Distributed Data Mining in Discovery Net. Dr. Moustafa Ghanem Department of Computing Imperial College London

Size: px
Start display at page:

Download "Distributed Data Mining in Discovery Net. Dr. Moustafa Ghanem Department of Computing Imperial College London"

Transcription

1 Distributed Data Mining in Discovery Net Dr. Moustafa Ghanem Department of Computing Imperial College London

2 1. What is Discovery Net 2. Distributed Data Mining for Compute Intensive Tasks 3. Distributed Data Mining for Sensor Grids 4. Knowledge Discovery from Naturally Distributed Data Sources 5. What Do Scientists Really Want?

3 1. What is Discovery Net

4 What is Discovery Net? Funding : One of the eight UK national e-science Pilot Projects funded by EPSRC ( 2.2M) Start Oct 2001, End March 2005 Goal :Construct the World s first Infrastructure for Global Knowledge Discovery Services Key Technologies: Open Service Computing High Throughput Devices and Real Time Data Mining Real Time Data Integration & Information Structuring Cross Domain Knowledge Discovery and Management Discovery Workflow and Discovery Planning

5 Discovery Net Applications Life Sciences High throughput genomics and proteomics Distributed Databases and Applications Environmental Modelling High throughput dispersed air sensing technology Sensor Grids A B C D E F G H I J K M L N Real time geo-hazard modelling Earthquake modelling through satellite imagery High performance Distributed Computation

6 Discovery Net Architecture DPML Web/Grid Services OGSA D-Net Clients: End-user applications and user interface allowing scientists to construct and drive knowledge discovery activities D-Net Middleware: Provides services and execution logic for distributed knowledge discovery and access to distributed resources and services High Performance Communication Protocol (GridFTP, DSTP..) Grid Infrastructure (GSI) Goal: Plug & Play Data Sources, Analysis Components & Knowledge Discovery Processes Computation & Data Resources: Distributed databases, compute servers and scientific devices.

7 Discovery Net Data Mining Components Generic Data Mining Classification, Clustering, Associations,.. Unstructured-Data Mining Text Mining, Image Mining Domain-specific Mining Bioinformatics, Cheminformatics,..

8 2. Distribution of Compute Intensive Tasks a. Distributed Data Mining for Geo-hazard Prediction

9 Grid-based Geo-hazard Data Mining Grid-based HPC Computation Automatically co-register a stack of imagery layers at high precision and speed. Workflow to Coordinate Grid Computation Data Warehousing & Modelling Co-registration & geo-rectification Image features extraction Cluster & classification Grid-based Data Access and Integration

10 Normalised cross-correlation (NCC) template algorithm Image before Image after Reading Data set Setting comparing window Significant correlation coefficient Reading Data set Setting search window Setting comparing window N Operating on a remotely accessed MPI UNIX parallel computer through fast network with DNet interface. Slow but high accuracy: 24 processors 10 hours for one scene of Landsat-7 ETM+ Pan imagery data. The algorithm also run on GRID. Y Delta X Delta X Correlation coefficient

11

12 2. Distribution of Compute Intensive Tasks b. Distributed Clustering

13 Workflows for Distributed Data Clustering

14 3. Distributed Mining over Sensor Grid Data Distributed Spatial Data Mining for Air Pollution Modelling

15 Sensor Specification The GUSTO Project - Update (Generic UV Sensors Technologies & Observations) High throughput open path spectrometer system Robust algorithm for pollutant concentration retrievals Measures SO2, NO, NO2,O3 & Benzene to ppb levels every few seconds Geared for networking of multiple GUSTO units within a GRID Infrastructure Can support Remote Sensing data for (contour) mapping of pollutants

16 Networking of Multiple GUSTO Units GUSTO unit 1 GUSTO unit 2 GUSTO unit 3 GUSTO unit 4 HTTP, SOAP, GSI Wireless connectivity Data upload service Sensor registry & control service SensorML Archived weather data Warehouse Archived health data Data access service Monitoring and control software HTTP, SOAP, GSI Public access Web visualizer Visualisation and Data Mining GRID Infrastructure

