Genetomic Promototypes

Size: px
Start display at page:

Download "Genetomic Promototypes"

Transcription

1 Genetomic Promototypes Mirkó Palla and Dana Pe er Department of Mechanical Engineering Clarkson University Potsdam, New York and Department of Genetics Harvard Medical School 77 Avenue Louis Pasteur Boston, Massachusetts 1

2 I. Introduction Transcriptional regulation plays a vital role in all living organisms. It influences development, complexity, diversity, homeostasis and other important biological functions (Davidson, 2001). Transcription is the first stage in the universal information flow from genome, where all genetic programs are stored, to proteome, through which these programs are executed. Thus, understanding the complex mechanism behind the control of transcription machinery constitutes one of the fundamental goals of quantitative biology. At the most fundamental level, transcription is controlled by the combinatorial interplay of cis-regulatory elements (or motifs) present in the gene s promoter region 1 and associated regulatory proteins (or transcription factors) present in the cytoplasm (Jacob and Monod, 1961). Because all transcription factors are gene products themselves, this mechanism is regulated by a set of motifs present in the particular gene s promoter. Thus, the elementary principles governing transcription can be understood by a quantitative description of how the motif s influence on gene expression depends on promoter context. In spite of major efforts aimed at identifying motifs in different species using a variety of approaches and analyzing their precise influence on gene expression (McGuire et al., 2000), little is known about the principles by which a gene s motifs translate into an expression level. In other words, quantitative effects of motifs on gene expression as a function of their promoter context is still poorly understood. II. Background Modern molecular biology has brought many new tools to the research scientists as well as an expanding database of genomes and new genes for study. Of particular use in the analysis of these genes is the synthetic promoter region, a base pair nucleotide sequence designed to the specifications of the investigator, which controls the transcription machinery. Synthetic promoters are responsible to control the same product 1 See figure 1 on page 6 for hypothetical gene control mechanism 2

3 as the gene of interest, but the bioengineered nucleotide sequence regulating that protein may express it differently under various environmental conditions. Designing synthetic promoters by hand is a time-consuming and error-prone process that may involve several computer programs. For this reason, an integrated bioengineering tool (a design software called BASHER) is under development, that combines many modules to provide a platform for high-throughput synthetic promoter region design for multi-kilobase sequences. Of all sequenced genomes, the yeast Saccharomyces cerevisiae has gained the most attention due to the availability of multiple yeast genomes and high quality mrna data. For this reason, this yeast species was chosen as our core model in the genomic analysis. III. Research methodology The power and flexibility of oligonucleotide synthesis is increasingly being recognized in the bioengineering community. Traditional promoter region synthesis applications include facilitation of site-directed mutagenesis, structural analysis and investigation of transcription regulation. The new theory of promoter variant design takes combinational and spacial effects (Beer and Tavazoie, 2004) of cis-binding sites 2 into account and incorporates them into the modeling process. Since binding sites can act as activators or inhibitors and can form modules (set of cis-elements) with linear, epistatic, synergistic or switch effects as result of their interaction, a deep combinatorial analysis is needed to decipher the governing regulatory logic. Previous studies show that there are functional and mechanistic implications of spatial organization of these regulatory elements. There are physical interactions between them as certain transcription factor binding sites overlap, implying the possibility for protein complex formation. Also, in the higher chromatin structure, there are regions of 3-dimensional occlusions blocking protein binding to regulatory motif sequence. Motif positioning relative to transcription start plays a significant role in the transcription regulatory mechanism, so synthetic DNA segment 2 Example of cis-binding sites (motifs) of promoter YCL027W figure 3 on page 7 3

4 insertions might reveal some functionality. Finally, the distance between cis-elements plays a major role in regulation; certain motif pairs only occur in a particular base pair distance form each other and some pairs occur more frequently then others in the promoter. It was also shown, that motif orientation and order has regulatory effects, i.e., a regulatory module will only influence gene expression in the right spatial combination (orientation, order). To decipher the governing regulatory logic, first combinations of elements must be removed or replaced with new synthetic motif sequences and the resulting gene expression profile can be analyzed under various environmental conditions 3. Furthermore the additional logical design steps should include: randomly moving a binding site to other locations, making small changes to cis-elements or adding new motifs based on new statistical data. These designing steps are performed by BASHER resulting in a set of systematic promoter variants in a high-throughput manner. In the past, researchers used many different programs to address the requirements of the separate steps of synthetic promoter design. Alternatively, they sent off their requirements to a black box provided by a gene synthesis company and let it use its proprietary programs to design nucleotide sequences of interest. To facilitate the use of synthetic promoter regions in both traditional and high-throughput applications, new and more flexible solutions are required. BASHER is a useful tool for investigators who wish to optimize protein expression and/or redesign their promoter of interest for detailed structure/function (Giaever, 2002) studies (e.g., mutagenesis). The objective of this research project is to create a Web-based program that is able to perform all of the functions outlined above for promoter design in a directed, step-wise manner. It accepts as input both ortholog promoter sequences and global transcription factor binding site maps of the organism of interest and allows users to move through the process of design in a series of modules that address practical issues surrounding oligonucleotide design. Users can follow the main design a promoter path or use the modules individually as needed. 3 See figure 2 on page 6 for flow chart of experimental steps 4

