Nebula A web-server for advanced ChIP-seq data analysis. Tutorial. by Valentina BOEVA
|
|
|
- Jasmin Singleton
- 10 years ago
- Views:
Transcription
1 Nebula A web-server for advanced ChIP-seq data analysis Tutorial by Valentina BOEVA
2 Content Upload data to the history pp. 5-6 Check read number and sequencing quality pp. 7-9 Visualize.BAM files in UCSC pp Run peak calling with MACS/FindPeaks pp Calculation of peak height distribution (control for immunoprecipitation quality, on FindPeaks results) pp Peak filtering (on FindPeaks results) p. 20 Convert FindPeaks output (.peaks) into Bed p. 21 Visualize.wig or.bed in UCSC pp De novo motif finding with ChIPmunk pp Calculate distribution of peak locations around gene TSS p. 30 Annotate peaks with genomic features p. 31 Run motif finding for peaks with selected genomic features pp Annotate genes with peak information p. 34 Annexes pp
3 Our web server: Our web service, Nebula, is based on the Galaxy open source framework. Tool box Work field History Main Galaxy server: [ ] does not include all our ChIP-seq analysis tools, but you can use it for other occasions. 3
4 Create your account Each registered user have a 50Gb quota and unregistered user have a 15Gb quota (which is enough to run the tutorial with examples). We would prefer you to register even if you don t use your real address. 4
5 Download the test dataset to the history Select and import all datasets: Then go back by clicking Analyze Data 5
6 Alternative way to download your dataset to the history This way you will use outside of this tutorial To upload files larger than 2GB, the user has to use the URL method through FTP/HTTP protocol. The user must have access to an open web server or ftp server where he should upload his data. If the user does not have access to any web or ftp server, he can install his own web server. The following servers are free and can be easily installed: Web servers: MAMP for Mac ( WAMP for Windows ( Ftp servers: FileZilla Server for Windows ( Pure-FTPd for Mac ( Once the user has his own server installed, he can put his data on the server, copy the URL to the file ( or and paste the URL into the URL Text box of the upload tool. After clicking on execute, the upload will start. A more complete tutorial can be found at the main Galaxy server: -> Live Quickies: Uploading Data using FTP, Galactic quickie #17 6
7 Read statistics Run flagstat to see how many reads were mapped flagstat output: 7
8 Check read quality before calling peaks Run FASTQC to see statistics on read quality Check FASTQC output: 8
9 Check read quality before calling peaks Check how many reads you have in total by looking at the output of flagstat (p. 7). How many reads were promised by the sequencing facilities? I would say that 20 million mapped reads should be OK. In our example we have more then 2 million reads on chr1 (0.07 of the total mouse genome), this corresponds to about 30 million reads for the whole genome. Check the proportion of duplicate reads ( FASTQC, p. 8). High level of PCR duplicates means that you provided to little material for sequencing. Check whether you will have enough reads when you filter out duplicates. In our case we have about 30% of reads which are duplicates. Looking at the graph, we can say that filtering of duplicate reads will remove about 20% of reads. So it is still OK to continue our analysis and do peak calling. (MACS and FindPeaks will remove duplicate reads for you). 9
10 Visualize.SAM/.BAM files in UCSC First create an index (.bai) for.bam files Do it both for TF_chr1_sorted.bam and input_chr1_sorted.bam! 10
11 Visualize.SAM/.BAM files in UCSC Click on main of the initial.bam file to visualize it in UCSC Do it twice: TF_chr1_sorted.bam and input_chr1_sorted.bam! Uploaded tracks will stay in your UCSC for several days. You can close and open the UCSC browser when you want and you won t lose your tracks. 11
12 Visualize.SAM/.BAM files in UCSC Go to the Klf7 gene and change view of the track right click! 12
13 How does a good binging site look like? (from Valouev et al., Nat Methods 2008) In our case the separation of forward and revers reads is not as clear. This is because it is SOLiD reads and we performed double sonication (one before and one after immunoprecipitation) 13
