The world of non-coding RNA. Espen Enerly

Size: px
Start display at page:

Download "The world of non-coding RNA. Espen Enerly"

Transcription

1 The world of non-coding RNA Espen Enerly

2 ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations

3 Common for all ncrna Per def.: never translated Not spurious transcripts Always/often works together with proteins RNA-RNA, RNA, RNA-DNA and RNA-Protein Different mutational pattern than CDS

4 Non coding RNA genes Gene groups (today ): rrna trna snrna snorna Long mrna like ncrna Antisense (transcribed from same locus; cis-acting) mirna Other groups tncrna (tiny non coding RNA; mirna like) strna (small temporal RNA; early grouping of mirna) Riboregulators/sRNA/saRNA (bacteria; cis- and trans-acting) acting) sirna (processed RNA and not a gene group) Introns

5 RNA processing Mattick et al. 2003

6 Well known ncrna rrna ribosomal RNA: component of the ribosome trna - transfer RNA: Guides the adding of amino acids during translation snrna Component of the splicing complex

7 Small nucleolar RNA. rrna editing via complementary binding 2 groups different secondary structure Modify differently Function: Ribosome assembly and/or function! genes identified Eukaryotes and archaebacteria 1. H/ACA snorna 2. C/D box snorna

8 Long mrna like ncrna No ORF (no coding potential) Spliced Many well known, essential genes e.g XIST, X-chromosome inactivation ~20 kb cdna Non sequence specific function Regulated by an antisense (TSIX). Number of genes? Several thousands mouse cdna cluster lack coding potential Many remains to be discovered

9 Antisense Transcribed from the same locus on the opposite strand dsrna in nucleus Effect: A. Editing of sense transcript which prevents export) B. Local silencing and heterochromatin formation Retrotransposons Repetitive elements Common among imprinted genes >8% of the human genes contain antisense transcripts e.g. Air Antisense to a cluster of imprinted genes

10 MicroRNAs Definition of mirnas ~22 nt long Processed from Dicer Hairpin precursor Phylogenetic conservation RNase III enzymes Recognize dsrna e.g. Dicer, Drosha ++ proteins Drosha Dicer Lee et al., EMBO 2002 and Nature 2003

11 MicroRNAs (2) ~ human mirna genes (most of them identified) Most famous: Lin-4 and Let-7 Developmental regulators in C. elegans Target unknown in most situations Ambros, Cell 2001

12 RNA interference (RNAi) and small interfering RNA (sirna) RNA interference Mechanism/process/ method Degrades long double stranded RNA Dicer Used to generate KO Introduce long dsrna or sirna (~22 nt) Dicer Long dsrna sirna mirnp-risc McManus and Sharp, 2002 Target cleavage

13 RNA interference (RNAi) and small interfering RNA (sirna) RNA interference Mechanism/process method Degrades long double stranded RNA Dicer Used to generate KO Introduce long dsrna or sirna (~22 nt) Target recognition Plant/animal disparity PremiRNA Dicer Long dsrna sirna and mirna mirnp-risc Translational repression McManus and Sharp, 2002 Target cleavage

14 RNA interference (RNAi) and small interfering RNA (sirna) Secondary sirnas and Transitive RNAi RdRP (RNA dependent RNA Polymerase) Amplification Found in Neurospora, C. elegans, and Arabidopsis Not in Drosophila and human Random degradative PCR- model Therapeutic possibilities Delivery, delivery, delivery Specificity (!) Systemic response (spreading) Plants, C. elegans Design of sirna In silico prediction sirna cocktail Secondary sirnas, generated from the dsrna extended (orange) upstream of the primary target region (blue) by RdRP, promote transitive RNAi against their sequence homologous gene family members (A) or alternatively spliced mrnas (B). Nishikura, 2001

15 mirna examples Altered mirna metabolism = pleiotropic developmental defects Leaf morphogenesis in plants JAW locus encode a mirna Cleave TCP4 mrna and regulate the level of this transcript Bantam i Drosophila Mir-23 in human Scarecrow i Arabidopsis Hot topics Target identification Regulation of mirna Pre-miRNA Mature mirna mrna Wild type Mutant

16 Localization and organization? Localization Intergenic regions (Between protein coding genes) Intronic e.g. mirna, long ncrna, e.g. snorna,, mirna(!) Organization Individual e.g. long ncrna, mirna and snorna Polycistronic e.g. rrna, mirna, and snorna