17 Pollution analysis

18

19

20

21 4. Knowledge Discovery from Naturally Distributed Data Sources Distributed Data Mining in Life Sciences

22 Distributed Data Mining for Life Sciences secondary structure tertiary structure polymorphism patient records epidemiology expression patterns physiology sequences alignments ATGCAAGTCCCT AAGATTGCATAA GCTCGCTCAGTT receptors signals pathways linkage maps cytogenetic maps physical maps

23 Information Integration Gene Expression Warehouse OMIM ExPASy SwissProt PDB ExPASy Enzyme Disease Protein Enzyme Affy Fragment LocusLink Known Gene MGD Sequence Metabolite Sequence Cluster SNP Pathway SPAD Genbank NCBI dbsnp KEGG NMR UniGene Given a collection of microarray generated gene expression data, what kind of questions the users wish to pose. Design an integration schema?

24 From Data Integration to Knowledge Unification In Silico Experiment D-World I-World K-World

25 Life Science Application: SC2002 HPC Challenge High Throughput Sequencers Identify Organism Chromosomes Identify Organism s DNA D-Net based Global Collaborative Real- Time Genome Annotation Nucleotide-level Annotation Genes Gene markers Regulatory Regions Segmental Duplication Literature References trnas, rrnas Non-translated RNAs Repetitive Elements SNP Variations.. EMBL TIGR NCBI SNP genscan grail E-PCR blast Repeat Masker genscan Protein-level Annotation Identify Proteins Functional Characteisation Domain Classify into Protein Families Homologues 3-D Structure Inter Pro SMART Inter Pro SWISS PROT blast PFAM 3D-PSSM Motif Search Genome Annotation Fold Prediction Literature References Secondary structure.. predator DSC Process-level Annotation Relate Cell Cycle Drugs Cell death Literature References Metabolism Biological Process.. Embryogenesis.. GO KEGG CSNDB GK Pathway Maps AmiGO virtual chip Ontologies GeneMaps GenNav 15 DBs 21 Applications

26 HPC Challenge SC2002 Download sequence from Reference Server Nucleotide Annotation Workflows Interactive Editor & Visualisation Real-time sequencing in London Inter Pro EMBL SMART NCBI KEGG SWISS PROT Save to Distributed Annotation Server TIGR SNP GO Distributed data and computation 1800 clicks 500 Web access 200 copy/paste 3 weeks work in 1 workflow and few second execution Execute distributed annotation workflow

27 Discovery Net in Action: China SARS Virtual Lab Homology search against viral genome DB Homology search against protein DB Genbank Annotation using Artemis and GenSense Gene prediction Predicted genes Annotation using Artemis and GenSense Homology search against motif DB Key word search GeneSense Ontology Exon prediction Splice site prediction Multiple sequence alignment Phylogenetic analysis Immunogenetics D-Net: Integration, interpretation, and discovery Relationship between SARS and other virus Mutual regions identification Protein localization site prediction Protein interaction prediction Relationship between SARS virus and human receptors prediction Microarray analysis Epidemiological analysis SARS patients diagnosis Classification and secondary structure prediction Bibliographic databases Bibliographic databases

28 Discovery Net in Action: SARS Virus Mutation Analysis

29 5. What do Scientist Really Want? Does it really work?

30 Towards Compositional Grid Services Native MPI OGSA-service Condor-G Web Service Service Browsing Workflow Warehousing Workflow Authoring Composing services Resource Mapping Sun Grid Engine Service Abstraction Oralce 10g Unicore Workflow Execution A compositional GRID Web Wrapper Workflow Management Collaborative Knowledge Management Workflow Deployment: Grid Service and Portal

