GenBank, Entrez, & FASTA

Size: px
Start display at page:

Download "GenBank, Entrez, & FASTA"

Transcription

1 GenBank, Entrez, & FASTA

2 Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories, particularly for long-term study of bioinformatic data flat files; not built for (and not great at) querying

3 Nucleotide Sequence Databases Second generation: Entrez gene is an example information is gene-centric (not just sequencecentric) all sequence information for a given gene can be found in one place

4 Nucleotide Sequence Databases Third generation: Ensembl is a good example dex.html Information is organized around whole genomes; not only a specific gene s structure, but its context: position of this gene relative to others strand orientation how gene relates to presence or absence of biochemical functions in organism

5 GenBank First example: prokaryotic gene point your browser to: choose Nucleotide from the Search pull-down menu in For box, type X01714 and click Go Click the link labeled X01714 Can Send To Text if you want to save the file

6 GenBank fields LOCUS size of sequence (in base pairs) nature of molecule (e.g. DNA or RNA) topology (linear or circular) DEFINITION: brief description of gene ACCESSION: unique identifier for this (and some other) databases VERSION: lists synonymous or past ID numbers

7 GenBank fields KEYWORDS: list of terms related to entry; can be used for keyword searching for related data SOURCE: common name of relevant organism ORGANISM: complete id, with taxonomic classification note that ORGANISM is indented under SOURCE; this indicates that ORGANISM is a subordinate term, or subsection, of SOURCE

8 GenBank fields REFERENCE: credits author(s) who initially determined the sequence; includes subsections: AUTHOR TITLE JOURNAL PUBMED COMMENT: free-formatted text that doesn t fit in another category

9 GenBank fields FEATURES: table describing gene regions and associated biological properties source: origin of specific regions of sequence; useful for distinguishing cloning vectors from host sequences promoter: precise coordinates of promoter element in the sequence; may be more than one of these misc feature: in this example, indicates (putative) location of transcription start (mrna synthesis) RBS (ribosome binding site): location of last upstream element CDS (CoDing Segment): describes the ORF

10 GenBank fields: FEATURES: CDS gives coordinates from initial nucleotide (ATG) to last nucleotide of stop codon (TAA) several lines follow, listing protein products, reading frame to use, genetic code to apply and several IDs for the protein sequence /translation section gives computer translation of sequence into amino acid sequence

11 Last Section: sequence itself This is the most important section in terms of analysis using other tools Can isolate just this section and save the file, using either the Download pull-down on the FASTA format page, or the more general method discussed later

12 Example 2: eukaryotic mrna Can obtain this example by searching Nucleotide database for U90223 Similar to prokaryote example, because we re looking at a direct coding sequence for a protein not DNA, in other words Notes on example: KEYWORD field is empty: this is an example of an incomplete annotation remember, you re looking at a primary database! FEATURES field contains some new terms: sig_peptide: location of mitochondrial targeting sequence mat_peptide: exact boundaries of mature peptide

13 Example 3: Eukaryotic gene Can obtain this record by searching Nucleotide for AF General information: LOCUS: same info as previous examples note the locus name is different from the accession number this time DEFINITION: specifies exon; remember, protein-coding regions in eukaryotes are not contiguous as in prokaryotes SEGMENT: indicates this is the second of 4; you d need all 4 to reconstruct the mrna that codes for the protein

14 Eukaryotic gene: FEATURES section source subsection includes a /map section: indicates chromosome (15) arm (q means long arm) cytogenic band (q21.1)

15 Eukaryotic gene: FEATURES section gene subsection: describes how to reconstruct the mrnas found in this and separate entries: the strings that begin AF refer to the GenBank entries (remember, this one was AF018430), and the numbers represent the nucleotide positions from the entries if a set of numbers (example: ) is NOT preceded by an entry indicator, it s from the current entry The < and > signs indicate that the start and stop points are only approximate

16 Eukaryotic gene: FEATURES section mrna section: can be read in a similar manner to the gene section note that there are two mrna sections (each followed by a CDS section) first section describes mitochondrial RNA second section describes nuclear RNA exon section: indicates position of exon(s) in sequence

