Genetomic Promototypes
|
|
- Curtis Crawford
- 7 years ago
- Views:
Transcription
1 Genetomic Promototypes Mirkó Palla and Dana Pe er Department of Mechanical Engineering Clarkson University Potsdam, New York and Department of Genetics Harvard Medical School 77 Avenue Louis Pasteur Boston, Massachusetts 1
2 I. Introduction Transcriptional regulation plays a vital role in all living organisms. It influences development, complexity, diversity, homeostasis and other important biological functions (Davidson, 2001). Transcription is the first stage in the universal information flow from genome, where all genetic programs are stored, to proteome, through which these programs are executed. Thus, understanding the complex mechanism behind the control of transcription machinery constitutes one of the fundamental goals of quantitative biology. At the most fundamental level, transcription is controlled by the combinatorial interplay of cis-regulatory elements (or motifs) present in the gene s promoter region 1 and associated regulatory proteins (or transcription factors) present in the cytoplasm (Jacob and Monod, 1961). Because all transcription factors are gene products themselves, this mechanism is regulated by a set of motifs present in the particular gene s promoter. Thus, the elementary principles governing transcription can be understood by a quantitative description of how the motif s influence on gene expression depends on promoter context. In spite of major efforts aimed at identifying motifs in different species using a variety of approaches and analyzing their precise influence on gene expression (McGuire et al., 2000), little is known about the principles by which a gene s motifs translate into an expression level. In other words, quantitative effects of motifs on gene expression as a function of their promoter context is still poorly understood. II. Background Modern molecular biology has brought many new tools to the research scientists as well as an expanding database of genomes and new genes for study. Of particular use in the analysis of these genes is the synthetic promoter region, a base pair nucleotide sequence designed to the specifications of the investigator, which controls the transcription machinery. Synthetic promoters are responsible to control the same product 1 See figure 1 on page 6 for hypothetical gene control mechanism 2
3 as the gene of interest, but the bioengineered nucleotide sequence regulating that protein may express it differently under various environmental conditions. Designing synthetic promoters by hand is a time-consuming and error-prone process that may involve several computer programs. For this reason, an integrated bioengineering tool (a design software called BASHER) is under development, that combines many modules to provide a platform for high-throughput synthetic promoter region design for multi-kilobase sequences. Of all sequenced genomes, the yeast Saccharomyces cerevisiae has gained the most attention due to the availability of multiple yeast genomes and high quality mrna data. For this reason, this yeast species was chosen as our core model in the genomic analysis. III. Research methodology The power and flexibility of oligonucleotide synthesis is increasingly being recognized in the bioengineering community. Traditional promoter region synthesis applications include facilitation of site-directed mutagenesis, structural analysis and investigation of transcription regulation. The new theory of promoter variant design takes combinational and spacial effects (Beer and Tavazoie, 2004) of cis-binding sites 2 into account and incorporates them into the modeling process. Since binding sites can act as activators or inhibitors and can form modules (set of cis-elements) with linear, epistatic, synergistic or switch effects as result of their interaction, a deep combinatorial analysis is needed to decipher the governing regulatory logic. Previous studies show that there are functional and mechanistic implications of spatial organization of these regulatory elements. There are physical interactions between them as certain transcription factor binding sites overlap, implying the possibility for protein complex formation. Also, in the higher chromatin structure, there are regions of 3-dimensional occlusions blocking protein binding to regulatory motif sequence. Motif positioning relative to transcription start plays a significant role in the transcription regulatory mechanism, so synthetic DNA segment 2 Example of cis-binding sites (motifs) of promoter YCL027W figure 3 on page 7 3