31 Discovery Net Service Composition

32 Full Workflow

33 Executing Protein Annotation Workflow

34 Deployment of Node

35 Deploying Protein Annotation Workflow

36 Executing Deployed Service

37 Locating & Executing Deployed Service from Discovery Net

38 Workflow Provenance

39 Workflow Warehousing

40 Discovery Net Snapshot Scientific Information In Real Time Scientific Discovery Literature Real Time Data Integration Discovery Services Service Workflow Databases Operational Data Dynamic Application Integration Integrative Knowledge Management Using Distributed Resources Images Instrument Data

Using the Grid for the interactive workflow management in biomedicine. Andrea Schenone BIOLAB DIST University of Genova

Using the Grid for the interactive workflow management in biomedicine. Andrea Schenone BIOLAB DIST University of Genova Using the Grid for the interactive workflow management in biomedicine Andrea Schenone BIOLAB DIST University of Genova overview background requirements solution case study results background A multilevel

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

Bioinformatics Grid - Enabled Tools For Biologists.

Bioinformatics Grid - Enabled Tools For Biologists. Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis

More information

Using Ontologies in Proteus for Modeling Data Mining Analysis of Proteomics Experiments

Using Ontologies in Proteus for Modeling Data Mining Analysis of Proteomics Experiments Using Ontologies in Proteus for Modeling Data Mining Analysis of Proteomics Experiments Mario Cannataro, Pietro Hiram Guzzi, Tommaso Mazza, and Pierangelo Veltri University Magna Græcia of Catanzaro, 88100

More information

Core Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1

Core Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1 Core Bioinformatics 2014/2015 Code: 42397 ECTS Credits: 12 Degree Type Year Semester 4313473 Bioinformàtica/Bioinformatics OB 0 1 Contact Name: Sònia Casillas Viladerrams Email: [email protected]

More information

Vad är bioinformatik och varför behöver vi det i vården? a bioinformatician's perspectives

Vad är bioinformatik och varför behöver vi det i vården? a bioinformatician's perspectives Vad är bioinformatik och varför behöver vi det i vården? a bioinformatician's perspectives [email protected] 2015-05-21 Functional Bioinformatics, Örebro University Vad är bioinformatik och varför

More information

A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques

A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques Proceedings of the 2007 WSEAS International Conference on Computer Engineering and Applications, Gold Coast, Australia, January 17-19, 2007 402 A Multiple DNA Sequence Translation Tool Incorporating Web

More information

EMBL Identity & Access Management

EMBL Identity & Access Management EMBL Identity & Access Management Rupert Lück EMBL Heidelberg e IRG Workshop Zürich Apr 24th 2008 Outline EMBL Overview Identity & Access Management for EMBL IT Requirements & Strategy Project Goal and

More information

Linear Sequence Analysis. 3-D Structure Analysis

Linear Sequence Analysis. 3-D Structure Analysis Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical properties Molecular weight (MW), isoelectric point (pi), amino acid content, hydropathy (hydrophilic

More information

THE CCLRC DATA PORTAL

THE CCLRC DATA PORTAL THE CCLRC DATA PORTAL Glen Drinkwater, Shoaib Sufi CCLRC Daresbury Laboratory, Daresbury, Warrington, Cheshire, WA4 4AD, UK. E-mail: [email protected], [email protected] Abstract: The project aims

More information

Cloud-Based Big Data Analytics in Bioinformatics

Cloud-Based Big Data Analytics in Bioinformatics Cloud-Based Big Data Analytics in Bioinformatics Presented By Cephas Mawere Harare Institute of Technology, Zimbabwe 1 Introduction 2 Big Data Analytics Big Data are a collection of data sets so large

More information

IEEE International Conference on Computing, Analytics and Security Trends CAST-2016 (19 21 December, 2016) Call for Paper

IEEE International Conference on Computing, Analytics and Security Trends CAST-2016 (19 21 December, 2016) Call for Paper IEEE International Conference on Computing, Analytics and Security Trends CAST-2016 (19 21 December, 2016) Call for Paper CAST-2015 provides an opportunity for researchers, academicians, scientists and

