DNA Insertions and Deletions in the Human Genome. Philipp W. Messer

Size: px
Start display at page:

Download "DNA Insertions and Deletions in the Human Genome. Philipp W. Messer"

Transcription

1 DNA Insertions and Deletions in the Human Genome Philipp W. Messer

2 Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3. DNA insertions / deletions (indels)

3 Outline 1. Origin and characteristics of indels 2. Indels in protein-coding regions 3. Duplications and genomic correlations 4. Duplications and alignment scores

4 Part 1 Origin and Characteristics of Indels in the Human Genome [Messer and Arndt, Mol Biol Evol 2007]

5 Identifying Insertions/Deletions Time ~5 Myr Human Chimp Rhesus High-quality flanks H:..ATACCTCGTACAATAGCGCTGGTACAGATA.. C:..ATACCTCGTACAAT--CGCTGGTACAGGTA.. R:..ATACCTCGTACAAT--CGCTGCTACAGATA.. Insertions can be distinguished from deletions (parsimony)

6 Insertion/Deletion Statistics Insertions: ~ events 15% SSR Deletions: ~ events 5% SSR

7 Molecular Mechanisms 1. Unequal Crossing Over (UCO) nonhomologous recombination 2. Replication Slippage (RS) slipped-strand mispairing

8 Indel Signatures for UCO and RS Insertions: Tandem duplications of preexisting duplicates Deletions: Remove one copy of preexisting duplicates

9 trace extension d insertion length l

10 Indel Trace Extensions UCO, RS (insertion) UCO, RS (deletion) Tandem duplication Random indel

11 Measured Trace Extensions (l=8 bp)

12 Chromosomal Rate Differences 800 Rates (bp / Mbp) Autosomes Chr X Chr Y 0 Insertions Deletions 1. Indels occur preferentially in the male germline 2. Indels are not recombination-mediated

13 Indel Characteristics 1. The majority of insertions are tandem duplications 2. Long preexisting duplicates are often missing 3. Indels occur preferentially in the male germline 4. Indels are not recombination-mediated

14 Nonhomologous End Joining DNA break End joining Small or no homology required Filling in of single strands

15 Part 2 Indels in Protein-coding Regions of the Human Genome [Chaux, Messer, Arndt, BMC Evol Biol (submitted)]

16 Indel Rates in Coding Regions

17 Genetic Code

18 Inserted/Deleted Amino Acids

19 Physico-chemical Properties

20 Physico-chemical Properties suppressed intensified

21 Protein Secondary Structure suppressed

22 Part 3 Tandem Duplications and Genomic Correlations [Messer, Arndt, Lässig, Phys Rev Lett 2005] [Messer, Lässig, Arndt, J Stat Mech 2005] [Messer, Arndt, Nucleic Acid Res 2006]

23 Sequence Evolution Model Mutation Segmental Duplication length l A C A A G T C C A rate µ rate δ l A T A A G T C C AGA T C C A Random Insertion Segmental Deletion length l A T T G T C C A rate γ l + rate γ l - A GA G A C T T A length l

24 The Correlation Function Measures likelihood of finding two G/C base pairs separated by a distance r along the genome ( ) = (, + ) 2 ( ) C r P x x r P x G/C G/C G T A T G A T C G A G A A Position: x x+r

25 Types of Correlation Behavior Random sequence Local correlations Long-range correlations Cr () 0 ( r r) Cr () exp / 0 Cr () r α Noise fluctuations Characteristic scale Generated e.g by Markov-processes Scale free, fractal Generated by a nontrivial dynamical model

26 Calculation of C(r) for Our Model Approach: continuous time Master Equation formalism Exact equation for the dynamics of C(r) Stationary solution in a continuum limit: C( r) r α with α = 4µ eff λ

27 Correlations in Genomic DNA Cr () r α distance r distance r correlation C(r) correlation C(r)

28

29 Part 4 Tandem Duplications and Alignment Score Statistics [Messer, Bundschuh, Vingron, Arndt, RECOMB 2006] [Messer, Bundschuh, Vingron, Arndt, JCB 2007]

30 Alignment Score Statistics Sequence alignment Seq1: ACCTAGTGCTA Significance Seq2: ATCTAGTGATA P-values of scores Requires DNA null model Standard iid model Problem Score distribution in the null model iid model correlated model Correlations in DNA Incorporate into null model P-values change e λs