14 Fragment count There exist two main ways to extract the signal (construct peaks) Tools: FindPeaks CisGenome Useq QuEST GLITR MACS F-Seq PeakSeq ERANGE SICER Spp SiSSRs Main methods: Tag extension Adopted from S. Pepke et al., 2009 Nat Methods (FindPeaks) (MACS) 14
15 Run MACS (if you want to compare its output with the output of FindPeaks. You can skip this step.) Band width: This value is only used while building the shifting model. Should be DNA fragment lengths It is important to check Parse xls files into into distinct interval files to get the locations of peak summits 15
16 Run FindPeaks Create a subset of the control dataset if there are more reads for the control sample than for the ChIP sample This command will 1. filter out duplicate reads from your ChIP and Control datasets, 2. randomly select reads from the Control sample so that the total number of reads in both sample were equal. 3. Transform.BAM into.sam, because for some unknown reason FindPeaks does not like some.bam If you have the same number of reads in the ChIP and the control sample, you will be able to compare their outputs later on and filter out peaks detected in both datasets. Imagine, you have 10 times more reads in the control? Then your real signal in the ChIP can appear weak 16
17 Run FindPeaks Run FindPeaks on the TF and Input sample (twice!) 17
18 Calculate peak height distribution immunoprecipitation quality control You should enter FindPeaks output files (.peaks) for the TF and Input You can the select the minimal peak height for further analyses using the calculated evaluation of false discovery rate: 18
19 Calculate peak height distribution immunoprecipitation quality control More high peaks in the ChIP sample the better the immunoprecipitation was preformed 19
20 Filter FindPeaks output using peaks from the control dataset The actual peak shapes is replaced by triangles (start, end, maximum and height). Then, the height (x) of maximal overlap is calculated. The ChIP peak is rejected if its height (h1) divided by x is less than or equal to a given threshold. ChIP Control ChIP Control vs h1 x h2 x = h2 h1 h1/x > 2? Keep the peak 20
21 Convert FindPeaks output (.peaks) into Bed if you did not select output in.bed at the previous step Convert filtered peaks into.bed (.BED is a standard format for genomic intervals): rename Convert the control peaks too. One should use a low threshold on peak height (we will further use these peaks as random control for peak location distribution): 21
22 Visualize.bed in UCSC For.BED: visualize directly in UCSC Klf7 22
23 Visualize.wig in UCSC For.wig.gz (output of FindPeaks): visualize directly in UCSC For.Wig (output of MACS): you need to convert.wig to.bw (Big Wig) first and then you will visualyze the BigWig file: 23
24 Get.fasta sequences to find overrepresented motifs Create.bed with coordinates of central regions of peaks (FindPeaks output: use.bed file) If you want to extract central regions for MACS use peaks: interval file instead of peaks: bed, since the former contains information about peak summits: 24
25 Get.fasta sequences to find overrepresented motifs Extract.fasta Extract.fasta for MACS central peak regions too if you used MACS peak calling: 25
26 Run motif finding on central regions of peaks Please, use this NAME for testing! If you also created.fasta for the MACS peaks (p. 24), you can run motif finding on them too: Please, NAME for testing! 26
27 Run motif finding on central regions of peaks Motifs found in peaks identified by FindPeaks (200bp central region, use UnZoom to see it better):
28 ChIPmunk has two modes to call multiple motifs Mask sequences ( filter ) Looking for several motifs of one TF cgatcgagacaggaatggctagata cacatgtaccaggaatccgagatat acgagatcgcaggaaaggctacgat cacatagatccggaatgcgatgcat actgcgctgcaggaatgagctagat cacagatggaaggaaggaaatgcat agatcgcggaaggaaggaactagca Mask motifs ( mask ) Looking for motifs of co-factors cgatcgagacaggaatggctagata cacatgtaccaggaatccgagatat acgagatcgcaggaaaggctacgat cacatagatccggaatgcgatgcat actgcgctgcaggaatgagctagat cacagatggaaggaaggaaatgcat agatcgcggaaggaaggaactagca CAGGAATG CAGGAATC CAGGAAAG CCGGAATG CAGGAATG GGAAGGAAGGAA GGAAGGAAGGAA CAGGAATG CAGGAATC CAGGAAAG CCGGAATG CAGGAATG agat agat agat agat agat agat agat Motif 1 Motif 2 Motif 1 Motif 2 Here we used the mask mode for motif finding (p. 25) 28