17 Summary of the groups Gene groups (today ): snorna Long mrna like ncrna Antisense (transcribed from same locus; cis-acting) mirna Other groups tncrna (tiny non coding RNA; mirna like) strna (small temporal RNA; early grouping of mirna) Riboregulators/sRNA/saRNA (bacteria; cis- and trans-acting) acting) sirna (processed RNA from mirna, exogenous dsrna,, viral dsrna or antisense) Introns

18 Processes which involves ncrnas Protein synthesis (rrna/trna/snorna snorna) Splicing and alternative splicing (snrna/snorna( snrna/snorna/+) /+) Translational regulation (mirna) mrna stability (mirna/sirna) Virus protection Suggested to be the evolutionary origin of RNAi mrna export (antisense) Chromatin modification (antisense/sirna) Transposon control Genomic imprinting X-chromosome inactivation DNA methylation ++

19 Non-coding RNAs: The architects of eukaryotic complexity (John Mattick) The traditional view most genes encode proteins and these are sufficient in themselves to specify and organize the autopoietic programming of complex biological entities The new view (Mattick s( view) 1) A second tier of genetic output and a network of parallel RNA- mediated interactions has evolved in multi-cellular eukaryotes 2) Expansion of ncrna in higher organisms suggests that evolution of complexity may not only have been dependent on more proteins and protein isoforms 3) Alteration in the RNA control architecture is responsible for much of the phenotypic alteration between individuals and species 4) Much of this is hidden in the introns

20 Introns as ncrna 95 % of pre-mrnas are introns Traditional view: Rapidly degraded, only minor regulatory functions Some introns contain ncrnas (snorna, mirna) Some are stabile and exported to cytoplasm Conserved elements (5'-introns)

21 Why is it discovered first now? RNA isolation disfavor ncrnas Poly-A A extraction Small RNA discarded Gene identification programs are specialized for protein coding genes RNA interference (1998) Tool to generate knockouts Gene therapy

22 Q & A

23 Bioinformatics In silico ncrna gene identification In silico target identification Implication for network construction Many genes have dual output RNAs as a hidden layer of regulation Increasing interest for RNA structure prediction ++

24 Antisense Air

Outline. interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work?

Outline. interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work? Outline Outline interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work? What is RNA interference? Recently discovered regulatory level. Genome immune system.

More information

Micro RNAs: potentielle Biomarker für das. Blutspenderscreening

Micro RNAs: potentielle Biomarker für das. Blutspenderscreening Micro RNAs: potentielle Biomarker für das Blutspenderscreening micrornas - Background Types of RNA -Coding: messenger RNA (mrna) -Non-coding (examples): Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear

More information

Functional and Biomedical Aspects of Genome Research

Functional and Biomedical Aspects of Genome Research Functional and Biomedical Aspects of Genome Research 20 11 35 Vorlesung SS 04 Bartsch, Jockusch & Schmitt-John Mi. 9:15-10:00, in W7-135 13 Functional RNAs Thomas Schmitt-John micro RNAs small interfering

More information

RNAi Shooting the Messenger!

RNAi Shooting the Messenger! RNAi Shooting the Messenger! Bronya Keats, Ph.D. Department of Genetics Louisiana State University Health Sciences Center New Orleans Email: bkeats@lsuhsc.edu RNA interference (RNAi) A mechanism by which

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

Functional RNAs; RNA catalysts, mirna,

Functional RNAs; RNA catalysts, mirna, Functional RNAs; RNA catalysts, mirna, srna, RNAi... RNAs have many functions rrna (ribosomal RNA) trna (transfer RNA) mrna (Messenger RNA) snrna (including snorna) ) (Small nuclear RNA- splicing) Other

More information

Protein Synthesis How Genes Become Constituent Molecules

Protein Synthesis How Genes Become Constituent Molecules Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Five-year relative survival rates. Cancer. Age-adjusted cancer death rates. Proteomic Technologies for Cancer Biomarker Discovery 2010/3/22

Five-year relative survival rates. Cancer. Age-adjusted cancer death rates. Proteomic Technologies for Cancer Biomarker Discovery 2010/3/22 Cancer Five-year relative survival rates Basal lamina Underlyig tissue Normal tissue Carcinoma Invasive carcinoma 1 http://www.cancer.org/docroot/home/index.asp 2 Proteomic Technologies for Cancer Biomarker

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

V22: involvement of micrornas in GRNs

V22: involvement of micrornas in GRNs What are micrornas? V22: involvement of micrornas in GRNs How can one identify micrornas? What is the function of micrornas? Elisa Izaurralde, MPI Tübingen Huntzinger, Izaurralde, Nat. Rev. Genet. 12,

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

Gene Models & Bed format: What they represent.

