The world of non-coding RNA. Espen Enerly
|
|
- Lucas Porter
- 8 years ago
- Views:
Transcription
1 The world of non-coding RNA Espen Enerly
2 ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations
3 Common for all ncrna Per def.: never translated Not spurious transcripts Always/often works together with proteins RNA-RNA, RNA, RNA-DNA and RNA-Protein Different mutational pattern than CDS
4 Non coding RNA genes Gene groups (today ): rrna trna snrna snorna Long mrna like ncrna Antisense (transcribed from same locus; cis-acting) mirna Other groups tncrna (tiny non coding RNA; mirna like) strna (small temporal RNA; early grouping of mirna) Riboregulators/sRNA/saRNA (bacteria; cis- and trans-acting) acting) sirna (processed RNA and not a gene group) Introns
5 RNA processing Mattick et al. 2003
6 Well known ncrna rrna ribosomal RNA: component of the ribosome trna - transfer RNA: Guides the adding of amino acids during translation snrna Component of the splicing complex
7 Small nucleolar RNA. rrna editing via complementary binding 2 groups different secondary structure Modify differently Function: Ribosome assembly and/or function! genes identified Eukaryotes and archaebacteria 1. H/ACA snorna 2. C/D box snorna
8 Long mrna like ncrna No ORF (no coding potential) Spliced Many well known, essential genes e.g XIST, X-chromosome inactivation ~20 kb cdna Non sequence specific function Regulated by an antisense (TSIX). Number of genes? Several thousands mouse cdna cluster lack coding potential Many remains to be discovered
9 Antisense Transcribed from the same locus on the opposite strand dsrna in nucleus Effect: A. Editing of sense transcript which prevents export) B. Local silencing and heterochromatin formation Retrotransposons Repetitive elements Common among imprinted genes >8% of the human genes contain antisense transcripts e.g. Air Antisense to a cluster of imprinted genes
10 MicroRNAs Definition of mirnas ~22 nt long Processed from Dicer Hairpin precursor Phylogenetic conservation RNase III enzymes Recognize dsrna e.g. Dicer, Drosha ++ proteins Drosha Dicer Lee et al., EMBO 2002 and Nature 2003
11 MicroRNAs (2) ~ human mirna genes (most of them identified) Most famous: Lin-4 and Let-7 Developmental regulators in C. elegans Target unknown in most situations Ambros, Cell 2001
12 RNA interference (RNAi) and small interfering RNA (sirna) RNA interference Mechanism/process/ method Degrades long double stranded RNA Dicer Used to generate KO Introduce long dsrna or sirna (~22 nt) Dicer Long dsrna sirna mirnp-risc McManus and Sharp, 2002 Target cleavage
13 RNA interference (RNAi) and small interfering RNA (sirna) RNA interference Mechanism/process method Degrades long double stranded RNA Dicer Used to generate KO Introduce long dsrna or sirna (~22 nt) Target recognition Plant/animal disparity PremiRNA Dicer Long dsrna sirna and mirna mirnp-risc Translational repression McManus and Sharp, 2002 Target cleavage
14 RNA interference (RNAi) and small interfering RNA (sirna) Secondary sirnas and Transitive RNAi RdRP (RNA dependent RNA Polymerase) Amplification Found in Neurospora, C. elegans, and Arabidopsis Not in Drosophila and human Random degradative PCR- model Therapeutic possibilities Delivery, delivery, delivery Specificity (!) Systemic response (spreading) Plants, C. elegans Design of sirna In silico prediction sirna cocktail Secondary sirnas, generated from the dsrna extended (orange) upstream of the primary target region (blue) by RdRP, promote transitive RNAi against their sequence homologous gene family members (A) or alternatively spliced mrnas (B). Nishikura, 2001
15 mirna examples Altered mirna metabolism = pleiotropic developmental defects Leaf morphogenesis in plants JAW locus encode a mirna Cleave TCP4 mrna and regulate the level of this transcript Bantam i Drosophila Mir-23 in human Scarecrow i Arabidopsis Hot topics Target identification Regulation of mirna Pre-miRNA Mature mirna mrna Wild type Mutant
16 Localization and organization? Localization Intergenic regions (Between protein coding genes) Intronic e.g. mirna, long ncrna, e.g. snorna,, mirna(!) Organization Individual e.g. long ncrna, mirna and snorna Polycistronic e.g. rrna, mirna, and snorna
17 Summary of the groups Gene groups (today ): snorna Long mrna like ncrna Antisense (transcribed from same locus; cis-acting) mirna Other groups tncrna (tiny non coding RNA; mirna like) strna (small temporal RNA; early grouping of mirna) Riboregulators/sRNA/saRNA (bacteria; cis- and trans-acting) acting) sirna (processed RNA from mirna, exogenous dsrna,, viral dsrna or antisense) Introns