29 Which known transcription factors correspond to identified motifs? Run TOMTOM: TOMTOM can be found by google using TOMTOM motif Select the type of motif mask Copy-paste your motif from Galaxy (remove motif name and nucleotide names in the beginning of each line) 29
30 Calculate distribution of peak locations around gene TSS Select the.bed files for FindPeaks filtered peaks and control. Use ProbeSets_FC1.5_ txt file with information about activated/repressed genes (this file you have uploaded to your history in the very beginning) ChIP Control ChIP vs Control 30
31 Modulated vs NoResponse for Control Modulated vs NoResponse ChIP vs Control Annotate peaks with genomic features 31
32 Run motif finding for peaks with selected genomic features Use: (c7== promoter or c7== immediatedownstream ) and c9== up-regulated Select central regions of peaks: 32
33 Run motif finding for peaks with selected genomic features Get.fasta Run Motif Finding Visualize motifs 33
34 Enrich. / Control Enrich. / Total Proportion Annotate genes with peak information Select 10 or 100 if you need a p-value for enrichment of each genomic category intragenic regions 34
35 Annexes File formats:.bai index for a.bam file (to visualize.bam in UCSC).BAM aligned reads, binary.sam.bed genomic coordinates.bw (BIG WIG) signal profile (to visualize.wig in UCSC).CSFASTA read sequences in color code.fasta DNA sequences.fastq read sequences and qualities.sam aligned reads.qual read qualities.wig signal profile (for visualization) 35
36 Tertiary analysis Peak calling + statistics Preliminary analysis + statistics Our workflow 36
Analysis of ChIP-seq data in Galaxy
Analysis of ChIP-seq data in Galaxy November, 2012 Local copy: https://galaxy.wi.mit.edu/ Joint project between BaRC and IT Main site: http://main.g2.bx.psu.edu/ 1 Font Conventions Bold and blue refers
Comparing Methods for Identifying Transcription Factor Target Genes
Comparing Methods for Identifying Transcription Factor Target Genes Alena van Bömmel (R 3.3.73) Matthew Huska (R 3.3.18) Max Planck Institute for Molecular Genetics Folie 1 Transcriptional Regulation TF
GMQL Functional Comparison with BEDTools and BEDOPS
GMQL Functional Comparison with BEDTools and BEDOPS Genomic Computing Group Dipartimento di Elettronica, Informazione e Bioingegneria Politecnico di Milano This document presents a functional comparison
Frequently Asked Questions Next Generation Sequencing
Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided
Computational Genomics. Next generation sequencing (NGS)
Computational Genomics Next generation sequencing (NGS) Sequencing technology defies Moore s law Nature Methods 2011 Log 10 (price) Sequencing the Human Genome 2001: Human Genome Project 2.7G$, 11 years
A Brief Introduction on DNase-Seq Data Aanalysis
A Brief Introduction on DNase-Seq Data Aanalysis Hashem Koohy, Thomas Down, Mikhail Spivakov and Tim Hubbard Spivakov s and Fraser s Lab September 13, 2014 1 Introduction DNaseI is an enzyme which cuts
Partek Methylation User Guide
Partek Methylation User Guide Introduction This user guide will explain the different types of workflow that can be used to analyze methylation datasets. Under the Partek Methylation workflow there are
Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center
Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing
17 July 2014 WEB-SERVER MANUAL. Contact: Michael Hackenberg ([email protected])
WEB-SERVER MANUAL Contact: Michael Hackenberg ([email protected]) 1 1 Introduction srnabench is a free web-server tool and standalone application for processing small- RNA data obtained from next generation
Tutorial for proteome data analysis using the Perseus software platform
Tutorial for proteome data analysis using the Perseus software platform Laboratory of Mass Spectrometry, LNBio, CNPEM Tutorial version 1.0, January 2014. Note: This tutorial was written based on the information
Genome-wide measurements of protein-dna interaction by chromatin immunoprecipitation
Genome-wide measurements of protein-dna interaction by chromatin immunoprecipitation D. Puthier. laboratoire INSERM, Aix-Marseille Université, TAGC/INSERM U928, Parc Scientifique de Luminy case 928 Outline
