schematic of the data we need to upload for each step. Step 1. Map reads History: mapwithbowtie Input files: WCE.fastq Nanog.fastq Step 2. Call peaks History: InputForMACS_mm9 Input files: Filter SAM on data 3_WCE Filter SAM on data 4_Nanog Step 3. Post processing History: InputFor_annotatePeaks Input files: Peaks Refseq Genes 3Kb Upstream of Refseq Genes 12
13 Hands-on: Data Upload Create a new history and name it mapwithbowtie 1) On the history MENU select Create New 2) On the history MENU select Saved Histories 3) Once you see your histories on the middle window click on the Unnamed history drop down menu and select Rename
14 Hands-on: Data Upload stay in mapwithbowtie history Upload the files that I have copied for to your uploads directory 14
15 Hands-on: Data Upload Click on the Shared Data Tab and select Published Histories Select InputForMACS_mm9 Click on Import history 15
16 Hands-on: Data Upload Click on the Shared Data Tab and select Published Histories Select InputFor_annotatePeaks Click on Import history 16
17 Getting Data from UCSC (local copy) UCSC Main Get Output 17
18 Getting Data from UCSC (local copy) Send to Galaxy 18
19 Hands-on: Data Upload Optional stay in imported: InputFor_annotatePeaks history Use the link to the UCSC main table browser 1. Get all mouse refseq genes mm9 chr1 2. Get all 3Kb upstream regions from mouse refseq genes mm9 chr1 Now you have all the data we need for the hands-on exercises 19
20 Important Icons Display data Edit attributes Delete Download View Details Run this job again View or Report this error Reporting an error will create a ticket Clicking on the name of the dataset displays it bellow Display data in local UCSC browser 20
21 History Good Practices Make a new history for each analysis that you perform. Rename the outputs of your jobs Permanently delete data that you don t need (or you will reach your quota of 250Gb). 21
22 History is not removed when datasets are removed 22
23 Other useful commands on the History menu Access histories that other users shared with you Transfer data between histories Share your history with other users 23
24 General workflow for ChIP-seq analysis Fastq files from the sequencing facility Check the quality of your reads (NGS: QC and manipulation -> FastQC) Step 1: Map the reads to the genome (BOWTIE) Step 2: Identify peaks (MACS) Step 3: Post processing: Annotate peaks i.e. find genes overlapping or close to the peaks Park, P. J., ChIP-seq: advantages and challenges of a maturing technology, Nat Rev Genet. Oct;10(10): (2009) 24
25 Analysis of ChIP-seq data using Galaxy 1. History: mapwithbowtie 1. Run FASTQ Groomer to convert fastq file to fastq Sanger format 2. Map with bowtie 3. Filter out unmapped reads 2. History: imported: InputForMACS_mm9 1. Call peaks bound using MACS 2. Select the peaks that are on chr1 3. History: imported: InputFor_annotatePeaks. Annotate peaks 1. Annotate peaks using Operate on Genomic Intervals tools 2. Annotate peaks using the Integrative Analysis- > peak2gene tool 25
26 Illumina data format Fastq format: GTAGAACTGGTACGGACAAGGGGAATCTGACTGTAG +ILLUMINA-F6C19_0048_FC:5:1:12440:1460#0/1 hhhhhhhhhhhghhhhhhhehhhedhhhhfhhhhhh /1 or /2 identifier seq +any description seq quality values 26
27 Sequence quality values on different FASTQ formats S - Sanger Phred+33, raw reads typically (0, 40) X - Solexa Solexa+64, raw reads typically (-5, 40) I - Illumina 1.3+ Phred+64, raw reads typically (0, 40) J - Illumina 1.5+ Phred+64, raw reads typically (3, 40) To discriminate between Solexa and Illumina 1.3+ check if your sequences' quality scores have any of the characters ;<=>? 27
28 FASTQ formats and FASTQ Groomer 28
29 Mapping Reads with Bowtie Bowtie 29