18 Processes which involves ncrnas Protein synthesis (rrna/trna/snorna snorna) Splicing and alternative splicing (snrna/snorna( snrna/snorna/+) /+) Translational regulation (mirna) mrna stability (mirna/sirna) Virus protection Suggested to be the evolutionary origin of RNAi mrna export (antisense) Chromatin modification (antisense/sirna) Transposon control Genomic imprinting X-chromosome inactivation DNA methylation ++
19 Non-coding RNAs: The architects of eukaryotic complexity (John Mattick) The traditional view most genes encode proteins and these are sufficient in themselves to specify and organize the autopoietic programming of complex biological entities The new view (Mattick s( view) 1) A second tier of genetic output and a network of parallel RNA- mediated interactions has evolved in multi-cellular eukaryotes 2) Expansion of ncrna in higher organisms suggests that evolution of complexity may not only have been dependent on more proteins and protein isoforms 3) Alteration in the RNA control architecture is responsible for much of the phenotypic alteration between individuals and species 4) Much of this is hidden in the introns
20 Introns as ncrna 95 % of pre-mrnas are introns Traditional view: Rapidly degraded, only minor regulatory functions Some introns contain ncrnas (snorna, mirna) Some are stabile and exported to cytoplasm Conserved elements (5'-introns)
21 Why is it discovered first now? RNA isolation disfavor ncrnas Poly-A A extraction Small RNA discarded Gene identification programs are specialized for protein coding genes RNA interference (1998) Tool to generate knockouts Gene therapy
22 Q & A
23 Bioinformatics In silico ncrna gene identification In silico target identification Implication for network construction Many genes have dual output RNAs as a hidden layer of regulation Increasing interest for RNA structure prediction ++
24 Antisense Air
Outline. interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work?
Outline Outline interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work? What is RNA interference? Recently discovered regulatory level. Genome immune system.
More informationMicro RNAs: potentielle Biomarker für das. Blutspenderscreening
Micro RNAs: potentielle Biomarker für das Blutspenderscreening micrornas - Background Types of RNA -Coding: messenger RNA (mrna) -Non-coding (examples): Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear
More informationFunctional and Biomedical Aspects of Genome Research
Functional and Biomedical Aspects of Genome Research 20 11 35 Vorlesung SS 04 Bartsch, Jockusch & Schmitt-John Mi. 9:15-10:00, in W7-135 13 Functional RNAs Thomas Schmitt-John micro RNAs small interfering
More informationRNAi Shooting the Messenger!
RNAi Shooting the Messenger! Bronya Keats, Ph.D. Department of Genetics Louisiana State University Health Sciences Center New Orleans Email: bkeats@lsuhsc.edu RNA interference (RNAi) A mechanism by which
More informationName Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
More informationFunctional RNAs; RNA catalysts, mirna,
Functional RNAs; RNA catalysts, mirna, srna, RNAi... RNAs have many functions rrna (ribosomal RNA) trna (transfer RNA) mrna (Messenger RNA) snrna (including snorna) ) (Small nuclear RNA- splicing) Other
More informationProtein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
More informationGenetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
More informationFive-year relative survival rates. Cancer. Age-adjusted cancer death rates. Proteomic Technologies for Cancer Biomarker Discovery 2010/3/22
Cancer Five-year relative survival rates Basal lamina Underlyig tissue Normal tissue Carcinoma Invasive carcinoma 1 http://www.cancer.org/docroot/home/index.asp 2 Proteomic Technologies for Cancer Biomarker
More informationTranscription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
More informationV22: involvement of micrornas in GRNs
What are micrornas? V22: involvement of micrornas in GRNs How can one identify micrornas? What is the function of micrornas? Elisa Izaurralde, MPI Tübingen Huntzinger, Izaurralde, Nat. Rev. Genet. 12,
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
More informationGene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
More information13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
More informationFrom DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
More information2013 W. H. Freeman and Company. 26 RNA Metabolism
2013 W. H. Freeman and Company 26 RNA Metabolism CHAPTER 26 RNA Metabolism Key topics: Transcription: DNA-dependent synthesis of RNA Capping and splicing: RNA processing Overview of RNA Function Ribonucleic
More informationLecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.au What is Gene Expression & Gene Regulation? 1. Gene Expression
More informationControl of Gene Expression