31 Gaussian Approximation Analytic approach to calculate alignment score statistics for null models with LRC sequences, i.e. C(r) r -α 2 s λ = σ 2 + c ζ (2 α ) vanishes for iid sequences LRC s increases probability of finding high alignment scores by chance

32 Numerical Verification Score distribution Decay parameter λ lrc (α=0.5) lrc (α=1.0) iid Gaussian approximation captures qualitative behavior

33 Biological Significance Alignment of random sequences with same correlation parameters as human chr. 22 λ iid 1.37 λ lrc 1.21 P lrc 3x10-5 P iid 2x10-6 Difference in λ is approx.16 %, p-value increase > 10 x

34 Summary 1. The majority of short DNA insertions are tandem duplications 2. Amino acid insertions/deletions are less deleterious than substitutions 3. Tandem duplications cause long-range correlations in genomic base composition 4. These correlations have profound impact on the statistics of sequence alignment scores

35 Acknowledgments Peter Arndt Nicole de la Chaux Paz Polak Federico Squartini Ralf Bundschuh Michael Lässig Martin Vingron

Innovations in Molecular Epidemiology

Innovations in Molecular Epidemiology Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether

More information

Pairwise Sequence Alignment

Pairwise Sequence Alignment Pairwise Sequence Alignment [email protected] SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What

More information

Chapter 6 DNA Replication

Chapter 6 DNA Replication Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University [email protected] http://tandem.bu.edu/ The Human Genome Project took

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations

Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations AlCoB 2014 First International Conference on Algorithms for Computational Biology Thiago da Silva Arruda Institute

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS

More information

Activity IT S ALL RELATIVES The Role of DNA Evidence in Forensic Investigations

Activity IT S ALL RELATIVES The Role of DNA Evidence in Forensic Investigations Activity IT S ALL RELATIVES The Role of DNA Evidence in Forensic Investigations SCENARIO You have responded, as a result of a call from the police to the Coroner s Office, to the scene of the death of

More information

European Medicines Agency

European Medicines Agency European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein

More information

Introduction to Phylogenetic Analysis

Introduction to Phylogenetic Analysis Subjects of this lecture Introduction to Phylogenetic nalysis Irit Orr 1 Introducing some of the terminology of phylogenetics. 2 Introducing some of the most commonly used methods for phylogenetic analysis.

More information

Genomes and SNPs in Malaria and Sickle Cell Anemia

Genomes and SNPs in Malaria and Sickle Cell Anemia Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

Bob Jesberg. Boston, MA April 3, 2014

Bob Jesberg. Boston, MA April 3, 2014 DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double

More information

Sequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment

Sequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment Sequence Analysis 15: lecture 5 Substitution matrices Multiple sequence alignment A teacher's dilemma To understand... Multiple sequence alignment Substitution matrices Phylogenetic trees You first need

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

Localised Sex, Contingency and Mutator Genes. Bacterial Genetics as a Metaphor for Computing Systems

Localised Sex, Contingency and Mutator Genes. Bacterial Genetics as a Metaphor for Computing Systems Localised Sex, Contingency and Mutator Genes Bacterial Genetics as a Metaphor for Computing Systems Outline Living Systems as metaphors Evolutionary mechanisms Mutation Sex and Localized sex Contingent

More information

escience and Post-Genome Biomedical Research

escience and Post-Genome Biomedical Research escience and Post-Genome Biomedical Research Thomas L. Casavant, Adam P. DeLuca Departments of Biomedical Engineering, Electrical Engineering and Ophthalmology Coordinated Laboratory for Computational

More information

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Focusing on results not data comprehensive data analysis for targeted next generation sequencing Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

MUTATION, DNA REPAIR AND CANCER

MUTATION, DNA REPAIR AND CANCER MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful

More information

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized: Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How

More information

MATCH Commun. Math. Comput. Chem. 61 (2009) 781-788

MATCH Commun. Math. Comput. Chem. 61 (2009) 781-788 MATCH Communications in Mathematical and in Computer Chemistry MATCH Commun. Math. Comput. Chem. 61 (2009) 781-788 ISSN 0340-6253 Three distances for rapid similarity analysis of DNA sequences Wei Chen,

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

Chapter 13: Meiosis and Sexual Life Cycles

Chapter 13: Meiosis and Sexual Life Cycles Name Period Chapter 13: Meiosis and Sexual Life Cycles Concept 13.1 Offspring acquire genes from parents by inheriting chromosomes 1. Let s begin with a review of several terms that you may already know.