17 Retrieving GenBank entries without accession numbers Search Nucleotide for specific product you re interested in; for example: human[organism] AND dutpase[protein name] this search yields several entries; can click the Links link to the right of one of these (AF018432) and choose Related Sequences from the pull-down that appears retrieves several more entries, some DNA and some mrna terms used in the titles of these entries can give us additional search criteria: human*organism+ AND dutp pyrophosphatase *Title+ yields somewhat different set of entries

18 FASTA format Standard data format for sequence data (nucleotide & protein) Includes: definition line (starts with > character) sequence data residues represented as single letters all caps Default input format for many sequence analysis tools For raw format, use FASTA without definition line(s)

19 Obtaining FASTA from GenBank record Click FASTA link (near top of page) Copy the entire entry (from > to last letter) and paste it into notepad Save the file under a relevant name

20 Obtaining protein sequence from GenBank record Scroll down the record until you find the CDS section Look for the label protein_id Click the link next to this label You can obtain FASTA format for the protein just as you did for the nucleotide sequence

21 Working with non-fasta data Since most sequence tools expect FASTA format, a dirty sequence (one with extraneous characters) can pose a problem The Sequence Manipulation Suite (SMS) is a tool that can be used to clean up such a sequence SMS can be found at

22 SMS Tool categories include: Format conversion Sequence analysis and others The figure to the right is a screen capture showing the Format conversion menu

23 Data conversion with Filter DNA tool

24 Example of results

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Biological Sequence Data Formats

Biological Sequence Data Formats Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA

More information

Gene Models & Bed format: What they represent.

Gene Models & Bed format: What they represent. GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,

More information

Protein Synthesis How Genes Become Constituent Molecules

Protein Synthesis How Genes Become Constituent Molecules Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: [email protected].

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu. Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: [email protected] What is Gene Expression & Gene Regulation? 1. Gene Expression

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

RNA & Protein Synthesis

RNA & Protein Synthesis RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

Specific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons

Specific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons Tutorial II Gene expression: mrna translation and protein synthesis Piergiorgio Percipalle, PhD Program Control of gene transcription and RNA processing mrna translation and protein synthesis KAROLINSKA

More information

13.2 Ribosomes & Protein Synthesis

13.2 Ribosomes & Protein Synthesis 13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

Ms. Campbell Protein Synthesis Practice Questions Regents L.E.

Ms. Campbell Protein Synthesis Practice Questions Regents L.E. Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

A Tutorial in Genetic Sequence Classification Tools and Techniques

A Tutorial in Genetic Sequence Classification Tools and Techniques A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University [email protected] www.jakemdrew.com Sequence Characters IUPAC nucleotide

More information

Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011

Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011 Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear

More information

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want 1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

Searching Nucleotide Databases

Searching Nucleotide Databases Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames

More information

Lecture 4. Polypeptide Synthesis Overview

Lecture 4. Polypeptide Synthesis Overview Initiation of Protein Synthesis (4.1) Lecture 4 Polypeptide Synthesis Overview Polypeptide synthesis proceeds sequentially from N Terminus to C terminus. Amino acids are not pre-positioned on a template.

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized: Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How

More information

org.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers.

org.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers. org.rn.eg.db December 16, 2015 org.rn.egaccnum Map Entrez Gene identifiers to GenBank Accession Numbers org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank

More information

To be able to describe polypeptide synthesis including transcription and splicing

To be able to describe polypeptide synthesis including transcription and splicing Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Activity 7.21 Transcription factors

Activity 7.21 Transcription factors Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation

More information

Overview of Eukaryotic Gene Prediction

Overview of Eukaryotic Gene Prediction Overview of Eukaryotic Gene Prediction CBB 231 / COMPSCI 261 W.H. Majoros What is DNA? Nucleus Chromosome Telomere Centromere Cell Telomere base pairs histones DNA (double helix) DNA is a Double Helix

More information

Basic Concepts of DNA, Proteins, Genes and Genomes

Basic Concepts of DNA, Proteins, Genes and Genomes Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate

More information

Modeling DNA Replication and Protein Synthesis

Modeling DNA Replication and Protein Synthesis Skills Practice Lab Modeling DNA Replication and Protein Synthesis OBJECTIVES Construct and analyze a model of DNA. Use a model to simulate the process of replication. Use a model to simulate the process

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:

More information

SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE

SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,

More information

GenBank: A Database of Genetic Sequence Data

GenBank: A Database of Genetic Sequence Data GenBank: A Database of Genetic Sequence Data Computer Science 105 Boston University David G. Sullivan, Ph.D. An Explosion of Scientific Data Scientists are generating ever increasing amounts of data. Relevant