More information

Syllabus of B.Sc. (Bioinformatics) Subject- Bioinformatics (as one subject) B.Sc. I Year Semester I Paper I: Basic of Bioinformatics 85 marks

Syllabus of B.Sc. (Bioinformatics) Subject- Bioinformatics (as one subject) B.Sc. I Year Semester I Paper I: Basic of Bioinformatics 85 marks Syllabus of B.Sc. (Bioinformatics) Subject- Bioinformatics (as one subject) B.Sc. I Year Semester I Paper I: Basic of Bioinformatics 85 marks Semester II Paper II: Mathematics I 85 marks B.Sc. II Year

More information

Integrating Bioinformatics, Medical Sciences and Drug Discovery

Integrating Bioinformatics, Medical Sciences and Drug Discovery Integrating Bioinformatics, Medical Sciences and Drug Discovery M. Madan Babu Centre for Biotechnology, Anna University, Chennai - 600025 phone: 44-4332179 :: email: [email protected] Bioinformatics

More information

Processing Genome Data using Scalable Database Technology. My Background

Processing Genome Data using Scalable Database Technology. My Background Johann Christoph Freytag, Ph.D. [email protected] http://www.dbis.informatik.hu-berlin.de Stanford University, February 2004 PhD @ Harvard Univ. Visiting Scientist, Microsoft Res. (2002)

More information

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:

More information

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

Lecture 11 Data storage and LIMS solutions. Stéphane LE CROM [email protected]

Lecture 11 Data storage and LIMS solutions. Stéphane LE CROM lecrom@biologie.ens.fr Lecture 11 Data storage and LIMS solutions Stéphane LE CROM [email protected] Various steps of a DNA microarray experiment Experimental steps Data analysis Experimental design set up Chips on catalog

More information

Guide for Bioinformatics Project Module 3

Guide for Bioinformatics Project Module 3 Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first

More information

Teaching Bioinformatics to Undergraduates

Teaching Bioinformatics to Undergraduates Teaching Bioinformatics to Undergraduates http://www.med.nyu.edu/rcr/asm Stuart M. Brown Research Computing, NYU School of Medicine I. What is Bioinformatics? II. Challenges of teaching bioinformatics

More information

BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16

BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16 Course Director: Dr. Barry Grant (DCM&B, [email protected]) Description: This is a three module course covering (1) Foundations of Bioinformatics, (2) Statistics in Bioinformatics, and (3) Systems

More information

Bioinformatics: course introduction

Bioinformatics: course introduction Bioinformatics: course introduction Filip Železný Czech Technical University in Prague Faculty of Electrical Engineering Department of Cybernetics Intelligent Data Analysis lab http://ida.felk.cvut.cz

More information

REGULATIONS FOR THE DEGREE OF MASTER OF SCIENCE IN COMPUTER SCIENCE (MSc[CompSc])

REGULATIONS FOR THE DEGREE OF MASTER OF SCIENCE IN COMPUTER SCIENCE (MSc[CompSc]) 244 REGULATIONS FOR THE DEGREE OF MASTER OF SCIENCE IN COMPUTER SCIENCE (MSc[CompSc]) (See also General Regulations) Any publication based on work approved for a higher degree should contain a reference

More information

HETEROGENEOUS DATA INTEGRATION FOR CLINICAL DECISION SUPPORT SYSTEM. Aniket Bochare - [email protected]. CMSC 601 - Presentation

HETEROGENEOUS DATA INTEGRATION FOR CLINICAL DECISION SUPPORT SYSTEM. Aniket Bochare - aniketb1@umbc.edu. CMSC 601 - Presentation HETEROGENEOUS DATA INTEGRATION FOR CLINICAL DECISION SUPPORT SYSTEM Aniket Bochare - [email protected] CMSC 601 - Presentation Date-04/25/2011 AGENDA Introduction and Background Framework Heterogeneous