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Replication Study Guide

Replication Study Guide Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have

More information

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each

More information

Genetics Test Biology I

Genetics Test Biology I Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.

More information

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme. Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.

More information

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh

More information

Human Genome and Human Genome Project. Louxin Zhang

Human Genome and Human Genome Project. Louxin Zhang Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular

More information

Practice Problems 4. (a) 19. (b) 36. (c) 17

Practice Problems 4. (a) 19. (b) 36. (c) 17 Chapter 10 Practice Problems Practice Problems 4 1. The diploid chromosome number in a variety of chrysanthemum is 18. What would you call varieties with the following chromosome numbers? (a) 19 (b) 36

More information

Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003

Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Similarity Searches on Sequence Databases: BLAST, FASTA Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Outline Importance of Similarity Heuristic Sequence Alignment:

More information

Becker Muscular Dystrophy

Becker Muscular Dystrophy Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency

More information

α α λ α = = λ λ α ψ = = α α α λ λ ψ α = + β = > θ θ β > β β θ θ θ β θ β γ θ β = γ θ > β > γ θ β γ = θ β = θ β = θ β = β θ = β β θ = = = β β θ = + α α α α α = = λ λ λ λ λ λ λ = λ λ α α α α λ ψ + α =

More information

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns

More information

DnaSP, DNA polymorphism analyses by the coalescent and other methods.

DnaSP, DNA polymorphism analyses by the coalescent and other methods. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Author affiliation: Julio Rozas 1, *, Juan C. Sánchez-DelBarrio 2,3, Xavier Messeguer 2 and Ricardo Rozas 1 1 Departament de Genètica,

More information

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur

More information

Mechanisms of Evolution

Mechanisms of Evolution page 2 page 3 Teacher's Notes Mechanisms of Evolution Grades: 11-12 Duration: 28 mins Summary of Program Evolution is the gradual change that can be seen in a population s genetic composition, from one

More information

BioBoot Camp Genetics

BioBoot Camp Genetics BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before

More information

Comparative genomic hybridization Because arrays are more than just a tool for expression analysis

Comparative genomic hybridization Because arrays are more than just a tool for expression analysis Microarray Data Analysis Workshop MedVetNet Workshop, DTU 2008 Comparative genomic hybridization Because arrays are more than just a tool for expression analysis Carsten Friis ( with several slides from

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?

4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true? Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.

More information

An example of bioinformatics application on plant breeding projects in Rijk Zwaan

An example of bioinformatics application on plant breeding projects in Rijk Zwaan An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on

More information

Protein & DNA Sequence Analysis. Bobbie-Jo Webb-Robertson May 3, 2004

Protein & DNA Sequence Analysis. Bobbie-Jo Webb-Robertson May 3, 2004 Protein & DNA Sequence Analysis Bobbie-Jo Webb-Robertson May 3, 2004 Sequence Analysis Anything connected to identifying higher biological meaning out of raw sequence data. 2 Genomic & Proteomic Data Sequence

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

Human Genome Organization: An Update. Genome Organization: An Update

Human Genome Organization: An Update. Genome Organization: An Update Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion

More information

AP BIOLOGY 2010 SCORING GUIDELINES (Form B)

AP BIOLOGY 2010 SCORING GUIDELINES (Form B) AP BIOLOGY 2010 SCORING GUIDELINES (Form B) Question 2 Certain human genetic conditions, such as sickle cell anemia, result from single base-pair mutations in DNA. (a) Explain how a single base-pair mutation

More information

Bio-Informatics Lectures. A Short Introduction

Bio-Informatics Lectures. A Short Introduction Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination

More information

LECTURE 6 Gene Mutation (Chapter 16.1-16.2)

LECTURE 6 Gene Mutation (Chapter 16.1-16.2) LECTURE 6 Gene Mutation (Chapter 16.1-16.2) 1 Mutation: A permanent change in the genetic material that can be passed from parent to offspring. Mutant (genotype): An organism whose DNA differs from the

More information

Lecture 2: Mitosis and meiosis

Lecture 2: Mitosis and meiosis Lecture 2: Mitosis and meiosis 1. Chromosomes 2. Diploid life cycle 3. Cell cycle 4. Mitosis 5. Meiosis 6. Parallel behavior of genes and chromosomes Basic morphology of chromosomes telomere short arm