Exercise with Gene Ontology - Cytoscape - BiNGO
Exercise with Gene Ontology - Cytoscape - BiNGO This practical has material extracted from http://www.cbs.dtu.dk/chipcourse/exercises/ex_go/goexercise11.php In this exercise we will analyze microarray
NaviCell Data Visualization Python API
NaviCell Data Visualization Python API Tutorial - Version 1.0 The NaviCell Data Visualization Python API is a Python module that let computational biologists write programs to interact with the molecular
GeneProf and the new GeneProf Web Services
GeneProf and the new GeneProf Web Services Florian Halbritter [email protected] Stem Cell Bioinformatics Group (Simon R. Tomlinson) [email protected] December 10, 2012 Florian Halbritter
Guide for Data Visualization and Analysis using ACSN
Guide for Data Visualization and Analysis using ACSN ACSN contains the NaviCell tool box, the intuitive and user- friendly environment for data visualization and analysis. The tool is accessible from the
LifeScope Genomic Analysis Software 2.5
USER GUIDE LifeScope Genomic Analysis Software 2.5 Graphical User Interface DATA ANALYSIS METHODS AND INTERPRETATION Publication Part Number 4471877 Rev. A Revision Date November 2011 For Research Use
SFTP Server User Login Instructions. Open Internet explorer and enter the following url: https://sftp.sae.org
SFTP Server User Login Instructions Open Internet explorer and enter the following url: https://sftp.sae.org You will be prompted for a user id and password as such. Please enter your account id and password.
Removing Sequential Bottlenecks in Analysis of Next-Generation Sequencing Data
Removing Sequential Bottlenecks in Analysis of Next-Generation Sequencing Data Yi Wang, Gagan Agrawal, Gulcin Ozer and Kun Huang The Ohio State University HiCOMB 2014 May 19 th, Phoenix, Arizona 1 Outline
Visualization of Phylogenetic Trees and Metadata
Visualization of Phylogenetic Trees and Metadata November 27, 2015 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com [email protected]
ACCREDITED SOLUTION. EXPLORER Core FTP
ACCREDITED SOLUTION EXPLORER Core FTP Document Name: EXPLORER Core FTP Revision: B Introduction: Typical Users: Product Description: This document describes the Core FTP (File Transfer Protocol) software
Inspiring Creative Fun Ysbrydoledig Creadigol Hwyl. Web Design in Nvu Workbook 1
Inspiring Creative Fun Ysbrydoledig Creadigol Hwyl Web Design in Nvu Workbook 1 The demand for Web Development skills is at an all time high due to the growing demand for businesses and individuals to
Ad Hoc (Temporary) Accounts Instructions
DLG/PDV SFTP Server Instructions 1. Ad Hoc (Temporary) Accounts. 2. LeadsGen (Permanent) Accounts. 3. Manually configuring SFTP Clients (WinSCP & FileZilla). 4. Uploading files into SFTP server. 5. Frequently
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data The Illumina TopHat Alignment and Cufflinks Assembly and Differential Expression apps make RNA data analysis accessible to any user, regardless
FileZilla: Uploading/Downloading Files to SBI FTP
FileZilla Download and Installation Instructions FileZilla is a free software that uses SourceForge as an installation provider. SourceForge is bundling the FileZilla software with other products that
Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes
Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes 2.1 Introduction Large-scale insertional mutagenesis screening in
Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics
Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics Christopher Benner, PhD Director, Integrative Genomics and Bioinformatics Core (IGC) idash Webinar,
Data Analysis & Management of High-throughput Sequencing Data. Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute
Data Analysis & Management of High-throughput Sequencing Data Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute Current Issues Current Issues The QSEQ file Number files per
Introduction to NGS data analysis
Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High
Basic Analysis of Microarray Data
Basic Analysis of Microarray Data A User Guide and Tutorial Scott A. Ness, Ph.D. Co-Director, Keck-UNM Genomics Resource and Dept. of Molecular Genetics and Microbiology University of New Mexico HSC Tel.