Gene Models & Bed format: What they represent. GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,

More information

13.4 Gene Regulation and Expression

13.4 Gene Regulation and Expression 13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

2013 W. H. Freeman and Company. 26 RNA Metabolism

2013 W. H. Freeman and Company. 26 RNA Metabolism 2013 W. H. Freeman and Company 26 RNA Metabolism CHAPTER 26 RNA Metabolism Key topics: Transcription: DNA-dependent synthesis of RNA Capping and splicing: RNA processing Overview of RNA Function Ribonucleic

More information

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu. Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.au What is Gene Expression & Gene Regulation? 1. Gene Expression

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression (Learning Objectives) Explain the role of gene expression is differentiation of function of cells which leads to the emergence of different tissues, organs, and organ systems

More information

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed

More information

AP BIOLOGY 2009 SCORING GUIDELINES

AP BIOLOGY 2009 SCORING GUIDELINES AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following

More information

Post-transcriptional control of gene expression

Post-transcriptional control of gene expression Post-transcriptional control of gene expression Possible post-transcriptional controls on gene expression Only a few of these controls are likely to be important for any one gene Mecanismo de processamento

More information

Lezioni Dipartimento di Oncologia Farmacologia Molecolare. RNA interference. Giovanna Damia 29 maggio 2006

Lezioni Dipartimento di Oncologia Farmacologia Molecolare. RNA interference. Giovanna Damia 29 maggio 2006 Lezioni Dipartimento di Oncologia Farmacologia Molecolare RNA interference Giovanna Damia 29 maggio 2006 RNA INTERFERENCE Sequence-specific gene suppression by dsrnas Gene silencing by dsrna: C. elegans

More information

Outline. MicroRNA Bioinformatics. microrna biogenesis. short non-coding RNAs not considered in this lecture. ! Introduction

Outline. MicroRNA Bioinformatics. microrna biogenesis. short non-coding RNAs not considered in this lecture. ! Introduction Outline MicroRNA Bioinformatics Rickard Sandberg Dept. of Cell and Molecular Biology (CMB) Karolinska Institutet! Introduction! microrna target site prediction! Useful resources 2 short non-coding RNAs

More information

mirnaselect pep-mir Cloning and Expression Vector

mirnaselect pep-mir Cloning and Expression Vector Product Data Sheet mirnaselect pep-mir Cloning and Expression Vector CATALOG NUMBER: MIR-EXP-C STORAGE: -80ºC QUANTITY: 2 vectors; each contains 100 µl of bacterial glycerol stock Components 1. mirnaselect

More information

Control of Gene Expression

Control of Gene Expression Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

Biogenesis, Size and Function of Small RNAs

Biogenesis, Size and Function of Small RNAs srnas of Plants Small, Non-coding RNAs of Plants Regulatory RNAs that act through gene silencing Two classes of small RNAs (srnas) o microrna (mirnas) Encoded by genes in the genome o small interfering

More information

Basic Principles of Transcription and Translation

Basic Principles of Transcription and Translation The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific traits by dictating the synthesis of

More information

Dicer Substrate RNAi Design

Dicer Substrate RNAi Design INTEGRATED DNA TECHNOLOGIES, INC. Dicer Substrate RNAi Design How to design and order 27-mer Dicer-substrate Duplex RNAs for use as RNA interference reagents The following document provides a summary of

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure

More information

Complex multicellular organisms are produced by cells that switch genes on and off during development.

Complex multicellular organisms are produced by cells that switch genes on and off during development. Home Control of Gene Expression Gene Regulation Is Necessary? By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring

More information

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional

More information

Profiling of non-coding RNA classes Gunter Meister

Profiling of non-coding RNA classes Gunter Meister Profiling of non-coding RNA classes Gunter Meister RNA Biology Regensburg University Universitätsstrasse 31 93053 Regensburg Overview Classes of non-coding RNAs Profiling strategies Validation Protein-RNA

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

GENE REGULATION. Teacher Packet

GENE REGULATION. Teacher Packet AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures

More information

Yang-Ming University, 2009 microrna Biology and Application

Yang-Ming University, 2009 microrna Biology and Application Yang-Ming University, 2009 microrna Biology and Application 3/03 microrna biogenesis and functions Woan-Yuh Tarn 3/10 micrornas and development Woan- Yuh Tarn 3/17 micrornas and nervous system Jeng-Ya

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams. Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.