30 Mapping Reads with Bowtie Set it to the read length used in your experiment; for today's session leave it as the default 28 Next Gen.Seq. 30
31 NGS: SAM Tools -> Filter SAM 31
32 Hands-on: Analysis of ChIP-seq data 1 History: mapwithbowtie Run NGS: QC and manipulation -> FASTQ Groomer on the 2 fastq files. The input files are Sanger format, but you still have to run fastq Groomer Map each of the fastq files with bowtie NGS: Mapping -> Map with Bowtie for Illumina Genome to map to: mm9 canonical Other parameters: use best Take the output from bowtie and filter out reads not mapped using: NGS: SAM Tools -> Filter SAM Tip: You don t have to wait for fastq groomer or bowtie to finish to send the next job 32
33 Analysis of ChIP-seq data: MACS mm9 Make this your read length (leave it as is for the hands on) MACS 33
34 Filter and Sort: Filter data on any column 34
35 Hands-on: Analysis of ChIP-seq data 2 History: InputForMACS_mm9 Take the filtered mapped reads (uploaded by me in this history) and run MACS NGS: Peak Calling -> MACS Model-based Analysis for ChIP-Seq Using the file that MACS generates MACS peaks on Filter SAM on data 4 select only the peaks on chr1 Filter and Sort -> Filter data on any column using simple expressions Other filters you may want to use when you are running your analysis are: Get the top 2000 peaks Get peaks with FC > cut-off value Get peaks with -log P > cut-off value 35
36 Post processing Text Manipulation 36
37 Operate on Genomic Intervals: Intersect the intervals of two datasets 37
38 Operate on Genomic Intervals: Intersect the intervals of two datasets 38
39 Hands-on: Analysis of ChIP-seq data 3 History: inputfor_annotatepeaks Annotate peaks. 1. Combine the mm10 refseq genes file and the 3Kb upstream of refseq gene file Text Manipulation -> Concatenate datasets tail-to-head Find the genes or upstream regions that overlap with peaks Operate on Genomic Intervals -> Intersect the intervals of two datasets 2. Find genes located at 3 Kb or less from the peak center using Integrative Analysis -> peak2gene 39
40 Tutorials and References Galaxy tutorials Previous Hot Topics References Giardine et al. (2005) Galaxy: a platform for interactive large-scale analysis. Genome Research 15: Taylor et al. (2007) Using Galaxy to perform large-scale interactive data analyses. Current Protocols in Bioinformatics Chapter 10, unit 10. Blankenberg et al. (2010) Manipulation of FASTQ data with Galaxy. Bioinformatics 26(14): Park, P. J. (2009) ChIP-seq: advantages and challenges of a maturing technology Nat. Rev. Genet. 10(10): Pepke et al. (2009) Computation for ChIP-seq and RNA-seq studies. Nature Methods 6, S22 - S32 Wilbanks et al. (2010) Evaluation of Algorithm Performance in ChIP-Seq peak Detection. PLoS ONE 5(7) Szalkowski et al. (2010) Rapid innovation in ChIP-seq peak-calling algorithms is outdistancing benchmarking efforts. Brief Bioinform doi: /bib/bbq068 Rye et al. (2011) A manually curated ChIP-seq benchmark demonstrates room for improvement in current peak-finder programs. Nucleic Acids Res. 39(4):e25 Zhang et al. (2008) Model-based Analysis of ChIP-Seq (MACS). Genome Biol vol. 9 (9) pp. R137 40
Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment
Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249
Nebula A web-server for advanced ChIP-seq data analysis. Tutorial. by Valentina BOEVA
Nebula A web-server for advanced ChIP-seq data analysis Tutorial by Valentina BOEVA Content Upload data to the history pp. 5-6 Check read number and sequencing quality pp. 7-9 Visualize.BAM files in UCSC
Comparing Methods for Identifying Transcription Factor Target Genes
Comparing Methods for Identifying Transcription Factor Target Genes Alena van Bömmel (R 3.3.73) Matthew Huska (R 3.3.18) Max Planck Institute for Molecular Genetics Folie 1 Transcriptional Regulation TF