5 IV. References 1. Davidson EH (2001) Genomic Regulatory Systems: Development and Evolution. San Diego: Academic Press 2. Giaever G. et al. (2002) Functional profiling of the Saccharomyces cerevisiae genome. Nature 418: Jacob F., Monod J. (1961) Genetic regulatory mechanisms in the synthesis of proteins. J Mol Biol 3: Beer MA, Tavazoie S. (2004) Predicting gene expression from sequence. Cell 117: McGuire AM, Hughes JD, Church GM (2000) Conservation of DNA regulatory motifs and discovery of new motifs in microbial genomes. Genome Res 10:

6 V. Figures and tables Figure 1 - Gene control mechanism for gene X Ortholog promoters Expression data PSSMs YFG Basher Cis element map Conditions Promoter variants Figure 2 Flow chart for experimental steps 6

7 Figure 3 Transcription factor binding sites for promoter YCL027W [Output example of visualization software see more in Manual] 7

RNA & Protein Synthesis

RNA & Protein Synthesis RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis

More information

In developmental genomic regulatory interactions among genes, encoding transcription factors

In developmental genomic regulatory interactions among genes, encoding transcription factors JOURNAL OF COMPUTATIONAL BIOLOGY Volume 20, Number 6, 2013 # Mary Ann Liebert, Inc. Pp. 419 423 DOI: 10.1089/cmb.2012.0297 Research Articles A New Software Package for Predictive Gene Regulatory Network

More information

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

Understanding the dynamics and function of cellular networks

Understanding the dynamics and function of cellular networks Understanding the dynamics and function of cellular networks Cells are complex systems functionally diverse elements diverse interactions that form networks signal transduction-, gene regulatory-, metabolic-

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

Integrating DNA Motif Discovery and Genome-Wide Expression Analysis. Erin M. Conlon

Integrating DNA Motif Discovery and Genome-Wide Expression Analysis. Erin M. Conlon Integrating DNA Motif Discovery and Genome-Wide Expression Analysis Department of Mathematics and Statistics University of Massachusetts Amherst Statistics in Functional Genomics Workshop Ascona, Switzerland

More information

Current Motif Discovery Tools and their Limitations

Current Motif Discovery Tools and their Limitations Current Motif Discovery Tools and their Limitations Philipp Bucher SIB / CIG Workshop 3 October 2006 Trendy Concepts and Hypotheses Transcription regulatory elements act in a context-dependent manner.

More information

Bob Jesberg. Boston, MA April 3, 2014

Bob Jesberg. Boston, MA April 3, 2014 DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double

More information

Feed Forward Loops in Biological Systems

Feed Forward Loops in Biological Systems Feed Forward Loops in Biological Systems Dr. M. Vijayalakshmi School of Chemical and Biotechnology SASTRA University Joint Initiative of IITs and IISc Funded by MHRD Page 1 of 7 Table of Contents 1 INTRODUCTION...

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

Human Genome Organization: An Update. Genome Organization: An Update

Human Genome Organization: An Update. Genome Organization: An Update Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion

More information

Basic Concepts of DNA, Proteins, Genes and Genomes

Basic Concepts of DNA, Proteins, Genes and Genomes Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate

More information

GENE REGULATION. Teacher Packet

GENE REGULATION. Teacher Packet AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures

More information

Activity 7.21 Transcription factors

Activity 7.21 Transcription factors Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

Genetics Lecture Notes 7.03 2005. Lectures 1 2

Genetics Lecture Notes 7.03 2005. Lectures 1 2 Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several

More information

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: [email protected].