MORPHEUS. http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix.
MORPHEUS http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix. Reference: MORPHEUS, a Webtool for Transcripton Factor Binding Analysis Using
How to Use Motion Detection in ACTi Cameras
ACTi Knowledge Base Category: Installation & Configuration Note Sub-category: Application Model: All Firmware: N/A Software: N/A Author: Ando.Meritee Published: 2010/11/19 Reviewed: 2011/03/02 How to Use
Create and share a map with GIScloud.com
Create and share a map with GIScloud.com GIS Cloud is a web based Geographic Information System powered by Cloud Computing and with the full power of desktop GIS. It allows users to create and access your
Module 1. Sequence Formats and Retrieval. Charles Steward
The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.
Data Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
N E X U S C O P Y N U M B E R H O W T O G U I D E S
HOW TO ACCESS THE ISCA DATA STORED IN BIODISCOVERY NEXUS DB GENOMIC DATA REPOSITORY: The ISCA (International Standard for Cytogenomic Arrays) consortium database contains whole genome array data from a
How to Install and Setting Up Drupal
Drupal 101 Introduction to Drupal September 12, 2014 nerdsummit.org Rick Hood [email protected] [email protected] [email protected] www.drupal.org/user/54879 2011 - present
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh
Tutorial. Reference Genome Tracks. Sample to Insight. November 27, 2015
Reference Genome Tracks November 27, 2015 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com [email protected] Reference
Accessing the FTP Server - User Manual
CENTRAL BANK OF CYPRUS Accessing the FTP Server - User Manual IT Department, CENTRAL BANK OF CYPRUS TABLE OF CONTENTS 1 EXECUTIVE SUMMARY... 1 1.1 AUDIENCE... 1 1.2 SCOPE... 1 2 CHANGES FROM THE OLD FTP
CMS and e-commerce Solutions. version 1.0. Please, visit us at: http://www.itoris.com or contact directly by email: sales@itoris.
Help Desk for Magento User Guide version 1.0 created by IToris IToris Table of contents 1. Introduction... 3 1.1. Purpose... 3 2. Installation and License... 3 2.1. System Requirements... 3 2.2. Installation...
Metadata Import Plugin User manual
Metadata Import Plugin User manual User manual for Metadata Import Plugin 1.0 Windows, Mac OS X and Linux August 30, 2013 This software is for research purposes only. CLC bio Silkeborgvej 2 Prismet DK-8000
SeattleSNPs Interactive Tutorial: Web Tools for Site Selection, Linkage Disequilibrium and Haplotype Analysis
SeattleSNPs Interactive Tutorial: Web Tools for Site Selection, Linkage Disequilibrium and Haplotype Analysis Goal: This tutorial introduces several websites and tools useful for determining linkage disequilibrium
Introduction. Overview of Bioconductor packages for short read analysis
Overview of Bioconductor packages for short read analysis Introduction General introduction SRAdb Pseudo code (Shortread) Short overview of some packages Quality assessment Example sequencing data in Bioconductor
Guidance for IA DMM: Connecting Your Computer to FSU Video File Server
1 Guidance for IA DMM: Connecting Your Computer to FSU Video File Server This guide will walk you through the process of connecting your computer to the FSU Video File Server and then uploading video files
Dashboard Builder TM for Microsoft Access
Dashboard Builder TM for Microsoft Access Web Edition Application Guide Version 5.3 5.12.2014 This document is copyright 2007-2014 OpenGate Software. The information contained in this document is subject
1. How to install PureFTP on SLES 11
This document is described about how to install and configure PureFTP server in SuSE Linux Enterprise Server 11. 1. How to install PureFTP on SLES 11 2. How to allow Anonymous users to log in to the PureFTP