Data Analysis & Management of High-throughput Sequencing Data. Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute
Data Analysis & Management of High-throughput Sequencing Data Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute Current Issues Current Issues The QSEQ file Number files per
Frequently Asked Questions Next Generation Sequencing
Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided
Using Galaxy for NGS Analysis. Daniel Blankenberg Postdoctoral Research Associate The Galaxy Team http://usegalaxy.org
Using Galaxy for NGS Analysis Daniel Blankenberg Postdoctoral Research Associate The Galaxy Team http://usegalaxy.org Overview NGS Data Galaxy tools for NGS Data Galaxy for Sequencing Facilities Overview
SOS SO S O n O lin n e lin e Bac Ba kup cku ck p u USER MANUAL
SOS Online Backup USER MANUAL HOW TO INSTALL THE SOFTWARE 1. Download the software from the website: http://www.sosonlinebackup.com/download_the_software.htm 2. Click Run to install when promoted, or alternatively,
-> Integration of MAPHiTS in Galaxy
Enabling NGS Analysis with(out) the Infrastructure, 12:0512 Development of a workflow for SNPs detection in grapevine From Sets to Graphs: Towards a Realistic Enrichment Analy species: MAPHiTS -> Integration
Using Internet or Windows Explorer to Upload Your Site
Using Internet or Windows Explorer to Upload Your Site This article briefly describes what an FTP client is and how to use Internet Explorer or Windows Explorer to upload your Web site to your hosting
Teacher References archived classes and resources
Archived Classes At the end of each school year, the past year s academic classes are archived, meaning they re still kept in finalsite, but are put in an inactive state and are not accessible by students.
Version 5.0 Release Notes
Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com
Installation Guide for Windows
Installation Guide for Windows Overview: Getting Ready Installing Sequencher Activating and Installing the License Registering Sequencher GETTING READY Trying Sequencher: Sequencher 5.2 and newer requires
CLOSHA MANUAL ver1.1. KOBIC (Korean Bioinformation Center) [email protected] 2016-05-08. Bioinformatics Workflow management System in Bio-Express
CLOSHA MANUAL ver1.1 Bioinformatics Workflow management System in Bio-Express Cloud Services for Massive Sequencing Data Analysis KOBIC (Korean Bioinformation Center) [email protected] 2016-05-08 1 1.
SUBJECT: New Features in Version 5.3
User Bulletin Sequencing Analysis Software v5.3 July 2007 SUBJECT: New Features in Version 5.3 This user bulletin includes the following topics: New Features in v5.3.....................................
GDP11 Student User s Guide. V. 1.7 December 2011
GDP11 Student User s Guide V. 1.7 December 2011 Contents Getting Started with GDP11... 4 Program Structure... 4 Lessons... 4 Lessons Menu... 4 Navigation Bar... 5 Student Portfolio... 5 GDP Technical Requirements...
Visualisation tools for next-generation sequencing
Visualisation tools for next-generation sequencing Simon Anders EBI is an Outstation of the European Molecular Biology Laboratory. Outline Exploring and checking alignment with alignment viewers Using
14.1. bs^ir^qfkd=obcib`qflk= Ñçê=emI=rkfuI=~åÇ=léÉåsjp=eçëíë
14.1 bs^ir^qfkd=obcib`qflk= Ñçê=emI=rkfuI=~åÇ=léÉåsjp=eçëíë bî~äì~íáåö=oéñäéåíáçå=ñçê=emi=rkfui=~åç=lééåsjp=eçëíë This guide walks you quickly through key Reflection features. It covers: Getting Connected
Frog VLE Update. Latest Features and Enhancements. September 2014
1 Frog VLE Update Latest Features and Enhancements September 2014 2 Frog VLE Update: September 2014 Contents New Features Overview... 1 Enhancements Overview... 2 New Features... 3 Site Backgrounds...