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu. Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: [email protected] What is Gene Expression & Gene Regulation? 1. Gene Expression

More information

Data Integration. Lectures 16 & 17. ECS289A, WQ03, Filkov

Data Integration. Lectures 16 & 17. ECS289A, WQ03, Filkov Data Integration Lectures 16 & 17 Lectures Outline Goals for Data Integration Homogeneous data integration time series data (Filkov et al. 2002) Heterogeneous data integration microarray + sequence microarray

More information

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized: Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

Protein Protein Interaction Networks

Protein Protein Interaction Networks Functional Pattern Mining from Genome Scale Protein Protein Interaction Networks Young-Rae Cho, Ph.D. Assistant Professor Department of Computer Science Baylor University it My Definition of Bioinformatics

More information

GenBank, Entrez, & FASTA

GenBank, Entrez, & FASTA GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Specific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons

Specific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons Tutorial II Gene expression: mrna translation and protein synthesis Piergiorgio Percipalle, PhD Program Control of gene transcription and RNA processing mrna translation and protein synthesis KAROLINSKA

More information

School of Nursing. Presented by Yvette Conley, PhD

School of Nursing. Presented by Yvette Conley, PhD Presented by Yvette Conley, PhD What we will cover during this webcast: Briefly discuss the approaches introduced in the paper: Genome Sequencing Genome Wide Association Studies Epigenomics Gene Expression

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Institutional Partnership Program

Institutional Partnership Program GENEWIZ Outsourcing Services Institutional Partnership Program Solid Science. Superior Service. DNA Sequencing Partners to Fuel Your Success Institutions whose success depends on significant life science

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

Site-Directed Nucleases and Cisgenesis Maria Fedorova, Ph.D.

Site-Directed Nucleases and Cisgenesis Maria Fedorova, Ph.D. Site-Directed Nucleases and Cisgenesis Maria Fedorova, Ph.D. Regulatory Strategy Lead Enabling Technologies DuPont-Pioneer, USA 1 New Plant Breeding Techniques 2007 New Techniques Working Group established

More information

An Overview of Cells and Cell Research

An Overview of Cells and Cell Research An Overview of Cells and Cell Research 1 An Overview of Cells and Cell Research Chapter Outline Model Species and Cell types Cell components Tools of Cell Biology Model Species E. Coli: simplest organism

More information

Answer Key. Vocabulary Practice

Answer Key. Vocabulary Practice Answer Key Vocabulary Practice Copyright by McDougal Littell, a division of Houghton Mifflin Company A. Categorize Words 1. organism, L; cell, L; species, L; transgenic, B; biotechnology, T; molecular

More information

13.2 Ribosomes & Protein Synthesis

13.2 Ribosomes & Protein Synthesis 13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).

More information

Human Genome and Human Genome Project. Louxin Zhang

Human Genome and Human Genome Project. Louxin Zhang Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular

More information

Chapter 5: Organization and Expression of Immunoglobulin Genes

Chapter 5: Organization and Expression of Immunoglobulin Genes Chapter 5: Organization and Expression of Immunoglobulin Genes I. Genetic Model Compatible with Ig Structure A. Two models for Ab structure diversity 1. Germ-line theory: maintained that the genome contributed

More information

Network Analysis. BCH 5101: Analysis of -Omics Data 1/34

Network Analysis. BCH 5101: Analysis of -Omics Data 1/34 Network Analysis BCH 5101: Analysis of -Omics Data 1/34 Network Analysis Graphs as a representation of networks Examples of genome-scale graphs Statistical properties of genome-scale graphs The search

More information

CCR Biology - Chapter 8 Practice Test - Summer 2012

CCR Biology - Chapter 8 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 8 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Hershey and Chase know

More information

Web-Based Genomic Information Integration with Gene Ontology

Web-Based Genomic Information Integration with Gene Ontology Web-Based Genomic Information Integration with Gene Ontology Kai Xu 1 IMAGEN group, National ICT Australia, Sydney, Australia, [email protected] Abstract. Despite the dramatic growth of online genomic

More information

Protein Synthesis How Genes Become Constituent Molecules

Protein Synthesis How Genes Become Constituent Molecules Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University [email protected] http://tandem.bu.edu/ The Human Genome Project took

More information

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Focusing on results not data comprehensive data analysis for targeted next generation sequencing Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes

More information

Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics

Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics Christopher Benner, PhD Director, Integrative Genomics and Bioinformatics Core (IGC) idash Webinar,

More information

13.4 Gene Regulation and Expression

13.4 Gene Regulation and Expression 13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.

More information

BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS

BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS 1. The Technology Strategy sets out six areas where technological developments are required to push the frontiers of knowledge

More information

Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS

Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS Period Date REGENTS REVIEW: PROTEIN SYNTHESIS 1. The diagram at the right represents a portion of a type of organic molecule present in the cells of organisms. What will most likely happen if there is

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression (Learning Objectives) Explain the role of gene expression is differentiation of function of cells which leads to the emergence of different tissues, organs, and organ systems