Basic and most important functions
Work with tariffs Basic and most important functions MikroBill gives you an efficient and clear way how to manage tariffs. You are able to set price, max. speed in/out, aggregation. System supports burst
Bioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
DOMUSBOX. User guide. Index
DOMUSBOX User guide Index Introduction... 2 1. Installing SEAV DOMUS... 4 1.1 Activating DomusBox... 4 1.2Drawing the environments in DomusWeb... 5 1.3Connecting DomusBox to the devices...9 1.4Configuration
To change title of module, click on settings
HTML Module: The most widely used module on the websites. This module is very flexible and is used for inserting text, images, tables, hyperlinks, document downloads, and HTML code. Hover the cursor over
1 ImageBrowser Software Guide
1 ImageBrowser Software Guide Table of Contents (1/2) Chapter 1 Try It! ImageBrowser Starting ImageBrowser -------------------------------------------------- 4 Importing Images to Your Computer ---------------------------------
Access your directories (home directory and shared directories) outside Tilburg University
Access your directories (home directory and shared directories) outside Tilburg University FileZilla offers you the possibility to access your personal M-drive or other network locations through a secure
STATGRAPHICS Online. Statistical Analysis and Data Visualization System. Revised 6/21/2012. Copyright 2012 by StatPoint Technologies, Inc.
STATGRAPHICS Online Statistical Analysis and Data Visualization System Revised 6/21/2012 Copyright 2012 by StatPoint Technologies, Inc. All rights reserved. Table of Contents Introduction... 1 Chapter
Joomla! 2.5.x Training Manual
Joomla! 2.5.x Training Manual Joomla is an online content management system that keeps track of all content on your website including text, images, links, and documents. This manual includes several tutorials
CREATING AND EDITING CONTENT AND BLOG POSTS WITH THE DRUPAL CKEDITOR
Drupal Website CKeditor Tutorials - Adding Blog Posts, Images & Web Pages with the CKeditor module The Drupal CKEditor Interface CREATING AND EDITING CONTENT AND BLOG POSTS WITH THE DRUPAL CKEDITOR "FINDING
Using Microsoft Expression Web to Upload Your Site
Using Microsoft Expression Web to Upload Your Site Using Microsoft Expression Web to Upload Your Web Site This article briefly describes how to use Microsoft Expression Web to connect to your Web server
GeneSifter: Next Generation Data Management and Analysis for Next Generation Sequencing
for Next Generation Sequencing Dale Baskin, N. Eric Olson, Laura Lucas, Todd Smith 1 Abstract Next generation sequencing technology is rapidly changing the way laboratories and researchers approach the
CLC Sequence Viewer USER MANUAL
CLC Sequence Viewer USER MANUAL Manual for CLC Sequence Viewer 7.6.1 Windows, Mac OS X and Linux September 3, 2015 This software is for research purposes only. QIAGEN Aarhus A/S Silkeborgvej 2 Prismet
Xerox 700 Digital Color Press with Integrated Fiery Color Server. Utilities
Xerox 700 Digital Color Press with Integrated Fiery Color Server Utilities 2008 Electronics for Imaging, Inc. The information in this publication is covered under Legal Notices for this product. 45072726
IBI Group FTP: Usage Instructions
IBI Group FTP: Usage Instructions Version: Windows; Last Updated: April 22 nd 2009 There are two IBI Group supported methods for connecting to the FTP site, My Computer and FileZilla Client Software. If
Table of Contents. I. Banner Design Studio Overview... 4. II. Banner Creation Methods... 6. III. User Interface... 8
User s Manual Table of Contents I. Banner Design Studio Overview... 4 II. Banner Creation Methods... 6 a) Create Banners from scratch in 3 easy steps... 6 b) Create Banners from template in 3 Easy Steps...