More information

CHAPTER 40 The Mechanism of Protein Synthesis

CHAPTER 40 The Mechanism of Protein Synthesis CHAPTER 40 The Mechanism of Protein Synthesis Problems: 2,3,6,7,9,13,14,15,18,19,20 Initiation: Locating the start codon. Elongation: Reading the codons (5 3 ) and synthesizing protein amino carboxyl.

More information

Chapter 18 Regulation of Gene Expression

Chapter 18 Regulation of Gene Expression Chapter 18 Regulation of Gene Expression 18.1. Gene Regulation Is Necessary By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation

OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation -Optimal strategies to a successful mirna research project Optimal strategies to a successful mirna research

More information

13.2 Ribosomes & Protein Synthesis

13.2 Ribosomes & Protein Synthesis 13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).

More information

THE ENZYMES. Department of Microbiology, Immunology, and Molecular Genetics, Molecular Biology Institute University of California

THE ENZYMES. Department of Microbiology, Immunology, and Molecular Genetics, Molecular Biology Institute University of California VOLUME THIRTY TWO THE ENZYMES Eukaryotic RNases and their Partners in RNA Degradation and Biogenesis, Part B Edited by FENG GUO Department of Biological Chemistry, David Geffen School of Medicine, Molecular

More information

How To Understand How Gene Expression Is Regulated

How To Understand How Gene Expression Is Regulated What makes cells different from each other? How do cells respond to information from environment? Regulation of: - Transcription - prokaryotes - eukaryotes - mrna splicing - mrna localisation and translation

More information

RNA: Transcription and Processing

RNA: Transcription and Processing 8 RNA: Transcription and Processing WORKING WITH THE FIGURES 1. In Figure 8-3, why are the arrows for genes 1 and 2 pointing in opposite directions? The arrows for genes 1 and 2 indicate the direction

More information

RNA & Protein Synthesis

RNA & Protein Synthesis RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis

More information

To be able to describe polypeptide synthesis including transcription and splicing

To be able to describe polypeptide synthesis including transcription and splicing Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain

More information

Recombinant DNA and Biotechnology

Recombinant DNA and Biotechnology Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

RNA Structure and folding

RNA Structure and folding RNA Structure and folding Overview: The main functional biomolecules in cells are polymers DNA, RNA and proteins For RNA and Proteins, the specific sequence of the polymer dictates its final structure

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

The microrna world: small is mighty

The microrna world: small is mighty 534 The microrna world: small is mighty Peter Nelson 1, Marianthi Kiriakidou 1,2, Anup Sharma 1, Elsa Maniataki 1 and Zissimos Mourelatos 1 1 Department of Pathology, University of Pennsylvania School

More information

micrornas Contents Introduction

micrornas Contents Introduction micrornas Contents Introduction... 1 Structure and Function of mirnas... 2 Plant mirnas... 4 mirna Biosynthesis... 5 Evolution of mirnas... 6 Conclusions... 9 References and Resources... 9 Introduction

More information

Activity 7.21 Transcription factors

Activity 7.21 Transcription factors Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation

More information

岑 祥 股 份 有 限 公 司 技 術 專 員 費 軫 尹 20100803

岑 祥 股 份 有 限 公 司 技 術 專 員 費 軫 尹 20100803 技 術 專 員 費 軫 尹 20100803 Overview of presentation Basic Biology of RNA interference Application of sirna for gene function? How to study mirna? How to deliver sirna and mirna? New prospects on RNAi research

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

Basic Concepts of DNA, Proteins, Genes and Genomes

Basic Concepts of DNA, Proteins, Genes and Genomes Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate

More information

Mir-X mirna First-Strand Synthesis Kit User Manual

Mir-X mirna First-Strand Synthesis Kit User Manual User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.