More information

An approach to grid scheduling by using Condor-G Matchmaking mechanism

An approach to grid scheduling by using Condor-G Matchmaking mechanism An approach to grid scheduling by using Condor-G Matchmaking mechanism E. Imamagic, B. Radic, D. Dobrenic University Computing Centre, University of Zagreb, Croatia {emir.imamagic, branimir.radic, dobrisa.dobrenic}@srce.hr

More information

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each

More information

Euro-BioImaging European Research Infrastructure for Imaging Technologies in Biological and Biomedical Sciences

Euro-BioImaging European Research Infrastructure for Imaging Technologies in Biological and Biomedical Sciences Euro-BioImaging European Research Infrastructure for Imaging Technologies in Biological and Biomedical Sciences WP11 Data Storage and Analysis Task 11.1 Coordination Deliverable 11.2 Community Needs of

More information

A Platform for Collaborative e-science Applications. Marian Bubak ICS / Cyfronet AGH Krakow, PL [email protected]

A Platform for Collaborative e-science Applications. Marian Bubak ICS / Cyfronet AGH Krakow, PL bubak@agh.edu.pl A Platform for Collaborative e-science Applications Marian Bubak ICS / Cyfronet AGH Krakow, PL [email protected] Outline Motivation Idea of an experiment Virtual laboratory Examples of experiments Summary

More information

Final Project Report

Final Project Report CPSC545 by Introduction to Data Mining Prof. Martin Schultz & Prof. Mark Gerstein Student Name: Yu Kor Hugo Lam Student ID : 904907866 Due Date : May 7, 2007 Introduction Final Project Report Pseudogenes

More information

The Human Genome Project

The Human Genome Project The Human Genome Project Brief History of the Human Genome Project Physical Chromosome Maps Genetic (or Linkage) Maps DNA Markers Sequencing and Annotating Genomic DNA What Have We learned from the HGP?

More information

Cluster, Grid, Cloud Concepts

Cluster, Grid, Cloud Concepts Cluster, Grid, Cloud Concepts Kalaiselvan.K Contents Section 1: Cluster Section 2: Grid Section 3: Cloud Cluster An Overview Need for a Cluster Cluster categorizations A computer cluster is a group of

More information

Biological Databases and Protein Sequence Analysis

Biological Databases and Protein Sequence Analysis Biological Databases and Protein Sequence Analysis Introduction M. Madan Babu, Center for Biotechnology, Anna University, Chennai 25, India Bioinformatics is the application of Information technology to

More information

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS

More information

BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS

BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS 1. The Technology Strategy sets out six areas where technological developments are required to push the frontiers of knowledge

More information

Novel Mining of Cancer via Mutation in Tumor Protein P53 using Quick Propagation Network

Novel Mining of Cancer via Mutation in Tumor Protein P53 using Quick Propagation Network Novel Mining of Cancer via Mutation in Tumor Protein P53 using Quick Propagation Network Ayad. Ghany Ismaeel, and Raghad. Zuhair Yousif Abstract There is multiple databases contain datasets of TP53 gene

More information

Protein Protein Interaction Networks

Protein Protein Interaction Networks Functional Pattern Mining from Genome Scale Protein Protein Interaction Networks Young-Rae Cho, Ph.D. Assistant Professor Department of Computer Science Baylor University it My Definition of Bioinformatics

More information

An Introduction to Genomics and SAS Scientific Discovery Solutions

An Introduction to Genomics and SAS Scientific Discovery Solutions An Introduction to Genomics and SAS Scientific Discovery Solutions Dr Karen M Miller Product Manager Bioinformatics SAS EMEA 16.06.03 Copyright 2003, SAS Institute Inc. All rights reserved. 1 Overview!