How to install and use the File Sharing Outlook Plugin
How to install and use the File Sharing Outlook Plugin Thank you for purchasing Green House Data File Sharing. This guide will show you how to install and configure the Outlook Plugin on your desktop.
Partek Methylation User Guide
Partek Methylation User Guide Introduction This user guide will explain the different types of workflow that can be used to analyze methylation datasets. Under the Partek Methylation workflow there are
Microsoft SharePoint 2010 End User Quick Reference Card
Microsoft SharePoint 2010 End User Quick Reference Card Microsoft SharePoint 2010 brings together the people, documents, information, and ideas of the University into a customizable workspace where everyone
Lab 5 Managing Access to Shared Folders
Islamic University of Gaza Computer Network Lab Faculty of engineering ECOM 4121 Computer Department. Prepared by : Eng. Eman R. Al-Kurdi Managing Access to Shared Folders Objective: Manage access to shared
Global TAC Secure FTP Site Customer User Guide
Global TAC Secure FTP Site Customer User Guide Introduction This guide is provided to assist you in using the GTAC Secure FTP site. This site resides in the Houston Remote Services Center (RSC), and is
Connecting to the Hospira FTP Server
Connecting to Hospira s FTP Server To transfer files to and from Hospira s FTP Server requires a connection to ftp.hospira-transfer.com. Several commercial and shareware File Transfer Protocol (FTP) software
Personal Cloud. Support Guide for Mac Computers. Storing and sharing your content 2
Personal Cloud Support Guide for Mac Computers Storing and sharing your content 2 Getting started 2 How to use the application 2 Managing your content 2 Adding content manually 3 Renaming files 3 Moving
End User Training Guide
End User Training Guide Everything You Need to Get Started on Vonage Business Solutions End User Portal This guide will give you a comprehensive look at the Vonage Business Solutions online user interface
Automatic Integration into Olympus Transcription Via FTP
Automatic Integration into Olympus Transcription Via FTP The following Guide demonstrates how to enable integration from the Hugo Dictation App via FTP into the Olympus Transcription Software The creation
GeneProf and the new GeneProf Web Services
GeneProf and the new GeneProf Web Services Florian Halbritter [email protected] Stem Cell Bioinformatics Group (Simon R. Tomlinson) [email protected] December 10, 2012 Florian Halbritter
Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling
Lectures 1 and 8 15 February 7, 2013 This is a review of the material from lectures 1 and 8 14. Note that the material from lecture 15 is not relevant for the final exam. Today we will go over the material
MultiExperiment Viewer Quickstart Guide
MultiExperiment Viewer Quickstart Guide Table of Contents: I. Preface - 2 II. Installing MeV - 2 III. Opening a Data Set - 2 IV. Filtering - 6 V. Clustering a. HCL - 8 b. K-means - 11 VI. Modules a. T-test
ShoreTel Enterprise Contact Center 8 Using Agent Toolbar
ShoreTel Enterprise Contact Center 8 Using Agent Toolbar November 2012 Legal Notices Document and Software Copyrights Copyright 1998-2012 by ShoreTel Inc., Sunnyvale, California, USA. All rights reserved.
LifeScope Genomic Analysis Software 2.5
USER GUIDE LifeScope Genomic Analysis Software 2.5 Graphical User Interface DATA ANALYSIS METHODS AND INTERPRETATION Publication Part Number 4471877 Rev. A Revision Date November 2011 For Research Use
Sequencing Analysis Software Version 5.1
Applied Biosystems DNA Sequencing Analysis Software Sequencing Analysis Software Version 5.1 The Applied Biosystems DNA Sequencing Analysis Software v5.1 is designed to analyze, display, edit, save, and
M-F: 7:00AM 1:00AM ET (800)704-7237 7:00 AM 12:00AM ET
Agent Guide LeadRouter Customer Service (800)704-7237 [email protected] M-F: 7:00AM 1:00AM ET Weekends: 7:00 AM 12:00AM ET Version 1.4 May 2012 Contents What is LeadRouter?... 4 The LeadRouter Approach...