More information

Non-coding RNA. John S. Mattick* and Igor V. Makunin INTRODUCTION. EXPANSION OF ncrnas AND RNA METABOLISM IN EUKARYOTES

Non-coding RNA. John S. Mattick* and Igor V. Makunin INTRODUCTION. EXPANSION OF ncrnas AND RNA METABOLISM IN EUKARYOTES doi:10.1093/hmg/ddl046 R17 R29 Non-coding RNA John S. Mattick* and Igor V. Makunin Australian Research Council Centre for Functional and Applied Genomics, Institute for Molecular Bioscience, University

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

MicroRNA formation. 4th International Symposium on Non-Surgical Contraceptive Methods of Pet Population Control

MicroRNA formation. 4th International Symposium on Non-Surgical Contraceptive Methods of Pet Population Control MicroRNA formation mirna s are processed from several precursor stages Mammalian genomes seem to have 100 s of mirna s Nucleotides in positions 2-8 of an mirna are considered the mirna seed 5 Methyl-G

More information

Introduction to Genome Annotation

Introduction to Genome Annotation Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT

More information

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh

More information

Plant RNAi mechanisms: lessons from silent transgenes. Institut Jean-Pierre Bourgin, INRA Versailles

Plant RNAi mechanisms: lessons from silent transgenes. Institut Jean-Pierre Bourgin, INRA Versailles Plant RNAi mechanisms: lessons from silent transgenes Institut Jean-Pierre Bourgin, INRA Versailles Plants encode two types of small RNAs: mirna and sirna MIR genes endoir NAT pairs TAS and PolIV loci

More information

Dr Alessandro Fatica (on behalf of Prof. Irene Bozzoni)

Dr Alessandro Fatica (on behalf of Prof. Irene Bozzoni) Dr Alessandro Fatica (on behalf of Prof. Irene Bozzoni) non coding RNAs in human diseases ROUND TABLE ITALY RUSSIA Dubna, 19-23 December 2010 alessandro.fatica@uniroma1.it Where is the information that

More information

AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET

AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET NAME: AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET 1. Griffith's experiments showing the transformation of R strain pneumococcus bacteria to S strain pneumococcus bacteria in the presence of

More information

-UFRJ. Rio de Janeiro. Brazil, 2. -Fasteris Co., Plan-les-Ouates. Switzerland, 3. -West Virginia University. Morgantown.

-UFRJ. Rio de Janeiro. Brazil, 2. -Fasteris Co., Plan-les-Ouates. Switzerland, 3. -West Virginia University. Morgantown. GLOBAL ALTERATION OF MICRORNAS AND TRANSPOSON-DERIVED SMALL RNAS IN COTTON (GOSSYPIUM HIRSUTUM) DURING COTTON LEAFROLL DWARF POLEROVIRUS (CLRDV) INFECTION Elisson Romanel 1, Tatiane da Franca Silva 1,

More information

Sickle cell anemia: Altered beta chain Single AA change (#6 Glu to Val) Consequence: Protein polymerizes Change in RBC shape ---> phenotypes

Sickle cell anemia: Altered beta chain Single AA change (#6 Glu to Val) Consequence: Protein polymerizes Change in RBC shape ---> phenotypes Protein Structure Polypeptide: Protein: Therefore: Example: Single chain of amino acids 1 or more polypeptide chains All polypeptides are proteins Some proteins contain >1 polypeptide Hemoglobin (O 2 binding

More information

Immunologie für Studierende der Biologie & Molekularmedizin. mirna und Immunität. Jürgen Wittmann (jwittman@molmed.uni-erlangen.

Immunologie für Studierende der Biologie & Molekularmedizin. mirna und Immunität. Jürgen Wittmann (jwittman@molmed.uni-erlangen. Immunologie für Studierende der Biologie & Molekularmedizin Konzepte der Immunologie Erlangen SS 2008 mirna und Immunität Jürgen Wittmann (jwittman@molmed.uni-erlangen.de) Division of Molecular Immunology

More information

Analytical Study of Hexapod mirnas using Phylogenetic Methods

Analytical Study of Hexapod mirnas using Phylogenetic Methods Analytical Study of Hexapod mirnas using Phylogenetic Methods A.K. Mishra and H.Chandrasekharan Unit of Simulation & Informatics, Indian Agricultural Research Institute, New Delhi, India akmishra@iari.res.in,

More information

mrna EDITING Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005

mrna EDITING Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005 mrna EDITING mrna EDITING http://dbb.urmc.rochester.edu/labs/smith/research_2.htm The number of A to I sites in the human transcriptome >15;000 the vast majority of these sites occurring in Alu repeats

More information

Sample Questions for Exam 3

Sample Questions for Exam 3 Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS

More information

7. 2. Regulation of gene expression. Unit 7: Molecular biology and genetics

7. 2. Regulation of gene expression. Unit 7: Molecular biology and genetics 7. 2 Regulation of gene expression We all start off as one stem cell (a fertilised ovum) that divides to give a ball of cells. These cells then differentiate and become specialised to carry out specific

More information

Biological Sciences Initiative. Human Genome

Biological Sciences Initiative. Human Genome Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.