More information

Three data delivery cases for EMBL- EBI s Embassy. Guy Cochrane www.ebi.ac.uk

Three data delivery cases for EMBL- EBI s Embassy. Guy Cochrane www.ebi.ac.uk Three data delivery cases for EMBL- EBI s Embassy Guy Cochrane www.ebi.ac.uk EMBL European Bioinformatics Institute Genes, genomes & variation European Nucleotide Archive 1000 Genomes Ensembl Ensembl Genomes

More information

How To Use The Assembly Database In A Microarray (Perl) With A Microarcode) (Perperl 2) (For Macrogenome) (Genome 2)

How To Use The Assembly Database In A Microarray (Perl) With A Microarcode) (Perperl 2) (For Macrogenome) (Genome 2) The Ensembl Core databases and API Useful links Installation instructions: http://www.ensembl.org/info/docs/api/api_installation.html Schema description: http://www.ensembl.org/info/docs/api/core/core_schema.html

More information

Dr Alexander Henzing

Dr Alexander Henzing Horizon 2020 Health, Demographic Change & Wellbeing EU funding, research and collaboration opportunities for 2016/17 Innovate UK funding opportunities in omics, bridging health and life sciences Dr Alexander

More information

The Lattice Project: A Multi-Model Grid Computing System. Center for Bioinformatics and Computational Biology University of Maryland

The Lattice Project: A Multi-Model Grid Computing System. Center for Bioinformatics and Computational Biology University of Maryland The Lattice Project: A Multi-Model Grid Computing System Center for Bioinformatics and Computational Biology University of Maryland Parallel Computing PARALLEL COMPUTING a form of computation in which

More information

From Data to Foresight:

From Data to Foresight: Laura Haas, IBM Fellow IBM Research - Almaden From Data to Foresight: Leveraging Data and Analytics for Materials Research 1 2011 IBM Corporation The road from data to foresight is long? Consumer Reports

More information

SGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD

SGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD White Paper SGI High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems Haruna Cofer*, PhD January, 2012 Abstract The SGI High Throughput Computing (HTC) Wrapper

More information

Big Data in BioMedical Sciences. Steven Newhouse, Head of Technical Services, EMBL-EBI

Big Data in BioMedical Sciences. Steven Newhouse, Head of Technical Services, EMBL-EBI Big Data in BioMedical Sciences Steven Newhouse, Head of Technical Services, EMBL-EBI Big Data for BioMedical Sciences EMBL-EBI: What we do and why? Challenges & Opportunities Infrastructure Requirements

More information

Anwendungsintegration und Workflows mit UNICORE 6

Anwendungsintegration und Workflows mit UNICORE 6 Mitglied der Helmholtz-Gemeinschaft Anwendungsintegration und Workflows mit UNICORE 6 Bernd Schuller und UNICORE-Team Jülich Supercomputing Centre, Forschungszentrum Jülich GmbH 26. November 2009 D-Grid

More information

An agent-based layered middleware as tool integration

An agent-based layered middleware as tool integration An agent-based layered middleware as tool integration Flavio Corradini Leonardo Mariani Emanuela Merelli University of L Aquila University of Milano University of Camerino ITALY ITALY ITALY Helsinki FSE/ESEC

More information

BIO 3352: BIOINFORMATICS II HYBRID COURSE SYLLABUS

BIO 3352: BIOINFORMATICS II HYBRID COURSE SYLLABUS BIO 3352: BIOINFORMATICS II HYBRID COURSE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title: Bioinformatics

More information

Web-Based Genomic Information Integration with Gene Ontology

Web-Based Genomic Information Integration with Gene Ontology Web-Based Genomic Information Integration with Gene Ontology Kai Xu 1 IMAGEN group, National ICT Australia, Sydney, Australia, [email protected] Abstract. Despite the dramatic growth of online genomic

More information

What s New in Pathway Studio Web 11.1

What s New in Pathway Studio Web 11.1 1 1 What s New in Pathway Studio Web 11.1 Elseiver is pleased to announce the release of Pathway Studio Web 11.1 for all database subscriptions (Mammal, Mammal+ChemEffect+DiseaseFx, Plant). This release

More information

PARALLEL & CLUSTER COMPUTING CS 6260 PROFESSOR: ELISE DE DONCKER BY: LINA HUSSEIN

PARALLEL & CLUSTER COMPUTING CS 6260 PROFESSOR: ELISE DE DONCKER BY: LINA HUSSEIN 1 PARALLEL & CLUSTER COMPUTING CS 6260 PROFESSOR: ELISE DE DONCKER BY: LINA HUSSEIN Introduction What is cluster computing? Classification of Cluster Computing Technologies: Beowulf cluster Construction