More information

RNA Viruses. A Practical Approac h. Alan J. Cann

RNA Viruses. A Practical Approac h. Alan J. Cann RNA Viruses A Practical Approac h Alan J. Cann List of protocols page xiii Abbreviations xvii Investigation of RNA virus genome structure 1 A j. Easton, A.C. Marriott and C.R. Pringl e 1 Introduction-the

More information

A Mathematical Model of a Synthetically Constructed Genetic Toggle Switch

A Mathematical Model of a Synthetically Constructed Genetic Toggle Switch BENG 221 Mathematical Methods in Bioengineering Project Report A Mathematical Model of a Synthetically Constructed Genetic Toggle Switch Nick Csicsery & Ricky O Laughlin October 15, 2013 1 TABLE OF CONTENTS

More information

White Paper. Yeast Systems Biology - Concepts

White Paper. Yeast Systems Biology - Concepts White Paper Yeast Systems Biology - Concepts Stefan Hohmann, Jens Nielsen, Hiroaki Kitano (see for further contributers at end of text) Göteborg, Lyngby, Tokyo, February 2004 1 Executive Summary Systems

More information

Quantitative proteomics background

Quantitative proteomics background Proteomics data analysis seminar Quantitative proteomics and transcriptomics of anaerobic and aerobic yeast cultures reveals post transcriptional regulation of key cellular processes de Groot, M., Daran

More information

June 09, 2009 Random Mutagenesis

June 09, 2009 Random Mutagenesis Why Mutagenesis? Analysis of protein function June 09, 2009 Random Mutagenesis Analysis of protein structure Protein engineering Analysis of structure-function relationship Analysis of the catalytic center

More information

Gene Regulation -- The Lac Operon

Gene Regulation -- The Lac Operon Gene Regulation -- The Lac Operon Specific proteins are present in different tissues and some appear only at certain times during development. All cells of a higher organism have the full set of genes:

More information

GENETIC NETWORK ANALYSIS IN LIGHT OF MASSIVELY PARALLEL BIOLOGICAL DATA ACQUISITION.

GENETIC NETWORK ANALYSIS IN LIGHT OF MASSIVELY PARALLEL BIOLOGICAL DATA ACQUISITION. GENETIC NETWORK ANALYSIS IN LIGHT OF MASSIVELY PARALLEL BIOLOGICAL DATA ACQUISITION. ZOLTAN SZALLASI Department of Pharmacology, Uniformed Services University of the Health Sciences, Bethesda, MD, 20814

More information

Lecture 11 Data storage and LIMS solutions. Stéphane LE CROM [email protected]

Lecture 11 Data storage and LIMS solutions. Stéphane LE CROM lecrom@biologie.ens.fr Lecture 11 Data storage and LIMS solutions Stéphane LE CROM [email protected] Various steps of a DNA microarray experiment Experimental steps Data analysis Experimental design set up Chips on catalog

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

Replication Study Guide

Replication Study Guide Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have

More information

DNA and the Cell. Version 2.3. English version. ELLS European Learning Laboratory for the Life Sciences

DNA and the Cell. Version 2.3. English version. ELLS European Learning Laboratory for the Life Sciences DNA and the Cell Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Version 2.3 English version ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra Manaia and

More information

Pairwise Sequence Alignment

Pairwise Sequence Alignment Pairwise Sequence Alignment [email protected] SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What

More information

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional

More information

Gene Models & Bed format: What they represent.

Gene Models & Bed format: What they represent. GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,

More information

The world of non-coding RNA. Espen Enerly

The world of non-coding RNA. Espen Enerly The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often

More information

INDUSTRY OVERVIEW. Our business segments. (ii) Global drug development service market Preclinical drug development services

INDUSTRY OVERVIEW. Our business segments. (ii) Global drug development service market Preclinical drug development services The information and statistics set out in this section and other sections of this document were extracted from different official government publications, available sources from public market research

More information

Biology Final Exam Study Guide: Semester 2

Biology Final Exam Study Guide: Semester 2 Biology Final Exam Study Guide: Semester 2 Questions 1. Scientific method: What does each of these entail? Investigation and Experimentation Problem Hypothesis Methods Results/Data Discussion/Conclusion

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

Microarray Technology

Microarray Technology Microarrays And Functional Genomics CPSC265 Matt Hudson Microarray Technology Relatively young technology Usually used like a Northern blot can determine the amount of mrna for a particular gene Except

More information

BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16

BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16 Course Director: Dr. Barry Grant (DCM&B, [email protected]) Description: This is a three module course covering (1) Foundations of Bioinformatics, (2) Statistics in Bioinformatics, and (3) Systems