More information

Hidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006

Hidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006 Hidden Markov Models in Bioinformatics By Máthé Zoltán Kőrösi Zoltán 2006 Outline Markov Chain HMM (Hidden Markov Model) Hidden Markov Models in Bioinformatics Gene Finding Gene Finding Model Viterbi algorithm

More information

DNA Sequence formats

DNA Sequence formats DNA Sequence formats [Plain] [EMBL] [FASTA] [GCG] [GenBank] [IG] [IUPAC] [How Genomatix represents sequence annotation] Plain sequence format A sequence in plain format may contain only IUPAC characters

More information

Genomes and SNPs in Malaria and Sickle Cell Anemia

Genomes and SNPs in Malaria and Sickle Cell Anemia Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing

More information

Module 10: Bioinformatics

Module 10: Bioinformatics Module 10: Bioinformatics 1.) Goal: To understand the general approaches for basic in silico (computer) analysis of DNA- and protein sequences. We are going to discuss sequence formatting required prior

More information

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each

More information

Tutorial. Reference Genome Tracks. Sample to Insight. November 27, 2015

Tutorial. Reference Genome Tracks. Sample to Insight. November 27, 2015 Reference Genome Tracks November 27, 2015 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com [email protected] Reference

More information

From DNA to Protein

From DNA to Protein Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins

More information

A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques

A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques Proceedings of the 2007 WSEAS International Conference on Computer Engineering and Applications, Gold Coast, Australia, January 17-19, 2007 402 A Multiple DNA Sequence Translation Tool Incorporating Web

More information

Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS

Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS Period Date REGENTS REVIEW: PROTEIN SYNTHESIS 1. The diagram at the right represents a portion of a type of organic molecule present in the cells of organisms. What will most likely happen if there is

More information

Gene Finding CMSC 423

Gene Finding CMSC 423 Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information

Introduction to Genome Annotation

Introduction to Genome Annotation Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at

Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at Woods Hole Zebrafish Genetics and Development Bioinformatics/Genomics Lab Ian Woods Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at http://faculty.ithaca.edu/iwoods/docs/wh/

More information

Sequencing the Human Genome

Sequencing the Human Genome Revised and Updated Edvo-Kit #339 Sequencing the Human Genome 339 Experiment Objective: In this experiment, students will read DNA sequences obtained from automated DNA sequencing techniques. The data

More information

Translation. Translation: Assembly of polypeptides on a ribosome

Translation. Translation: Assembly of polypeptides on a ribosome Translation Translation: Assembly of polypeptides on a ribosome Living cells devote more energy to the synthesis of proteins than to any other aspect of metabolism. About a third of the dry mass of a cell

More information

How To Understand How Gene Expression Is Regulated

How To Understand How Gene Expression Is Regulated What makes cells different from each other? How do cells respond to information from environment? Regulation of: - Transcription - prokaryotes - eukaryotes - mrna splicing - mrna localisation and translation

More information

GENE CONSTRUCTION KIT 4

GENE CONSTRUCTION KIT 4 GENE CONSTRUCTION KIT 4 Tutorials & User Manual from Textco BioSoftware, Inc. September 2012, First Edition Gene Construction Kit 4 Manual is Copyright Textco Bio- Software, Inc. 2003-2012. All rights

More information

13.4 Gene Regulation and Expression

13.4 Gene Regulation and Expression 13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.

More information

Sample Questions for Exam 3

Sample Questions for Exam 3 Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.

More information

GENE REGULATION. Teacher Packet

GENE REGULATION. Teacher Packet AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures

More information

Biological Databases and Protein Sequence Analysis

Biological Databases and Protein Sequence Analysis Biological Databases and Protein Sequence Analysis Introduction M. Madan Babu, Center for Biotechnology, Anna University, Chennai 25, India Bioinformatics is the application of Information technology to

More information

CCR Biology - Chapter 8 Practice Test - Summer 2012

CCR Biology - Chapter 8 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 8 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Hershey and Chase know

More information

Module 1. Sequence Formats and Retrieval. Charles Steward

Module 1. Sequence Formats and Retrieval. Charles Steward The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.