webmethods Certificate Toolkit
Title Page webmethods Certificate Toolkit User s Guide Version 7.1.1 January 2008 webmethods Copyright & Document ID This document applies to webmethods Certificate Toolkit Version 7.1.1 and to all subsequent
Web Ambassador Training on the CMS
Web Ambassador Training on the CMS Learning Objectives Upon completion of this training, participants will be able to: Describe what is a CMS and how to login Upload files and images Organize content Create
BioHPC Web Computing Resources at CBSU
BioHPC Web Computing Resources at CBSU 3CPG workshop Robert Bukowski Computational Biology Service Unit http://cbsu.tc.cornell.edu/lab/doc/biohpc_web_tutorial.pdf BioHPC infrastructure at CBSU BioHPC Web
SAM Brief Student User Guide
SAM Assessment, Training and Projects for Microsoft Office December 2015 SAM Brief Student User Guide Contents Introduction 1 How to Use SAM 2 Logging in the First Time as a Pre-registered Student 2 Profile
HelpDesk Connect Operator Manual rev. 1.0.
HelpDesk Connect Operator Manual rev. 1.0. 2003-2009 Eastwright Corp. www.eastwright.com 1 1.System Overview 1.1. Concepts The HelpDesk Connect is a web based help desk system. The program allows efficient
MICROSOFT OUTLOOK 2011 GETTING STARTED AND HELP RESOURCES
MICROSOFT OUTLOOK 2011 GETTING STARTED AND HELP RESOURCES Lasted Edited: 2012-07-10 1 Introduction... 4 Getting Started... 4 Tour of the Outlook 2011 Interface... 4 Start Outlook 2011... 5 Configure E-mail
ShoreTel Contact Center Using ShoreWare Agent Toolbar
ShoreTel Contact Center Using ShoreWare Agent Toolbar USER GUIDES RELEASE 6 Document and Software Copyrights Copyright 1998 2010 ShoreTel, Inc. All rights reserved. Printed in the United States of America.
DDN CUSTOMER SUPPORT COMMUNITY QUICK START GUIDE
DDN CUSTOMER SUPPORT COMMUNITY QUICK START GUIDE March 10, 2015 v2 Contents Getting an Account Logging In Creating a New Case Updating an Existing Case Using the Knowledgebase Welcome to the DDN Customer
Chronicle USER MANUAL
Chronicle USER MANUAL 1st Edition 2 IN THIS MANUAL Part One The Chronicle Interface The Overview Screen The Bill Detail Screen Part Two Creating, Editing and Viewing Bills Creating Your First Bill Editing
ORACLE BUSINESS INTELLIGENCE WORKSHOP
ORACLE BUSINESS INTELLIGENCE WORKSHOP Integration of Oracle BI Publisher with Oracle Business Intelligence Enterprise Edition Purpose This tutorial mainly covers how Oracle BI Publisher is integrated with
Data Director Create a New Answer Sheet
Data Director Create a New Answer Sheet DataDirector allows you to create answer sheets for assessments. Your answer sheet may contain multiple question types. Once the Answer Sheet is created and saved,
User Manual. Transcriptome Analysis Console (TAC) Software. For Research Use Only. Not for use in diagnostic procedures. P/N 703150 Rev.