More information

MAKING AN EVOLUTIONARY TREE

MAKING AN EVOLUTIONARY TREE Student manual MAKING AN EVOLUTIONARY TREE THEORY The relationship between different species can be derived from different information sources. The connection between species may turn out by similarities

More information

Rapid alignment methods: FASTA and BLAST. p The biological problem p Search strategies p FASTA p BLAST

Rapid alignment methods: FASTA and BLAST. p The biological problem p Search strategies p FASTA p BLAST Rapid alignment methods: FASTA and BLAST p The biological problem p Search strategies p FASTA p BLAST 257 BLAST: Basic Local Alignment Search Tool p BLAST (Altschul et al., 1990) and its variants are some

More information

Gene Therapy and Genetic Counseling. Chapter 20

Gene Therapy and Genetic Counseling. Chapter 20 Gene Therapy and Genetic Counseling Chapter 20 What is Gene Therapy? Treating a disease by replacing, manipulating or supplementing a gene The act of changing an individual s DNA sequence to fix a non-functional

More information

Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS

Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS Period Date REGENTS REVIEW: PROTEIN SYNTHESIS 1. The diagram at the right represents a portion of a type of organic molecule present in the cells of organisms. What will most likely happen if there is

More information

GenBank: A Database of Genetic Sequence Data

GenBank: A Database of Genetic Sequence Data GenBank: A Database of Genetic Sequence Data Computer Science 105 Boston University David G. Sullivan, Ph.D. An Explosion of Scientific Data Scientists are generating ever increasing amounts of data. Relevant

More information

Biological Sequence Data Formats

Biological Sequence Data Formats Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

Amino Acids and Their Properties

Amino Acids and Their Properties Amino Acids and Their Properties Recap: ss-rrna and mutations Ribosomal RNA (rrna) evolves very slowly Much slower than proteins ss-rrna is typically used So by aligning ss-rrna of one organism with that

More information

The Human Genome Project

The Human Genome Project The Human Genome Project Brief History of the Human Genome Project Physical Chromosome Maps Genetic (or Linkage) Maps DNA Markers Sequencing and Annotating Genomic DNA What Have We learned from the HGP?

More information

GenBank, Entrez, & FASTA

GenBank, Entrez, & FASTA GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,

More information

Biological Sciences Initiative. Human Genome

Biological Sciences Initiative. Human Genome Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.

More information

SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE

SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,

More information

FREQUENTLY ASKED QUESTIONS ABOUT ADMISSIONS TO THE MS HUMAN GENETICS AND GENETIC COUNSELING PROGRAM Updated September 2015

FREQUENTLY ASKED QUESTIONS ABOUT ADMISSIONS TO THE MS HUMAN GENETICS AND GENETIC COUNSELING PROGRAM Updated September 2015 FREQUENTLY ASKED QUESTIONS ABOUT ADMISSIONS TO THE MS HUMAN GENETICS AND GENETIC COUNSELING PROGRAM Updated September 2015 General questions about applications and the program 1. Q: Can I apply for winter

More information

SNP Essentials The same SNP story

SNP Essentials The same SNP story HOW SNPS HELP RESEARCHERS FIND THE GENETIC CAUSES OF DISEASE SNP Essentials One of the findings of the Human Genome Project is that the DNA of any two people, all 3.1 billion molecules of it, is more than

More information

Linear Sequence Analysis. 3-D Structure Analysis

Linear Sequence Analysis. 3-D Structure Analysis Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical properties Molecular weight (MW), isoelectric point (pi), amino acid content, hydropathy (hydrophilic

More information

Commonly Used STR Markers

Commonly Used STR Markers Commonly Used STR Markers Repeats Satellites 100 to 1000 bases repeated Minisatellites VNTR variable number tandem repeat 10 to 100 bases repeated Microsatellites STR short tandem repeat 2 to 6 bases repeated

More information

Gene mutation and molecular medicine Chapter 15

Gene mutation and molecular medicine Chapter 15 Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: [email protected]

PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,

More information

Chapter 5: Organization and Expression of Immunoglobulin Genes

Chapter 5: Organization and Expression of Immunoglobulin Genes Chapter 5: Organization and Expression of Immunoglobulin Genes I. Genetic Model Compatible with Ig Structure A. Two models for Ab structure diversity 1. Germ-line theory: maintained that the genome contributed