More information

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination

More information

The Making of the Fittest: Evolving Switches, Evolving Bodies

The Making of the Fittest: Evolving Switches, Evolving Bodies OVERVIEW MODELING THE REGULATORY SWITCHES OF THE PITX1 GENE IN STICKLEBACK FISH This hands-on activity supports the short film, The Making of the Fittest:, and aims to help students understand eukaryotic

More information

Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) [email protected]

Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat Bioinformatique et Séquençage Haut Débit, Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) [email protected] 1 RNA Transcription to RNA and subsequent

More information

Name: Date: Period: DNA Unit: DNA Webquest

Name: Date: Period: DNA Unit: DNA Webquest Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History http://www.dnaftb.org/dnaftb/1/concept/index.html Read the text and answer the following questions.

More information

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the

More information

Modeling and Simulation of Gene Regulatory Networks

Modeling and Simulation of Gene Regulatory Networks Modeling and Simulation of Gene Regulatory Networks Hidde de Jong INRIA Grenoble - Rhône-Alpes [email protected] http://ibis.inrialpes.fr INRIA Grenoble - Rhône-Alpes and IBIS IBIS: systems biology

More information

LightSwitch Luciferase Assay System

LightSwitch Luciferase Assay System Constructs, Assays & Services Assay System Promoter GoClones Synthetic Response Elements Pathway Cell Lines 3 UTR GoClones mirna Mimics & Inhibitors Synthetic mirna Targets Transfection Reagents Assay

More information

RT 2 Profiler PCR Array: Web-Based Data Analysis Tutorial

RT 2 Profiler PCR Array: Web-Based Data Analysis Tutorial RT 2 Profiler PCR Array: Web-Based Data Analysis Tutorial Samuel J. Rulli, Jr., Ph.D. qpcr-applications Scientist [email protected] Pathway Focused Research from Sample Prep to Data Analysis! -2-

More information

Denominazione insegnamento in italiano Denominazione insegnamento in inglese Tipologia dell esame (scritto- scritto/orale orale)

Denominazione insegnamento in italiano Denominazione insegnamento in inglese Tipologia dell esame (scritto- scritto/orale orale) Biochimica Cellulare II Cellular Biochemistry II e COMPREHENSION OF MECHANISMS REGULATING CELL CYCLE AND CELL PROLIFERATION IN EUKARYOTES. EVOLUTION OF MOLECULAR CIRCUITS THAT REGULATE GROWTH AND CELL

More information

Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations

Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations AlCoB 2014 First International Conference on Algorithms for Computational Biology Thiago da Silva Arruda Institute

More information

Bioinformatics: Network Analysis

Bioinformatics: Network Analysis Bioinformatics: Network Analysis Graph-theoretic Properties of Biological Networks COMP 572 (BIOS 572 / BIOE 564) - Fall 2013 Luay Nakhleh, Rice University 1 Outline Architectural features Motifs, modules,

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS

More information

Molecular Genetics: Challenges for Statistical Practice. J.K. Lindsey

Molecular Genetics: Challenges for Statistical Practice. J.K. Lindsey Molecular Genetics: Challenges for Statistical Practice J.K. Lindsey 1. What is a Microarray? 2. Design Questions 3. Modelling Questions 4. Longitudinal Data 5. Conclusions 1. What is a microarray? A microarray

More information

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert September 24, 2013 Abstract FlipFlop implements a fast method for de novo transcript

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]

More information

Introduction to Genome Annotation

Introduction to Genome Annotation Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT

More information

Core Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1

Core Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1 Core Bioinformatics 2014/2015 Code: 42397 ECTS Credits: 12 Degree Type Year Semester 4313473 Bioinformàtica/Bioinformatics OB 0 1 Contact Name: Sònia Casillas Viladerrams Email: [email protected]

More information

Bioinformatics Grid - Enabled Tools For Biologists.

Bioinformatics Grid - Enabled Tools For Biologists. Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis

More information

1. Introduction Gene regulation Genomics and genome analyses Hidden markov model (HMM)

1. Introduction Gene regulation Genomics and genome analyses Hidden markov model (HMM) 1. Introduction Gene regulation Genomics and genome analyses Hidden markov model (HMM) 2. Gene regulation tools and methods Regulatory sequences and motif discovery TF binding sites, microrna target prediction

More information

Probabilistic methods for post-genomic data integration

Probabilistic methods for post-genomic data integration Probabilistic methods for post-genomic data integration Dirk Husmeier Biomathematics & Statistics Scotland (BioSS) JMB, The King s Buildings, Edinburgh EH9 3JZ United Kingdom http://wwwbiossacuk/ dirk

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information