User Manual Transcriptome Analysis Console (TAC) Software For Research Use Only. Not for use in diagnostic procedures. P/N 703150 Rev. 1 Trademarks Affymetrix, Axiom, Command Console, DMET, GeneAtlas,
Chapter 2: Getting Started
Chapter 2: Getting Started Once Partek Flow is installed, Chapter 2 will take the user to the next stage and describes the user interface and, of note, defines a number of terms required to understand
TREK HOSC PAYLOAD ETHERNET GATEWAY (HPEG) USER GUIDE
TREK HOSC PAYLOAD ETHERNET GATEWAY (HPEG) USER GUIDE April 2016 Approved for Public Release; Distribution is Unlimited. TABLE OF CONTENTS PARAGRAPH PAGE 1 Welcome... 1 1.1 Getting Started... 1 1.2 System
USING OUTLOOK WITH ENTERGROUP. Microsoft Outlook
USING OUTLOOK WITH ENTERGROUP In this tutorial you will learn how to use Outlook with your EnterGroup account. You will learn how to setup an IMAP or POP account, and also how to move your emails and contacts
Getting Started with MozyPro Online Backup Online Software from Time Warner Cable Business Class
Getting Started with MozyPro Online Backup Online Software from Time Warner Cable Business Class A Guide for Users MozyPro is an online backup service with an easy to use interface so you can start backing
Xerox 700 Digital Color Press with Integrated Fiery Color Server. Utilities
Xerox 700 Digital Color Press with Integrated Fiery Color Server Utilities 2008 Electronics for Imaging, Inc. The information in this publication is covered under Legal Notices for this product. 45072726
Release Information. Copyright. Limit of Liability. Trademarks. Customer Support
Release Information Document Version Number GeneticistAsst-1.1.6-UG002 Software Version 1.1.6 Document Status Final Copyright 2015. SoftGenetics, LLC, All rights reserved. The information contained herein
Archiving and Managing Your Mailbox
Archiving and Managing Your Mailbox We Need You to Do Your Part We ask everyone to participate in routinely cleaning out their mailbox. Large mailboxes with thousands of messages impact backups and may
DROOMS DATA ROOM USER GUIDE. www.drooms.com
USER GUIDE www.drooms.com USER GUIDE Dear User, Whether simply reviewing documentation, sending queries during the due diligence process or administering a data room yourself, Drooms is the software solution
Using WS_FTP. This tutorial explains how to use WS_FTP, a File Transfer Program for Microsoft Windows. INFORMATION SYSTEMS SERVICES.
INFORMATION SYSTEMS SERVICES Using WS_FTP This tutorial explains how to use WS_FTP, a File Transfer Program for Microsoft Windows. AUTHOR: Information Systems Services DATE: July 2003 EDITION: 1.1 TUT
Worldspan Go! Internet Connection Office Management Instructions
Worldspan Go! Internet Connection Office Management Instructions Follow these instructions after the installation of Worldspan Go! These instructions will walk you through getting started to downloading
SPSS: Getting Started. For Windows
For Windows Updated: August 2012 Table of Contents Section 1: Overview... 3 1.1 Introduction to SPSS Tutorials... 3 1.2 Introduction to SPSS... 3 1.3 Overview of SPSS for Windows... 3 Section 2: Entering
Integrated Rule-based Data Management System for Genome Sequencing Data
Integrated Rule-based Data Management System for Genome Sequencing Data A Research Data Management (RDM) Green Shoots Pilots Project Report by Michael Mueller, Simon Burbidge, Steven Lawlor and Jorge Ferrer
GMQL Functional Comparison with BEDTools and BEDOPS
GMQL Functional Comparison with BEDTools and BEDOPS Genomic Computing Group Dipartimento di Elettronica, Informazione e Bioingegneria Politecnico di Milano This document presents a functional comparison
Introduction to NGS data analysis
Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High
Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center
Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing
ORACLE BUSINESS INTELLIGENCE WORKSHOP
ORACLE BUSINESS INTELLIGENCE WORKSHOP Creating Interactive Dashboards and Using Oracle Business Intelligence Answers Purpose This tutorial shows you how to build, format, and customize Oracle Business
Strategic Information Reporting Initiative (SIRI) User Guide for Student Dashboard
Strategic Information Reporting Initiative (SIRI) User Guide for Student Dashboard Table of Contents I. Signing into SIRI... 3 A. Logging on... 3 B. Accessing SIRI off campus... 4 C. Questions... 4 II.