4 insertions might reveal some functionality. Finally, the distance between cis-elements plays a major role in regulation; certain motif pairs only occur in a particular base pair distance form each other and some pairs occur more frequently then others in the promoter. It was also shown, that motif orientation and order has regulatory effects, i.e., a regulatory module will only influence gene expression in the right spatial combination (orientation, order). To decipher the governing regulatory logic, first combinations of elements must be removed or replaced with new synthetic motif sequences and the resulting gene expression profile can be analyzed under various environmental conditions 3. Furthermore the additional logical design steps should include: randomly moving a binding site to other locations, making small changes to cis-elements or adding new motifs based on new statistical data. These designing steps are performed by BASHER resulting in a set of systematic promoter variants in a high-throughput manner. In the past, researchers used many different programs to address the requirements of the separate steps of synthetic promoter design. Alternatively, they sent off their requirements to a black box provided by a gene synthesis company and let it use its proprietary programs to design nucleotide sequences of interest. To facilitate the use of synthetic promoter regions in both traditional and high-throughput applications, new and more flexible solutions are required. BASHER is a useful tool for investigators who wish to optimize protein expression and/or redesign their promoter of interest for detailed structure/function (Giaever, 2002) studies (e.g., mutagenesis). The objective of this research project is to create a Web-based program that is able to perform all of the functions outlined above for promoter design in a directed, step-wise manner. It accepts as input both ortholog promoter sequences and global transcription factor binding site maps of the organism of interest and allows users to move through the process of design in a series of modules that address practical issues surrounding oligonucleotide design. Users can follow the main design a promoter path or use the modules individually as needed. 3 See figure 2 on page 6 for flow chart of experimental steps 4
5 IV. References 1. Davidson EH (2001) Genomic Regulatory Systems: Development and Evolution. San Diego: Academic Press 2. Giaever G. et al. (2002) Functional profiling of the Saccharomyces cerevisiae genome. Nature 418: Jacob F., Monod J. (1961) Genetic regulatory mechanisms in the synthesis of proteins. J Mol Biol 3: Beer MA, Tavazoie S. (2004) Predicting gene expression from sequence. Cell 117: McGuire AM, Hughes JD, Church GM (2000) Conservation of DNA regulatory motifs and discovery of new motifs in microbial genomes. Genome Res 10:
6 V. Figures and tables Figure 1 - Gene control mechanism for gene X Ortholog promoters Expression data PSSMs YFG Basher Cis element map Conditions Promoter variants Figure 2 Flow chart for experimental steps 6
7 Figure 3 Transcription factor binding sites for promoter YCL027W [Output example of visualization software see more in Manual] 7
RNA & Protein Synthesis
RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis
More informationIn developmental genomic regulatory interactions among genes, encoding transcription factors
JOURNAL OF COMPUTATIONAL BIOLOGY Volume 20, Number 6, 2013 # Mary Ann Liebert, Inc. Pp. 419 423 DOI: 10.1089/cmb.2012.0297 Research Articles A New Software Package for Predictive Gene Regulatory Network
More informationSystematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh
More informationCOMPUTATIONAL FRAMEWORKS FOR UNDERSTANDING THE FUNCTION AND EVOLUTION OF DEVELOPMENTAL ENHANCERS IN DROSOPHILA
COMPUTATIONAL FRAMEWORKS FOR UNDERSTANDING THE FUNCTION AND EVOLUTION OF DEVELOPMENTAL ENHANCERS IN DROSOPHILA Saurabh Sinha, Dept of Computer Science, University of Illinois Cis-regulatory modules (enhancers)
More informationFrom DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
More informationUnderstanding the dynamics and function of cellular networks
Understanding the dynamics and function of cellular networks Cells are complex systems functionally diverse elements diverse interactions that form networks signal transduction-, gene regulatory-, metabolic-
More informationTranslation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
More informationIntegrating DNA Motif Discovery and Genome-Wide Expression Analysis. Erin M. Conlon
Integrating DNA Motif Discovery and Genome-Wide Expression Analysis Department of Mathematics and Statistics University of Massachusetts Amherst Statistics in Functional Genomics Workshop Ascona, Switzerland
More informationCurrent Motif Discovery Tools and their Limitations
Current Motif Discovery Tools and their Limitations Philipp Bucher SIB / CIG Workshop 3 October 2006 Trendy Concepts and Hypotheses Transcription regulatory elements act in a context-dependent manner.
More informationBob Jesberg. Boston, MA April 3, 2014
DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double
More informationFeed Forward Loops in Biological Systems
Feed Forward Loops in Biological Systems Dr. M. Vijayalakshmi School of Chemical and Biotechnology SASTRA University Joint Initiative of IITs and IISc Funded by MHRD Page 1 of 7 Table of Contents 1 INTRODUCTION...