More information

HYPOTHESIS TESTING: POWER OF THE TEST

HYPOTHESIS TESTING: POWER OF THE TEST HYPOTHESIS TESTING: POWER OF THE TEST The first 6 steps of the 9-step test of hypothesis are called "the test". These steps are not dependent on the observed data values. When planning a research project,

More information

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

Towards Integrating the Detection of Genetic Variants into an In-Memory Database

Towards Integrating the Detection of Genetic Variants into an In-Memory Database Towards Integrating the Detection of Genetic Variants into an 2nd International Workshop on Big Data in Bioinformatics and Healthcare Oct 27, 2014 Motivation Genome Data Analysis Process DNA Sample Base

More information

MORPHEUS. http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix.

MORPHEUS. http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix. MORPHEUS http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix. Reference: MORPHEUS, a Webtool for Transcripton Factor Binding Analysis Using

More information

Genetomic Promototypes

Genetomic Promototypes Genetomic Promototypes Mirkó Palla and Dana Pe er Department of Mechanical Engineering Clarkson University Potsdam, New York and Department of Genetics Harvard Medical School 77 Avenue Louis Pasteur Boston,

More information

Answer Key Problem Set 5

Answer Key Problem Set 5 7.03 Fall 2003 1 of 6 1. a) Genetic properties of gln2- and gln 3-: Answer Key Problem Set 5 Both are uninducible, as they give decreased glutamine synthetase (GS) activity. Both are recessive, as mating

More information

Models of Switching in Biophysical Contexts

Models of Switching in Biophysical Contexts Models of Switching in Biophysical Contexts Martin R. Evans SUPA, School of Physics and Astronomy, University of Edinburgh, U.K. March 7, 2011 Collaborators: Paolo Visco (MSC, Paris) Rosalind J. Allen

More information

Genetics Lecture Notes 7.03 2005. Lectures 1 2

Genetics Lecture Notes 7.03 2005. Lectures 1 2 Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

PRACTICE TEST QUESTIONS

PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

Milk protein genetic variation in Butana cattle

Milk protein genetic variation in Butana cattle Milk protein genetic variation in Butana cattle Ammar Said Ahmed Züchtungsbiologie und molekulare Genetik, Humboldt Universität zu Berlin, Invalidenstraβe 42, 10115 Berlin, Deutschland 1 Outline Background

More information

Worksheet - COMPARATIVE MAPPING 1

Worksheet - COMPARATIVE MAPPING 1 Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that

More information

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

Protein Prospector and Ways of Calculating Expectation Values

Protein Prospector and Ways of Calculating Expectation Values Protein Prospector and Ways of Calculating Expectation Values 1/16 Aenoch J. Lynn; Robert J. Chalkley; Peter R. Baker; Mark R. Segal; and Alma L. Burlingame University of California, San Francisco, San

More information

Chapter 13: Meiosis and Sexual Life Cycles

Chapter 13: Meiosis and Sexual Life Cycles Name Period Concept 13.1 Offspring acquire genes from parents by inheriting chromosomes 1. Let s begin with a review of several terms that you may already know. Define: gene locus gamete male gamete female

More information

Umm AL Qura University MUTATIONS. Dr Neda M Bogari

Umm AL Qura University MUTATIONS. Dr Neda M Bogari Umm AL Qura University MUTATIONS Dr Neda M Bogari CONTACTS www.bogari.net http://web.me.com/bogari/bogari.net/ From DNA to Mutations MUTATION Definition: Permanent change in nucleotide sequence. It can

More information

On Covert Data Communication Channels Employing DNA Steganography with Application in Massive Data Storage

On Covert Data Communication Channels Employing DNA Steganography with Application in Massive Data Storage ARAB ACADEMY FOR SCIENCE, TECHNOLOGY AND MARITIME TRANSPORT COLLEGE OF ENGINEERING AND TECHNOLOGY COMPUTER ENGINEERING DEPARTMENT On Covert Data Communication Channels Employing DNA Steganography with

More information

Fact Sheet 14 EPIGENETICS

Fact Sheet 14 EPIGENETICS This fact sheet describes epigenetics which refers to factors that can influence the way our genes are expressed in the cells of our body. In summary Epigenetics is a phenomenon that affects the way cells

More information