Using Zimbra Briefcase
Using Zimbra Briefcase The Zimbra Collaboration Suite has a built-in utility for storing and sharing files called Briefcase. Putting files into your Briefcase makes them available to you and others that
Information & Communication Technologies FTP and GroupWise Archives Wilfrid Laurier University
Instructions for MAC users MAC users have not been joined to the Active Directory Domain. ICT is unable to capture GroupWise archives you may have on your computer automatically or confirm if you have
Table of Contents. Welcome... 2. Login... 3. Password Assistance... 4. Self Registration... 5. Secure Mail... 7. Compose... 8. Drafts...
Table of Contents Welcome... 2 Login... 3 Password Assistance... 4 Self Registration... 5 Secure Mail... 7 Compose... 8 Drafts... 10 Outbox... 11 Sent Items... 12 View Package Details... 12 File Manager...
Getting Started Guide - Desktop
Getting Started Guide - Desktop 1. Sign Up PERSONAL OPENTEXT CORE ACCOUNT To get started sharing and collaborating on your files from a Mac or Windows browser, you ll need to sign up for your OpenText
Online Test Monitor Certification Course 2014-2015 Transcript
Online Test Monitor Certification Course 2014-2015 Transcript Slide # Slide 1 Slide 2 Slide 3 Slide 4 Slide 5 Slide 6 Slide 7 Minnesota Assessments Test Security Training for Districts and Schools Welcome
picocms Client Training - A pico-cms.com
picocms Client Training - A pico-cms.com Find Our User Manual at http://pico-cms.com/user-manual Login: URL(domain name/login) Layout to training: I. Overview about pico II. Users a. Adding a User b. Edit
FileCruiser. Desktop Agent Guide
FileCruiser Desktop Agent Guide FileCruiser Desktop Agent Guide Contents Contents Getting Started with FileCruiser 1 Using the FileCruiser Agent 2 Desktop Shortcut 2 Log in to FileCruiser Agent 3 Using
Trouble Ticket Express
Trouble Ticket Express Operator Manual rev. 1.0. 2006 by United Web Coders www.unitedwebcoders.com 1. System Overview 1.1. Concepts The Trouble Ticket Express is a web based help desk system. The program
USER GUIDE. Unit 2: Synergy. Chapter 2: Using Schoolwires Synergy
USER GUIDE Unit 2: Synergy Chapter 2: Using Schoolwires Synergy Schoolwires Synergy & Assist Version 2.0 TABLE OF CONTENTS Introductions... 1 Audience... 1 Objectives... 1 Before You Begin... 1 Getting
ShoreTel Enterprise Contact Center Using Agent Toolbar
ShoreTel Enterprise Contact Center Using Agent Toolbar USER GUIDES RELEASE 7 Document and Software Copyrights Copyright 1998 2011 ShoreTel, Inc. All rights reserved. Printed in the United States of America.
PA Payroll Exercise for Intermediate Excel
PA Payroll Exercise for Intermediate Excel Follow the directions below to create a payroll exercise. Read through each individual direction before performing it, like you are following recipe instructions.
The data between TC Monitor and remote devices is exchanged using HTTP protocol. Monitored devices operate either as server or client mode.
1. Introduction TC Monitor is easy to use Windows application for monitoring and control of some Teracom Ethernet (TCW) and GSM/GPRS (TCG) controllers. The supported devices are TCW122B-CM, TCW181B- CM,
Titan Apps. Drive (Documents)
Titan Apps Drive (Documents) University of Wisconsin Oshkosh 7/11/2012 0 Contents What is Titan Apps?... 1 Need Help with Titan Apps?... 1 What other resources can I use to help me with Titan Apps?...
EMC Documentum Webtop
EMC Documentum Webtop Version 6.5 User Guide P/N 300 007 239 A01 EMC Corporation Corporate Headquarters: Hopkinton, MA 01748 9103 1 508 435 1000 www.emc.com Copyright 1994 2008 EMC Corporation. All rights
How Sequencing Experiments Fail
How Sequencing Experiments Fail v1.0 Simon Andrews [email protected] Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine
Icebox - Sendio SPAM Filter
Icebox - Sendio SPAM Filter Sendio Icebox The Navajo Department of Information Technology (DIT) installed and implemented a SPAM filter in 2008 to capture unwanted mail before it gets to your email inbox.