More information

Introduction to Genome Annotation

Introduction to Genome Annotation Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT

More information

Tutorial for proteome data analysis using the Perseus software platform

Tutorial for proteome data analysis using the Perseus software platform Tutorial for proteome data analysis using the Perseus software platform Laboratory of Mass Spectrometry, LNBio, CNPEM Tutorial version 1.0, January 2014. Note: This tutorial was written based on the information

More information

Search and Data Mining: Techniques. Applications Anya Yarygina Boris Novikov

Search and Data Mining: Techniques. Applications Anya Yarygina Boris Novikov Search and Data Mining: Techniques Applications Anya Yarygina Boris Novikov Introduction Data mining applications Data mining system products and research prototypes Additional themes on data mining Social

More information

Efficient Parallel Execution of Sequence Similarity Analysis Via Dynamic Load Balancing

Efficient Parallel Execution of Sequence Similarity Analysis Via Dynamic Load Balancing Efficient Parallel Execution of Sequence Similarity Analysis Via Dynamic Load Balancing James D. Jackson Philip J. Hatcher Department of Computer Science Kingsbury Hall University of New Hampshire Durham,

More information

Cloud Computing Solutions for Genomics Across Geographic, Institutional and Economic Barriers

Cloud Computing Solutions for Genomics Across Geographic, Institutional and Economic Barriers Cloud Computing Solutions for Genomics Across Geographic, Institutional and Economic Barriers Ntinos Krampis Asst. Professor J. Craig Venter Institute [email protected] http://www.jcvi.org/cms/about/bios/kkrampis/

More information

Integrated Rule-based Data Management System for Genome Sequencing Data

Integrated Rule-based Data Management System for Genome Sequencing Data Integrated Rule-based Data Management System for Genome Sequencing Data A Research Data Management (RDM) Green Shoots Pilots Project Report by Michael Mueller, Simon Burbidge, Steven Lawlor and Jorge Ferrer

More information

org.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers.

org.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers. org.rn.eg.db December 16, 2015 org.rn.egaccnum Map Entrez Gene identifiers to GenBank Accession Numbers org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank

More information

Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011

Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011 Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear

More information

A W orkflow Management System for Bioinformatics Grid

A W orkflow Management System for Bioinformatics Grid A W orkflow Management System for Bioinformatics Grid Giovanni Aloisio, Massimo Cafaro, Sandro Fiore, Maria Mirto C A C T/IS U FI SP A CI, University of Lecce and NNL/INFM&CNR,Italy NETTAB 2005, 5-7 October

More information

Scientific and Technical Applications as a Service in the Cloud

Scientific and Technical Applications as a Service in the Cloud Scientific and Technical Applications as a Service in the Cloud University of Bern, 28.11.2011 adapted version Wibke Sudholt CloudBroker GmbH Technoparkstrasse 1, CH-8005 Zurich, Switzerland Phone: +41

More information

A Reliable and Fast Data Transfer for Grid Systems Using a Dynamic Firewall Configuration

A Reliable and Fast Data Transfer for Grid Systems Using a Dynamic Firewall Configuration A Reliable and Fast Data Transfer for Grid Systems Using a Dynamic Firewall Configuration Thomas Oistrez Research Centre Juelich Juelich Supercomputing Centre August 21, 2008 1 / 16 Overview 1 UNICORE

More information

Databases and mapping BWA. Samtools

Databases and mapping BWA. Samtools Databases and mapping BWA Samtools FASTQ, SFF, bax.h5 ACE, FASTG FASTA BAM/SAM GFF, BED GenBank/Embl/DDJB many more File formats FASTQ Output format from Illumina and IonTorrent sequencers. Quality scores:

More information

Human Genome and Human Genome Project. Louxin Zhang

Human Genome and Human Genome Project. Louxin Zhang Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular

More information

Sequencing the Human Genome

Sequencing the Human Genome Revised and Updated Edvo-Kit #339 Sequencing the Human Genome 339 Experiment Objective: In this experiment, students will read DNA sequences obtained from automated DNA sequencing techniques. The data

More information

Technical. Overview. ~ a ~ irods version 4.x

Technical. Overview. ~ a ~ irods version 4.x Technical Overview ~ a ~ irods version 4.x The integrated Ru e-oriented DATA System irods is open-source, data management software that lets users: access, manage, and share data across any type or number

More information

Big Data Analytics and Healthcare

Big Data Analytics and Healthcare Big Data Analytics and Healthcare Anup Kumar, Professor and Director of MINDS Lab Computer Engineering and Computer Science Department University of Louisville Road Map Introduction Data Sources Structured

More information

Classic Grid Architecture

Classic Grid Architecture Peer-to to-peer Grids Classic Grid Architecture Resources Database Database Netsolve Collaboration Composition Content Access Computing Security Middle Tier Brokers Service Providers Middle Tier becomes

More information

Pipeline Pilot Enterprise Server. Flexible Integration of Disparate Data and Applications. Capture and Deployment of Best Practices

Pipeline Pilot Enterprise Server. Flexible Integration of Disparate Data and Applications. Capture and Deployment of Best Practices overview Pipeline Pilot Enterprise Server Pipeline Pilot Enterprise Server (PPES) is a powerful client-server platform that streamlines the integration and analysis of the vast quantities of data flooding

More information

Big Data Mining Services and Knowledge Discovery Applications on Clouds

Big Data Mining Services and Knowledge Discovery Applications on Clouds Big Data Mining Services and Knowledge Discovery Applications on Clouds Domenico Talia DIMES, Università della Calabria & DtoK Lab Italy [email protected] Data Availability or Data Deluge? Some decades

More information

School of Nursing. Presented by Yvette Conley, PhD

School of Nursing. Presented by Yvette Conley, PhD Presented by Yvette Conley, PhD What we will cover during this webcast: Briefly discuss the approaches introduced in the paper: Genome Sequencing Genome Wide Association Studies Epigenomics Gene Expression

More information

Big Data in Drug Discovery

Big Data in Drug Discovery Big Data in Drug Discovery David J. Wild Assistant Professor & Director, Cheminformatics Program Indiana University School of Informatics and Computing [email protected] - http://djwild.info Epochs in

More information

Preparing the scenario for the use of patient s genome sequences in clinic. Joaquín Dopazo

Preparing the scenario for the use of patient s genome sequences in clinic. Joaquín Dopazo Preparing the scenario for the use of patient s genome sequences in clinic Joaquín Dopazo Computational Medicine Institute, Centro de Investigación Príncipe Felipe (CIPF), Functional Genomics Node, (INB),

More information

Genome Explorer For Comparative Genome Analysis

Genome Explorer For Comparative Genome Analysis Genome Explorer For Comparative Genome Analysis Jenn Conn 1, Jo L. Dicks 1 and Ian N. Roberts 2 Abstract Genome Explorer brings together the tools required to build and compare phylogenies from both sequence

More information

Check Your Data Freedom: A Taxonomy to Assess Life Science Database Openness

Check Your Data Freedom: A Taxonomy to Assess Life Science Database Openness Check Your Data Freedom: A Taxonomy to Assess Life Science Database Openness Melanie Dulong de Rosnay Fellow, Science Commons and Berkman Center for Internet & Society at Harvard University This article

More information

Informatics and Knowledge Management at the Novartis Institutes for BioMedical Research (NIBR)

Informatics and Knowledge Management at the Novartis Institutes for BioMedical Research (NIBR) Informatics and Knowledge Management at the Novartis Institutes for BioMedical Research (NIBR) Enable Science in silico & Provide the Right Knowledge to the Right People at the Right Time to enable the

More information