More information

Integration of data management and analysis for genome research

Integration of data management and analysis for genome research Integration of data management and analysis for genome research Volker Brendel Deparment of Zoology & Genetics and Department of Statistics Iowa State University 2112 Molecular Biology Building Ames, Iowa

More information

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3 DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

Frequently Asked Questions Next Generation Sequencing

Frequently Asked Questions Next Generation Sequencing Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided

More information

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme. Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.

More information

Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.

Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells. Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]

More information

Lecture Outline. Introduction to Databases. Introduction. Data Formats Sample databases How to text search databases. Shifra Ben-Dor Irit Orr

Lecture Outline. Introduction to Databases. Introduction. Data Formats Sample databases How to text search databases. Shifra Ben-Dor Irit Orr Introduction to Databases Shifra Ben-Dor Irit Orr Lecture Outline Introduction Data and Database types Database components Data Formats Sample databases How to text search databases What units of information

More information

PRACTICE TEST QUESTIONS

PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

LESSON 4. Using Bioinformatics to Analyze Protein Sequences. Introduction. Learning Objectives. Key Concepts

LESSON 4. Using Bioinformatics to Analyze Protein Sequences. Introduction. Learning Objectives. Key Concepts 4 Using Bioinformatics to Analyze Protein Sequences Introduction In this lesson, students perform a paper exercise designed to reinforce the student understanding of the complementary nature of DNA and

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: [email protected]

PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,

More information

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed

More information

Becker Muscular Dystrophy

Becker Muscular Dystrophy Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency

More information

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination

More information

Bio 102 Practice Problems Recombinant DNA and Biotechnology

Bio 102 Practice Problems Recombinant DNA and Biotechnology Bio 102 Practice Problems Recombinant DNA and Biotechnology Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which of the following DNA sequences could be the recognition site

More information

CHAPTER 30: PROTEIN SYNTHESIS

CHAPTER 30: PROTEIN SYNTHESIS CHAPTER 30: PROTEIN SYNTHESIS (Translation) Translation: mrna protein LECTURE TOPICS Complexity, stages, rate, accuracy Amino acid activation [trna charging] trnas and translating the Genetic Code - Amino

More information

DNA and the Cell. Version 2.3. English version. ELLS European Learning Laboratory for the Life Sciences

DNA and the Cell. Version 2.3. English version. ELLS European Learning Laboratory for the Life Sciences DNA and the Cell Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Version 2.3 English version ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra Manaia and

More information

AP BIOLOGY 2009 SCORING GUIDELINES

AP BIOLOGY 2009 SCORING GUIDELINES AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following

More information

Serial Cloner 1.2. User Manual Part I -Basic functions -

Serial Cloner 1.2. User Manual Part I -Basic functions - Serial Cloner 1.2 User Manual Part I -Basic functions - I Built-In Help Window You will find in this manual the description of the different windows and functions of Serial Cloner as well as some useful

More information

Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison

Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]

More information

Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS

Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS Lab 2/Phylogenetics/September 16, 2002 1 Read: Tudge Chapter 2 PHYLOGENETICS Objective of the Lab: To understand how DNA and protein sequence information can be used to make comparisons and assess evolutionary

More information

Academic Nucleic Acids and Protein Synthesis Test

Academic Nucleic Acids and Protein Synthesis Test Academic Nucleic Acids and Protein Synthesis Test Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. Each organism has a unique combination

More information

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams. Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.

More information

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold

More information

Replication Study Guide

Replication Study Guide Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS

More information

The world of non-coding RNA. Espen Enerly

The world of non-coding RNA. Espen Enerly The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often

More information

Name: Date: Period: DNA Unit: DNA Webquest

Name: Date: Period: DNA Unit: DNA Webquest Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History http://www.dnaftb.org/dnaftb/1/concept/index.html Read the text and answer the following questions.

More information

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown 1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains

More information

Concluding lesson. Student manual. What kind of protein are you? (Basic)

Concluding lesson. Student manual. What kind of protein are you? (Basic) Concluding lesson Student manual What kind of protein are you? (Basic) Part 1 The hereditary material of an organism is stored in a coded way on the DNA. This code consists of four different nucleotides:

More information

BioBoot Camp Genetics

BioBoot Camp Genetics BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before

More information

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page

More information

1.5 page 3 DNA Replication S. Preston 1

1.5 page 3 DNA Replication S. Preston 1 AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 3 l. DNA Replication 1. Go through PowerPoint 2. Read notes p2 and then watch the animation

More information