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data The Illumina TopHat Alignment and Cufflinks Assembly and Differential Expression apps make RNA data analysis accessible to any user, regardless
Icebox - Sendio SPAM Filter
Icebox - Sendio SPAM Filter Sendio Icebox The Navajo Department of Information Technology (DIT) installed and implemented a SPAM filter in 2008 to capture unwanted mail before it gets to your email inbox.
Create a PDF File. Tip. In this lesson, you will learn how to:
Create a PDF File Now that you ve seen what an ETD looks like and how to browse the contents, it s time to learn how to convert your own thesis or dissertation into a PDF file. There are several different
Google Drive: Access and organize your files
Google Drive: Access and organize your files Use Google Drive to store and access your files, folders, and Google Docs, Sheets, and Slides anywhere. Change a file on the web, your computer, tablet, or
User Guide. Trade Finance Global. Reports Centre. October 2015. nordea.com/cm OR tradefinance Name of document 8/8 2015/V1
User Guide Trade Finance Global Reports Centre October 2015 nordea.com/cm OR tradefinance Name of document 2015/V1 8/8 Table of Contents 1 Trade Finance Global (TFG) Reports Centre Overview... 4 1.1 Key
How To Use Helpdesk Online On A Pc Or Mac Or Mac (For Pc Or Ipa) On A Mac Or Ipad (For Mac) On Pc Or Pc Or Pb (For Ipa Or Mac)
About Helpdesk Online Helpdesk Online is a web portal for CGS dealers and customers that handles support issues such as software error reports, license problems or feature requests. Helpdesk Online allows
USER GUIDE for LEAD AUDITORS
USER GUIDE for LEAD AUDITORS Surveys, Audits, Assessments and Reviews Information System Doc 22-0085 Rev0 Paper copies of this document may not be current and should not be relied on for official purposes.
WEBMAIL User s Manual
WEBMAIL User s Manual Overview What it is: What it is not: A convenient method of retrieving and sending mails while you re away from your home computer. A sophisticated mail client meant to be your primary
N E X U S C O P Y N U M B E R H O W T O G U I D E S
HOW TO ACCESS THE ISCA DATA STORED IN BIODISCOVERY NEXUS DB GENOMIC DATA REPOSITORY: The ISCA (International Standard for Cytogenomic Arrays) consortium database contains whole genome array data from a
Plesk for Windows Copyright Notice
2 Plesk for Windows Copyright Notice ISBN: N/A SWsoft. 13755 Sunrise Valley Drive Suite 325 Herndon VA 20171 USA Phone: +1 (703) 815 5670 Fax: +1 (703) 815 5675 Copyright 1999-2007, SWsoft Holdings, Ltd.
Contents. Using Web Access... 1. Managing Shared Folders... 28. Managing Account Settings... 36. Index... 39
Contents Using Web Access... 1 Using the Sign In Page... 1 Signing In to Seagate Global Access... 2 Creating a Seagate Global Access Account... 2 If You Forget Your Password... 5 Viewing Central Axis Details...
NJCU WEBSITE TRAINING MANUAL
NJCU WEBSITE TRAINING MANUAL Submit Support Requests to: http://web.njcu.edu/its/websupport/ (Login with your GothicNet Username and Password.) Table of Contents NJCU WEBSITE TRAINING: Content Contributors...
DiskPulse DISK CHANGE MONITOR
DiskPulse DISK CHANGE MONITOR User Manual Version 7.9 Oct 2015 www.diskpulse.com [email protected] 1 1 DiskPulse Overview...3 2 DiskPulse Product Versions...5 3 Using Desktop Product Version...6 3.1 Product