Control of Gene Expression (Learning Objectives) Explain the role of gene expression is differentiation of function of cells which leads to the emergence of different tissues, organs, and organ systems
More informationLecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
More informationAP BIOLOGY 2009 SCORING GUIDELINES
AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following
More informationPost-transcriptional control of gene expression
Post-transcriptional control of gene expression Possible post-transcriptional controls on gene expression Only a few of these controls are likely to be important for any one gene Mecanismo de processamento
More informationLezioni Dipartimento di Oncologia Farmacologia Molecolare. RNA interference. Giovanna Damia 29 maggio 2006
Lezioni Dipartimento di Oncologia Farmacologia Molecolare RNA interference Giovanna Damia 29 maggio 2006 RNA INTERFERENCE Sequence-specific gene suppression by dsrnas Gene silencing by dsrna: C. elegans
More informationOutline. MicroRNA Bioinformatics. microrna biogenesis. short non-coding RNAs not considered in this lecture. ! Introduction
Outline MicroRNA Bioinformatics Rickard Sandberg Dept. of Cell and Molecular Biology (CMB) Karolinska Institutet! Introduction! microrna target site prediction! Useful resources 2 short non-coding RNAs
More informationmirnaselect pep-mir Cloning and Expression Vector
Product Data Sheet mirnaselect pep-mir Cloning and Expression Vector CATALOG NUMBER: MIR-EXP-C STORAGE: -80ºC QUANTITY: 2 vectors; each contains 100 µl of bacterial glycerol stock Components 1. mirnaselect
More informationControl of Gene Expression
Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
More informationDNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
More informationBiogenesis, Size and Function of Small RNAs
srnas of Plants Small, Non-coding RNAs of Plants Regulatory RNAs that act through gene silencing Two classes of small RNAs (srnas) o microrna (mirnas) Encoded by genes in the genome o small interfering
More informationBasic Principles of Transcription and Translation
The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific traits by dictating the synthesis of
More informationDicer Substrate RNAi Design
INTEGRATED DNA TECHNOLOGIES, INC. Dicer Substrate RNAi Design How to design and order 27-mer Dicer-substrate Duplex RNAs for use as RNA interference reagents The following document provides a summary of
More informationControl of Gene Expression
Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure
More informationComplex multicellular organisms are produced by cells that switch genes on and off during development.
Home Control of Gene Expression Gene Regulation Is Necessary? By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
More informationCentral Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription
Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional
More informationProfiling of non-coding RNA classes Gunter Meister
Profiling of non-coding RNA classes Gunter Meister RNA Biology Regensburg University Universitätsstrasse 31 93053 Regensburg Overview Classes of non-coding RNAs Profiling strategies Validation Protein-RNA
More informationStructure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
More informationGENE REGULATION. Teacher Packet
AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures
More informationYang-Ming University, 2009 microrna Biology and Application
Yang-Ming University, 2009 microrna Biology and Application 3/03 microrna biogenesis and functions Woan-Yuh Tarn 3/10 micrornas and development Woan- Yuh Tarn 3/17 micrornas and nervous system Jeng-Ya
More informationTranslation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
More informationModule 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.
Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.
More informationCHAPTER 40 The Mechanism of Protein Synthesis
CHAPTER 40 The Mechanism of Protein Synthesis Problems: 2,3,6,7,9,13,14,15,18,19,20 Initiation: Locating the start codon. Elongation: Reading the codons (5 3 ) and synthesizing protein amino carboxyl.
More informationChapter 18 Regulation of Gene Expression
Chapter 18 Regulation of Gene Expression 18.1. Gene Regulation Is Necessary By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection
More informationMolecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
More informationOriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation
OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation -Optimal strategies to a successful mirna research project Optimal strategies to a successful mirna research
More information13.2 Ribosomes & Protein Synthesis
13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).