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
More informationA Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
More informationSystems Biology through Data Analysis and Simulation
Biomolecular Networks Initiative Systems Biology through Data Analysis and Simulation William Cannon Computational Biosciences 5/30/03 Cellular Dynamics Microbial Cell Dynamics Data Mining Nitrate NARX
More informationHuman Genome Organization: An Update. Genome Organization: An Update
Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion
More informationBasic Concepts of DNA, Proteins, Genes and Genomes
Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate
More informationGENE REGULATION. Teacher Packet
AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures
More informationActivity 7.21 Transcription factors
Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation
More informationName Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
More informationGenetics Lecture Notes 7.03 2005. Lectures 1 2
Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several
More informationTitle: Surveying Genome to Identify Origins of DNA Replication In Silico
Title: Surveying Genome to Identify Origins of DNA Replication In Silico Abstract: DNA replication origins are the bases to realize the process of chromosome replication and analyze the progress of cell
More informationLecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.au What is Gene Expression & Gene Regulation? 1. Gene Expression
More informationData Integration. Lectures 16 & 17. ECS289A, WQ03, Filkov
Data Integration Lectures 16 & 17 Lectures Outline Goals for Data Integration Homogeneous data integration time series data (Filkov et al. 2002) Heterogeneous data integration microarray + sequence microarray
More informationThe sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:
Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How
More informationControl of Gene Expression
Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure
More informationDNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
More informationProtein Protein Interaction Networks
Functional Pattern Mining from Genome Scale Protein Protein Interaction Networks Young-Rae Cho, Ph.D. Assistant Professor Department of Computer Science Baylor University it My Definition of Bioinformatics
More informationGenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
More informationRETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
More informationSpecific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons
Tutorial II Gene expression: mrna translation and protein synthesis Piergiorgio Percipalle, PhD Program Control of gene transcription and RNA processing mrna translation and protein synthesis KAROLINSKA
More informationSchool of Nursing. Presented by Yvette Conley, PhD
Presented by Yvette Conley, PhD What we will cover during this webcast: Briefly discuss the approaches introduced in the paper: Genome Sequencing Genome Wide Association Studies Epigenomics Gene Expression
More informationAlgorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
More informationCCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
More informationInstitutional Partnership Program
GENEWIZ Outsourcing Services Institutional Partnership Program Solid Science. Superior Service. DNA Sequencing Partners to Fuel Your Success Institutions whose success depends on significant life science
More informationThe Steps. 1. Transcription. 2. Transferal. 3. Translation
Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order
More informationTranscription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
More informationSite-Directed Nucleases and Cisgenesis Maria Fedorova, Ph.D.
Site-Directed Nucleases and Cisgenesis Maria Fedorova, Ph.D. Regulatory Strategy Lead Enabling Technologies DuPont-Pioneer, USA 1 New Plant Breeding Techniques 2007 New Techniques Working Group established
More informationAn Overview of Cells and Cell Research
An Overview of Cells and Cell Research 1 An Overview of Cells and Cell Research Chapter Outline Model Species and Cell types Cell components Tools of Cell Biology Model Species E. Coli: simplest organism
More informationAnswer Key. Vocabulary Practice
Answer Key Vocabulary Practice Copyright by McDougal Littell, a division of Houghton Mifflin Company A. Categorize Words 1. organism, L; cell, L; species, L; transgenic, B; biotechnology, T; molecular
More information13.2 Ribosomes & Protein Synthesis
13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).
More informationHuman Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
More informationChapter 5: Organization and Expression of Immunoglobulin Genes
Chapter 5: Organization and Expression of Immunoglobulin Genes I. Genetic Model Compatible with Ig Structure A. Two models for Ab structure diversity 1. Germ-line theory: maintained that the genome contributed
More informationNetwork Analysis. BCH 5101: Analysis of -Omics Data 1/34
Network Analysis BCH 5101: Analysis of -Omics Data 1/34 Network Analysis Graphs as a representation of networks Examples of genome-scale graphs Statistical properties of genome-scale graphs The search
More informationCCR Biology - Chapter 8 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 8 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Hershey and Chase know
More informationWeb-Based Genomic Information Integration with Gene Ontology
Web-Based Genomic Information Integration with Gene Ontology Kai Xu 1 IMAGEN group, National ICT Australia, Sydney, Australia, kai.xu@nicta.com.au Abstract. Despite the dramatic growth of online genomic
More informationProtein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
More informationName Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
More informationTITLE MOTIVATION OBJECTIVES AUDIENCE COURSE INSTRUCTORS. Analysis of regulatory sequences controlling the expression of gene networks
TITLE Analysis of regulatory sequences controlling the expression of gene networks MOTIVATION Functional genomics techniques are defining sets of genes likely to act in concert. From expression profiles,
More informationNext Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took
More informationFocusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
More informationAnalysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics
Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics Christopher Benner, PhD Director, Integrative Genomics and Bioinformatics Core (IGC) idash Webinar,