-> Integration of MAPHiTS in Galaxy
Enabling NGS Analysis with(out) the Infrastructure, 12:0512 Development of a workflow for SNPs detection in grapevine From Sets to Graphs: Towards a Realistic Enrichment Analy species: MAPHiTS -> Integration
Table of Contents File Set Up
Table of Contents File Set Up File Basics Page 2 Setting Up Bleed Page 3 Banner Set Up Pockets and Bleed Page 4-5 Tradeshow Booth File Set Up Page 6 FTP Information Page 7 Scanning, Resolutions and Proofs
Simplifying Data Interpretation with Nexus Copy Number
Simplifying Data Interpretation with Nexus Copy Number A WHITE PAPER FROM BIODISCOVERY, INC. Rapid technological advancements, such as high-density acgh and SNP arrays as well as next-generation sequencing
Assignment #03: Time Management with Excel
Technical Module I Demonstrator: Dereatha Cross [email protected] Assignment #03: Time Management with Excel Introduction Success in any endeavor depends upon time management. One of the optional exercises
Using Internet or Windows Explorer to Upload Your Site
Using Internet or Windows Explorer to Upload Your Site This article briefly describes what an FTP client is and how to use Internet Explorer or Windows Explorer to upload your Web site to your hosting
Next Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
Tutorial. for. HG2F/3F/4F Series Operator Interfaces
Tutorial for HG2F/3F/4F Series Operator Interfaces WindO/I-NV2 Tutorial for HG2F/3F/4F Series Operator Interfaces English Edition 3.0 July 2004 IDEC Corporation 1175 Elko Drive Sunnyvale, CA 94089 Ph:
C-more Remote Access, Data Log, FTP File Transfer, and Email Tutorial
C-more Remote Access, Data Log, FTP File Transfer, and Email Tutorial P a g e 2 Introduction: This script will walk you through the basic process of setting up the remote access, data logging, FTP file
Analyzing the Effect of Treatment and Time on Gene Expression in Partek Genomics Suite (PGS) 6.6: A Breast Cancer Study
Analyzing the Effect of Treatment and Time on Gene Expression in Partek Genomics Suite (PGS) 6.6: A Breast Cancer Study The data for this study is taken from experiment GSE848 from the Gene Expression
Site Maintenance Using Dreamweaver
Site Maintenance Using Dreamweaver As you know, it is possible to transfer the files that make up your web site from your local computer to the remote server using FTP (file transfer protocol) or some
3.5 EXTERNAL NETWORK HDD. User s Manual
3.5 EXTERNAL NETWORK HDD User s Manual Table of Content Before You Use Key Features H/W Installation Illustration of Product LED Definition NETWORK HDD Assembly Setup the Network HDD Home Disk Utility
Podium View TM 2.0 Visual Presenter Image Software User Manual - English (WINDOWS)
Podium View TM 2.0 Visual Presenter Image Software User Manual - English (WINDOWS) Table of Contents 1. Introduction... 2 2. System Requirements... 2 3. Installing Podium View... 3 4. Connection to the
IGV User Guide. User Interface Main Window. This guide describes the Integrative Genomics Viewer (IGV).
IGV User Guide This guide describes the Integrative Genomics Viewer (IGV). To start IGV, go to the IGV downloads page: http://www.broadinstitute.org/igv/download. Look at a printer-friendly HTML version
Virtual Appliance for VMware Server. Getting Started Guide. Revision 2.0.2. Warning and Disclaimer
Virtual Appliance for VMware Server Getting Started Guide Revision 2.0.2 Warning and Disclaimer This document is designed to provide information about the configuration and installation of the CensorNet
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
G E N OM I C S S E RV I C ES
GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E
W3Perl A free logfile analyzer
W3Perl A free logfile analyzer Features Works on Unix / Windows / Mac View last entries based on Perl scripts Web / FTP / Squid / Email servers Session tracking Others log format can be added easily Detailed
ArcGIS online Introduction... 2. Module 1: How to create a basic map on ArcGIS online... 3. Creating a public account with ArcGIS online...