More information

RNAi History, Mechanism and Application

RNAi History, Mechanism and Application DRUG DISCOVERY AND DEVELOPMENT RNAi History, Mechanism and Application Shuo Gu The History of RNAi About the author: Dr. Shuo Gu is currently a Postdoctoral Scholar at Stanford University, School of Medicine.

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

trna Processing and Modification

trna Processing and Modification trna Processing and Modification RNA POL III - TRANSCRIPTS 5S RNA, trna, repetitive Sequenzen (Alu-typ), versch. kleine stabile RNAs (7SL - RNA vom signal recognition particle (SRP)), U6 RNA 5S RNA nicht

More information

Translation. Translation: Assembly of polypeptides on a ribosome

Translation. Translation: Assembly of polypeptides on a ribosome Translation Translation: Assembly of polypeptides on a ribosome Living cells devote more energy to the synthesis of proteins than to any other aspect of metabolism. About a third of the dry mass of a cell

More information

Lecture 6. Regulation of Protein Synthesis at the Translational Level

Lecture 6. Regulation of Protein Synthesis at the Translational Level Regulation of Protein Synthesis (6.1) Lecture 6 Regulation of Protein Synthesis at the Translational Level Comparison of EF-Tu-GDP and EF-Tu-GTP conformations EF-Tu-GDP EF-Tu-GTP Next: Comparison of GDP

More information

Biochimie. Small RNAs derived from longer non-coding RNAs. Susanne Röther *, Gunter Meister. Review. abstract

Biochimie. Small RNAs derived from longer non-coding RNAs. Susanne Röther *, Gunter Meister. Review. abstract Biochimie 93 (2011) 1905e1915 Contents lists available at ScienceDirect Biochimie journal homepage: www.elsevier.com/locate/biochi Review Small RNAs derived from longer non-coding RNAs Susanne Röther *,

More information

Comprehensive mirna Research Technologies

Comprehensive mirna Research Technologies Comprehensive mirna Research Technologies Sample & Assay Technologies QIAGEN solutions for advancing microrna research In the last few years, the identification of microrna (mirna) and the recognition

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

CCR Biology - Chapter 8 Practice Test - Summer 2012

CCR Biology - Chapter 8 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 8 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Hershey and Chase know

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

Question 4 /29 points. Total /100 points

Question 4 /29 points. Total /100 points MIT Department of Biology 7.28, Spring 2005 - Molecular Biology 7.28 Spring 2005 Exam Three Question 1 Question 2 Question 3 /30 points /20 points /21 points Question 4 /29 points Total /100 points 1 Question

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information

DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH)

DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH) DNA, RNA, replication, translation, and transcription Overview Recall the central dogma of biology: DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) DNA structure

More information

Expression analysis of Drosophila melanogaster micrornas

Expression analysis of Drosophila melanogaster micrornas Expression analysis of Drosophila melanogaster micrornas Dissertation zur Erlangung des Doktorgrades der Mathematisch-Naturwissenschaftlichen Fakultäten der Georg-August-Universität zu Göttingen vorgelegt

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.

Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells. Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,

More information

Functional characterisation of microrna-containing Argonaute protein complexes

Functional characterisation of microrna-containing Argonaute protein complexes Dissertation zur Erlangung des Doktorgrades der Fakultät für Biologie der Ludwig-Maximilians-Universität München Functional characterisation of microrna-containing Argonaute protein complexes vorgelegt

More information

Non-Coding RNAs: Multi-Tasking Molecules in the Cell

Non-Coding RNAs: Multi-Tasking Molecules in the Cell Int. J. Mol. Sci. 2013, 14, 16010-16039; doi:10.3390/ijms140816010 Review OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Non-Coding RNAs: Multi-Tasking

More information

Comparative epigenomic analysis between model plant and crop

Comparative epigenomic analysis between model plant and crop The 19 th Crucifer Genetics Workshop and Brassica 2014 Genetic Improvement of Brassicaceae Crops in the Era of Genomics Comparative epigenomic analysis between model plant and crop Xiaofeng Cao Institute

More information

European Medicines Agency

European Medicines Agency European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein

More information

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3 DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can

More information

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,

More information