More informationTHE ENZYMES. Department of Microbiology, Immunology, and Molecular Genetics, Molecular Biology Institute University of California
VOLUME THIRTY TWO THE ENZYMES Eukaryotic RNases and their Partners in RNA Degradation and Biogenesis, Part B Edited by FENG GUO Department of Biological Chemistry, David Geffen School of Medicine, Molecular
More informationHow To Understand How Gene Expression Is Regulated
What makes cells different from each other? How do cells respond to information from environment? Regulation of: - Transcription - prokaryotes - eukaryotes - mrna splicing - mrna localisation and translation
More informationRNA: Transcription and Processing
8 RNA: Transcription and Processing WORKING WITH THE FIGURES 1. In Figure 8-3, why are the arrows for genes 1 and 2 pointing in opposite directions? The arrows for genes 1 and 2 indicate the direction
More informationRNA & Protein Synthesis
RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis
More informationTo be able to describe polypeptide synthesis including transcription and splicing
Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain
More informationRecombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
More informationThe Steps. 1. Transcription. 2. Transferal. 3. Translation
Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order
More informationRNA Structure and folding
RNA Structure and folding Overview: The main functional biomolecules in cells are polymers DNA, RNA and proteins For RNA and Proteins, the specific sequence of the polymer dictates its final structure
More informationCCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
More informationa. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled
Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino
More informationThe microrna world: small is mighty
534 The microrna world: small is mighty Peter Nelson 1, Marianthi Kiriakidou 1,2, Anup Sharma 1, Elsa Maniataki 1 and Zissimos Mourelatos 1 1 Department of Pathology, University of Pennsylvania School
More informationmicrornas Contents Introduction
micrornas Contents Introduction... 1 Structure and Function of mirnas... 2 Plant mirnas... 4 mirna Biosynthesis... 5 Evolution of mirnas... 6 Conclusions... 9 References and Resources... 9 Introduction
More informationActivity 7.21 Transcription factors
Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation
More information岑 祥 股 份 有 限 公 司 技 術 專 員 費 軫 尹 20100803
技 術 專 員 費 軫 尹 20100803 Overview of presentation Basic Biology of RNA interference Application of sirna for gene function? How to study mirna? How to deliver sirna and mirna? New prospects on RNAi research
More information1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
More informationBasic Concepts of DNA, Proteins, Genes and Genomes
Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate
More informationMir-X mirna First-Strand Synthesis Kit User Manual
User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.
More informationNon-coding RNA. John S. Mattick* and Igor V. Makunin INTRODUCTION. EXPANSION OF ncrnas AND RNA METABOLISM IN EUKARYOTES
doi:10.1093/hmg/ddl046 R17 R29 Non-coding RNA John S. Mattick* and Igor V. Makunin Australian Research Council Centre for Functional and Applied Genomics, Institute for Molecular Bioscience, University
More informationName Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
More informationMicroRNA formation. 4th International Symposium on Non-Surgical Contraceptive Methods of Pet Population Control
MicroRNA formation mirna s are processed from several precursor stages Mammalian genomes seem to have 100 s of mirna s Nucleotides in positions 2-8 of an mirna are considered the mirna seed 5 Methyl-G
More informationIntroduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
More informationSystematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh
More informationPlant RNAi mechanisms: lessons from silent transgenes. Institut Jean-Pierre Bourgin, INRA Versailles
Plant RNAi mechanisms: lessons from silent transgenes Institut Jean-Pierre Bourgin, INRA Versailles Plants encode two types of small RNAs: mirna and sirna MIR genes endoir NAT pairs TAS and PolIV loci
More informationDr Alessandro Fatica (on behalf of Prof. Irene Bozzoni)
Dr Alessandro Fatica (on behalf of Prof. Irene Bozzoni) non coding RNAs in human diseases ROUND TABLE ITALY RUSSIA Dubna, 19-23 December 2010 alessandro.fatica@uniroma1.it Where is the information that
More informationAP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET
NAME: AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET 1. Griffith's experiments showing the transformation of R strain pneumococcus bacteria to S strain pneumococcus bacteria in the presence of
More information-UFRJ. Rio de Janeiro. Brazil, 2. -Fasteris Co., Plan-les-Ouates. Switzerland, 3. -West Virginia University. Morgantown.
GLOBAL ALTERATION OF MICRORNAS AND TRANSPOSON-DERIVED SMALL RNAS IN COTTON (GOSSYPIUM HIRSUTUM) DURING COTTON LEAFROLL DWARF POLEROVIRUS (CLRDV) INFECTION Elisson Romanel 1, Tatiane da Franca Silva 1,
More informationSickle cell anemia: Altered beta chain Single AA change (#6 Glu to Val) Consequence: Protein polymerizes Change in RBC shape ---> phenotypes
Protein Structure Polypeptide: Protein: Therefore: Example: Single chain of amino acids 1 or more polypeptide chains All polypeptides are proteins Some proteins contain >1 polypeptide Hemoglobin (O 2 binding
More informationImmunologie für Studierende der Biologie & Molekularmedizin. mirna und Immunität. Jürgen Wittmann (jwittman@molmed.uni-erlangen.