Table of Contents ArcGIS online Introduction... 2 Module 1: How to create a basic map on ArcGIS online... 3 Creating a public account with ArcGIS online... 3 Opening a Map, Adding a Basemap and then Saving
I. Delivery E-mail: Flash CMS template package... 2. II. Flash CMS template installation... 4. III. Control Panel setup... 5
Contents I. Delivery E-mail: Flash CMS template package... 2 II. Flash CMS template installation... 4 III. Control Panel setup... 5 IV. Control Panel activation... 6 Appendix 1: Switching to binary file
How Sequencing Experiments Fail
How Sequencing Experiments Fail v1.0 Simon Andrews [email protected] Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine
Analysis of FFPE DNA Data in CNAG 2.0 A Manual
Analysis of FFPE DNA Data in CNAG 2.0 A Manual Table of Contents: I. Background P.2 II. Installation and Setup a. Download/Install CNAG 2.0 P.3 b. Setup P.4 III. Extract Mapping 500K FFPE Data P.7 IV.
Analyzing microrna Data and Integrating mirna with Gene Expression Data in Partek Genomics Suite 6.6
Analyzing microrna Data and Integrating mirna with Gene Expression Data in Partek Genomics Suite 6.6 Overview This tutorial outlines how microrna data can be analyzed within Partek Genomics Suite. Additionally,
Running and Enhancing your own Galaxy. Daniel Blankenberg The Galaxy Team http://usegalaxy.org
Running and Enhancing your own Galaxy Daniel Blankenberg The Galaxy Team http://usegalaxy.org Overview Where and How you can use and build Galaxy public website local instance on the cloud tool shed/contributing
How to Find High Authority Expired Domains Using Scrapebox
How to Find High Authority Expired Domains Using Scrapebox High authority expired domains are still a powerful tool to have in your SEO arsenal and you re about to learn one way to find them using Scrapebox.
Yale Pseudogene Analysis as part of GENCODE Project
Sanger Center 2009.01.20, 11:20-11:40 Mark B Gerstein Yale Illustra(on from Gerstein & Zheng (2006). Sci Am. (c) Mark Gerstein, 2002, (c) Yale, 1 1Lectures.GersteinLab.org 2007bioinfo.mbb.yale.edu Yale
Using Excel in Research. Hui Bian Office for Faculty Excellence
Using Excel in Research Hui Bian Office for Faculty Excellence Data entry in Excel Directly type information into the cells Enter data using Form Command: File > Options 2 Data entry in Excel Tool bar:
Microarray Data Analysis. A step by step analysis using BRB-Array Tools
Microarray Data Analysis A step by step analysis using BRB-Array Tools 1 EXAMINATION OF DIFFERENTIAL GENE EXPRESSION (1) Objective: to find genes whose expression is changed before and after chemotherapy.
Getting Started with KompoZer
Getting Started with KompoZer Contents Web Publishing with KompoZer... 1 Objectives... 1 UNIX computer account... 1 Resources for learning more about WWW and HTML... 1 Introduction... 2 Publishing files
#mstrworld. No Data Left behind: 20+ new data sources with new data preparation in MicroStrategy 10
No Data Left behind: 20+ new data sources with new data preparation in MicroStrategy 10 MicroStrategy Analytics Agenda Product Workflows Different Data Import Processes Product Demonstrations Data Preparation
EXCEL PIVOT TABLE David Geffen School of Medicine, UCLA Dean s Office Oct 2002
EXCEL PIVOT TABLE David Geffen School of Medicine, UCLA Dean s Office Oct 2002 Table of Contents Part I Creating a Pivot Table Excel Database......3 What is a Pivot Table...... 3 Creating Pivot Tables
WS_FTP Professional 12
WS_FTP Professional 12 Tools Guide Contents CHAPTER 1 Introduction Ways to Automate Regular File Transfers...5 Check Transfer Status and Logs...6 Building a List of Files for Transfer...6 Transfer Files