More information13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
More informationBBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS
BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS 1. The Technology Strategy sets out six areas where technological developments are required to push the frontiers of knowledge
More informationRegents Biology REGENTS REVIEW: PROTEIN SYNTHESIS
Period Date REGENTS REVIEW: PROTEIN SYNTHESIS 1. The diagram at the right represents a portion of a type of organic molecule present in the cells of organisms. What will most likely happen if there is
More informationControl of Gene Expression
Control of Gene Expression (Learning Objectives) Explain the role of gene expression is differentiation of function of cells which leads to the emergence of different tissues, organs, and organ systems
More informationRNA Viruses. A Practical Approac h. Alan J. Cann
RNA Viruses A Practical Approac h Alan J. Cann List of protocols page xiii Abbreviations xvii Investigation of RNA virus genome structure 1 A j. Easton, A.C. Marriott and C.R. Pringl e 1 Introduction-the
More informationA Mathematical Model of a Synthetically Constructed Genetic Toggle Switch
BENG 221 Mathematical Methods in Bioengineering Project Report A Mathematical Model of a Synthetically Constructed Genetic Toggle Switch Nick Csicsery & Ricky O Laughlin October 15, 2013 1 TABLE OF CONTENTS
More informationWhite Paper. Yeast Systems Biology - Concepts
White Paper Yeast Systems Biology - Concepts Stefan Hohmann, Jens Nielsen, Hiroaki Kitano (see for further contributers at end of text) Göteborg, Lyngby, Tokyo, February 2004 1 Executive Summary Systems
More informationQuantitative proteomics background
Proteomics data analysis seminar Quantitative proteomics and transcriptomics of anaerobic and aerobic yeast cultures reveals post transcriptional regulation of key cellular processes de Groot, M., Daran
More informationJune 09, 2009 Random Mutagenesis
Why Mutagenesis? Analysis of protein function June 09, 2009 Random Mutagenesis Analysis of protein structure Protein engineering Analysis of structure-function relationship Analysis of the catalytic center
More informationGene Regulation -- The Lac Operon
Gene Regulation -- The Lac Operon Specific proteins are present in different tissues and some appear only at certain times during development. All cells of a higher organism have the full set of genes:
More informationGENETIC NETWORK ANALYSIS IN LIGHT OF MASSIVELY PARALLEL BIOLOGICAL DATA ACQUISITION.
GENETIC NETWORK ANALYSIS IN LIGHT OF MASSIVELY PARALLEL BIOLOGICAL DATA ACQUISITION. ZOLTAN SZALLASI Department of Pharmacology, Uniformed Services University of the Health Sciences, Bethesda, MD, 20814
More informationLecture 11 Data storage and LIMS solutions. Stéphane LE CROM lecrom@biologie.ens.fr
Lecture 11 Data storage and LIMS solutions Stéphane LE CROM lecrom@biologie.ens.fr Various steps of a DNA microarray experiment Experimental steps Data analysis Experimental design set up Chips on catalog
More informationMolecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
More informationGenetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
More informationReplication Study Guide
Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have
More informationDNA and the Cell. Version 2.3. English version. ELLS European Learning Laboratory for the Life Sciences
DNA and the Cell Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Version 2.3 English version ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra Manaia and
More informationPairwise Sequence Alignment
Pairwise Sequence Alignment carolin.kosiol@vetmeduni.ac.at SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What
More informationCentral Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription
Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional
More informationGene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
More informationThe world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
More informationINDUSTRY OVERVIEW. Our business segments. (ii) Global drug development service market Preclinical drug development services
The information and statistics set out in this section and other sections of this document were extracted from different official government publications, available sources from public market research
More informationHow To Understand The Pharmacology Of The Pharmaceutical Industry
It; MM MODERN Ul NDUSTRY 77 /
More informationResumen Curricular de los Profesores. Jesse Boehm
Resumen Curricular de los Profesores Jesse Boehm Jesse Boehm is the assistant director of the Cancer Program at the Broad Institute. In this role, he works closely with Cancer Program director Todd Golub
More informationBiology Final Exam Study Guide: Semester 2
Biology Final Exam Study Guide: Semester 2 Questions 1. Scientific method: What does each of these entail? Investigation and Experimentation Problem Hypothesis Methods Results/Data Discussion/Conclusion
More informationHow many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
More informationMicroarray Technology
Microarrays And Functional Genomics CPSC265 Matt Hudson Microarray Technology Relatively young technology Usually used like a Northern blot can determine the amount of mrna for a particular gene Except
More informationBIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16
Course Director: Dr. Barry Grant (DCM&B, bjgrant@med.umich.edu) Description: This is a three module course covering (1) Foundations of Bioinformatics, (2) Statistics in Bioinformatics, and (3) Systems
More informationBioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
More informationISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes
ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination
More informationThe Making of the Fittest: Evolving Switches, Evolving Bodies
OVERVIEW MODELING THE REGULATORY SWITCHES OF THE PITX1 GENE IN STICKLEBACK FISH This hands-on activity supports the short film, The Making of the Fittest:, and aims to help students understand eukaryotic
More informationDiscovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat
Bioinformatique et Séquençage Haut Débit, Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat 1 RNA Transcription to RNA and subsequent
More informationName: Date: Period: DNA Unit: DNA Webquest
Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History http://www.dnaftb.org/dnaftb/1/concept/index.html Read the text and answer the following questions.
More informationCHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the
More informationModeling and Simulation of Gene Regulatory Networks
Modeling and Simulation of Gene Regulatory Networks Hidde de Jong INRIA Grenoble - Rhône-Alpes Hidde.de-Jong@inria.fr http://ibis.inrialpes.fr INRIA Grenoble - Rhône-Alpes and IBIS IBIS: systems biology
More informationLightSwitch Luciferase Assay System
Constructs, Assays & Services Assay System Promoter GoClones Synthetic Response Elements Pathway Cell Lines 3 UTR GoClones mirna Mimics & Inhibitors Synthetic mirna Targets Transfection Reagents Assay
More informationRT 2 Profiler PCR Array: Web-Based Data Analysis Tutorial
RT 2 Profiler PCR Array: Web-Based Data Analysis Tutorial Samuel J. Rulli, Jr., Ph.D. qpcr-applications Scientist Samuel.Rulli@QIAGEN.com Pathway Focused Research from Sample Prep to Data Analysis! -2-
More informationDenominazione insegnamento in italiano Denominazione insegnamento in inglese Tipologia dell esame (scritto- scritto/orale orale)
Biochimica Cellulare II Cellular Biochemistry II e COMPREHENSION OF MECHANISMS REGULATING CELL CYCLE AND CELL PROLIFERATION IN EUKARYOTES. EVOLUTION OF MOLECULAR CIRCUITS THAT REGULATE GROWTH AND CELL
More informationHeuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations
Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations AlCoB 2014 First International Conference on Algorithms for Computational Biology Thiago da Silva Arruda Institute
More informationBioinformatics: Network Analysis
Bioinformatics: Network Analysis Graph-theoretic Properties of Biological Networks COMP 572 (BIOS 572 / BIOE 564) - Fall 2013 Luay Nakhleh, Rice University 1 Outline Architectural features Motifs, modules,
More informationINTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
More informationMolecular Genetics: Challenges for Statistical Practice. J.K. Lindsey
Molecular Genetics: Challenges for Statistical Practice J.K. Lindsey 1. What is a Microarray? 2. Design Questions 3. Modelling Questions 4. Longitudinal Data 5. Conclusions 1. What is a microarray? A microarray
More informationFlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem
FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert September 24, 2013 Abstract FlipFlop implements a fast method for de novo transcript
More informationIntroduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
More informationIntroduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
More informationCore Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1
Core Bioinformatics 2014/2015 Code: 42397 ECTS Credits: 12 Degree Type Year Semester 4313473 Bioinformàtica/Bioinformatics OB 0 1 Contact Name: Sònia Casillas Viladerrams Email: Sonia.Casillas@uab.cat
More informationBioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
More information1. Introduction Gene regulation Genomics and genome analyses Hidden markov model (HMM)
1. Introduction Gene regulation Genomics and genome analyses Hidden markov model (HMM) 2. Gene regulation tools and methods Regulatory sequences and motif discovery TF binding sites, microrna target prediction
More informationProbabilistic methods for post-genomic data integration
Probabilistic methods for post-genomic data integration Dirk Husmeier Biomathematics & Statistics Scotland (BioSS) JMB, The King s Buildings, Edinburgh EH9 3JZ United Kingdom http://wwwbiossacuk/ dirk
More informationStructure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
More information