Immunologie für Studierende der Biologie & Molekularmedizin Konzepte der Immunologie Erlangen SS 2008 mirna und Immunität Jürgen Wittmann (jwittman@molmed.uni-erlangen.de) Division of Molecular Immunology
More informationAnalytical Study of Hexapod mirnas using Phylogenetic Methods
Analytical Study of Hexapod mirnas using Phylogenetic Methods A.K. Mishra and H.Chandrasekharan Unit of Simulation & Informatics, Indian Agricultural Research Institute, New Delhi, India akmishra@iari.res.in,
More informationmrna EDITING Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005
mrna EDITING mrna EDITING http://dbb.urmc.rochester.edu/labs/smith/research_2.htm The number of A to I sites in the human transcriptome >15;000 the vast majority of these sites occurring in Alu repeats
More informationSample Questions for Exam 3
Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.
More informationRETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
More informationINTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
More information7. 2. Regulation of gene expression. Unit 7: Molecular biology and genetics
7. 2 Regulation of gene expression We all start off as one stem cell (a fertilised ovum) that divides to give a ball of cells. These cells then differentiate and become specialised to carry out specific
More informationBiological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
More informationRNAi History, Mechanism and Application
DRUG DISCOVERY AND DEVELOPMENT RNAi History, Mechanism and Application Shuo Gu The History of RNAi About the author: Dr. Shuo Gu is currently a Postdoctoral Scholar at Stanford University, School of Medicine.
More informationBiotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
More informationtrna Processing and Modification
trna Processing and Modification RNA POL III - TRANSCRIPTS 5S RNA, trna, repetitive Sequenzen (Alu-typ), versch. kleine stabile RNAs (7SL - RNA vom signal recognition particle (SRP)), U6 RNA 5S RNA nicht
More informationTranslation. Translation: Assembly of polypeptides on a ribosome
Translation Translation: Assembly of polypeptides on a ribosome Living cells devote more energy to the synthesis of proteins than to any other aspect of metabolism. About a third of the dry mass of a cell
More informationLecture 6. Regulation of Protein Synthesis at the Translational Level
Regulation of Protein Synthesis (6.1) Lecture 6 Regulation of Protein Synthesis at the Translational Level Comparison of EF-Tu-GDP and EF-Tu-GTP conformations EF-Tu-GDP EF-Tu-GTP Next: Comparison of GDP
More informationBiochimie. Small RNAs derived from longer non-coding RNAs. Susanne Röther *, Gunter Meister. Review. abstract
Biochimie 93 (2011) 1905e1915 Contents lists available at ScienceDirect Biochimie journal homepage: www.elsevier.com/locate/biochi Review Small RNAs derived from longer non-coding RNAs Susanne Röther *,
More informationComprehensive mirna Research Technologies
Comprehensive mirna Research Technologies Sample & Assay Technologies QIAGEN solutions for advancing microrna research In the last few years, the identification of microrna (mirna) and the recognition
More information2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
More informationCCR Biology - Chapter 8 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 8 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Hershey and Chase know
More informationBiotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
More informationQuestion 4 /29 points. Total /100 points
MIT Department of Biology 7.28, Spring 2005 - Molecular Biology 7.28 Spring 2005 Exam Three Question 1 Question 2 Question 3 /30 points /20 points /21 points Question 4 /29 points Total /100 points 1 Question
More informationCoding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein
Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of
More informationDNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH)
DNA, RNA, replication, translation, and transcription Overview Recall the central dogma of biology: DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) DNA structure
More informationExpression analysis of Drosophila melanogaster micrornas
Expression analysis of Drosophila melanogaster micrornas Dissertation zur Erlangung des Doktorgrades der Mathematisch-Naturwissenschaftlichen Fakultäten der Georg-August-Universität zu Göttingen vorgelegt
More informationAlgorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
More informationTransfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.
Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,
More informationFunctional characterisation of microrna-containing Argonaute protein complexes
Dissertation zur Erlangung des Doktorgrades der Fakultät für Biologie der Ludwig-Maximilians-Universität München Functional characterisation of microrna-containing Argonaute protein complexes vorgelegt
More informationNon-Coding RNAs: Multi-Tasking Molecules in the Cell
Int. J. Mol. Sci. 2013, 14, 16010-16039; doi:10.3390/ijms140816010 Review OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Non-Coding RNAs: Multi-Tasking
More informationComparative epigenomic analysis between model plant and crop
The 19 th Crucifer Genetics Workshop and Brassica 2014 Genetic Improvement of Brassicaceae Crops in the Era of Genomics Comparative epigenomic analysis between model plant and crop Xiaofeng Cao Institute
More informationEuropean Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
More informationDNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3
DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can
More informationIntroduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
More information