Final Project Report
|
|
|
- Wesley Lang
- 9 years ago
- Views:
Transcription
1 CPSC545 by Introduction to Data Mining Prof. Martin Schultz & Prof. Mark Gerstein Student Name: Yu Kor Hugo Lam Student ID : Due Date : May 7, 2007 Introduction Final Project Report Pseudogenes are dead genes that apparently have no functions. They originate from genes that once functional. Due to certain kinds of mutation and sequence rearrangement, these genes are disabled and cannot be transcribed or translated into any functional molecules. There are two main types of pseudogenes, they are processed pseudogenes and duplicated pseudogenes. Processed pseudogenes are pseudogenes that are generated by retrotransposition. Duplicated pseudogenes are pseudogenes that are generated by gene duplication and mutation. Retrotransposition is a process that reverse transcribes an mrna, or a portion of it, back into the DNA. Normally, the mrna transcribed from the DNA will be translated into a protein. However, there are also times that it will be retrotransposed into the DNA. Because the mrna being retrotransposed is usually mature, having the introns spliced out, a Poly-A tail, and most importantly lacking a promoter, it becomes non-functional even though it is integrated back into the DNA. As a result, it becomes a processed pseudogene. Duplicated pseudogene arises from a different mechanism, gene duplication, which is common and important in the evolution of genomes. Gene duplication usually occurs as a result of an error in homologous recombination. Since the duplicated gene oftentimes has no selective pressure, its mutation happens faster and much more freely if comparing to a single-copy gene. When a mutation disables the function of the duplicate, it becomes a non-functional pseudogene, which may have introns and promoter, but usually does not have much impact. Although pseudogenes are not functional, or not functioning like a normal gene does, studying pseudogenes is not trivial. For instances, it gives us hints about life histories like a fossil record; some of them seem to be actively transcribed and may involve in calibrating the genome; some can be converted back into a functional gene through mutations; and it improves gene annotation.
2 Therefore, researchers have been developing different techniques to identify, classify and annotate pseudogenes. PseudoPipe developed at Gerstein Lab at Yale is a case in point. It is an automated pseudogene identification pipeline that involves using BLAST to rapidly cross reference potential parent proteins against the intergenic regions of the genome, processing the resulting hits, and classifying the pseudogenes based on a combination of criteria including intron-exon structure, existence of stop codons, frameshifts and etc. Goal PseudoPipe classifies pseudogenes as Processed Pseudogene, Duplicated Pseudogene, and Pseudogene Fragment. Basically, if a pseudogene has more than one exon, it will be classified as duplicated pseudogene. If it has one exon and spans 70% the parent or more, it will be classified as processed pseudogene. Otherwise, if it spans less than 70%, it will be classified as pseudogene fragment, which means it cannot be determined as either a processed pseudogene or a duplicated pseudogene. The goal of this project is first to reproduce the classification model to see if the data conform to these criteria, second to identify any clusters among the pseudogenes, and then to train a model to predict the types of those pseudogene fragments. Method Data Source The pseudogene dataset was retrieved from PseudoPipe ( and the data corresponding to processed pseudogene, duplicated pseudogene, and pseudogene fragment were extracted. The attributes of the data are as follows:
3 Tools Weka was used to carry out the data mining tasks. It is an open-source software with a collection of machine learning algorithms for data mining. It has a GUI to apply the algorithms directly to a dataset and a set of API for writing custom code. It also contains tools for data pre-processing, classification, regression, clustering, association rules, and visualization. R, a free software environment for statistical computing and graphics, was used to process the data generated from Weka and to generate those graphs that are not available in Weka. And ScatterPlot3D, a library package in R which plots a three dimensional (3D) point cloud, was used to plot the clustering result in 3D. Decision Tree Decision tree, a.k.a. classification tree and reduction tree, was used to reproduce the pseudogene classification model. In a decision tree in data mining, leaves represent classifications and branches represent conjunctions of features that lead to those classifications. It is a supervised approach to classification and its implementation in Weka is called J48. The algorithm can be summarized as follows: 1. Create a node and choose an attribute that best separates the data. 2. Create a branch for each value or each set of values of the node s attribute 3. Assign the data to different branches according to the attribute values of the branches 4. For each branch, a. if all members have the same class, terminate and label it with that class b. if it has no further distinguishing attributes, label it with the major class in it 5. For each branch that has not been labeled, repeat the process K-means K-means, following the attribute selection by Principle Component Analysis (PCA) which will be discussed later, was used to cluster the pseudogenes. It is one of the simplest unsupervised learning algorithms that solve clustering problem. It clusters the objects based on their attributes into k groups. The idea is to find the centers of the k clusters. However, it assumes that k is known in advance. Following is the summary of the algorithm:
4 1. Place K points into the space represented by the objects that are being clustered. These points represent initial group centroids 2. Assign each object to the group that has the closest centroid 3. When all objects have been assigned, recalculate the positions of the K centroids. 4. Repeat Steps 2 and 3 until the centroids no longer move. This produces a separation of the objects into groups from which the metric to be minimized can be calculated. Principle Component Analysis A common weakness of clustering is that it depends pretty much on visualizing the obtained clusters. However, visualizing high dimensional data directly is technically impossible. PCA, principle component analysis, can transform the data to a new coordinate system such that the greatest variance by any projection of the data comes to lie on the first coordinate (called the first principal component), the second greatest variance on the second coordinate, and so on. Therefore, the PCA procedure was applied to the pseudogene data as an attribute selection process. Then the k-means algorithm was applied to the data in the new feature space. The algorithm of PCA is as follows: 1. Subtract the mean from each of the data dimensions. The mean subtracted is the average across each dimension. 2. Calculate the covariance matrix. That is all possible covariance values between all the different dimensions. 3. Calculate the eigenvectors and eigenvalues of the covariance matrix, which is also a square matrix. 4. Order the eigenvectors by their eigenvalues, from highest to lowest. This gives the components in order of significance. 5. Derive the new data set by multiplying the eigenvectors with the original data set. Bayesian Network A Bayesian Network is a directed acyclic graph that contains nodes and arcs in which the nodes represent the variables and the arcs encode the conditional dependencies. Probabilistic inference could be carried out by computing the posterior distribution of variables given the evidence. It was chosen to create a probabilistic model to predict the types of the pseudogene fragments.
5 Results Getting and preprocessing the data The pseudogene data set, which contains 27,763 records, was generated by the PseudoPipe. Data corresponding to processed pseudogene, duplicated pseudogene, and pseudogene fragment were extracted, which resulted in a data set having 21,258 records. Records of the pseudogene fragments were removed for training the Bayes Net. Moreover, a set of attributes were selected for PCA and Bayes Net. Details will be discussed later. Following shows a portion of the data and the distribution of the data: Processed Duplicated Fragments
6 Reproducing the pseudogene classification model As mentioned in the method section, decision tree was used to reproduce the pseudogene classification model. Except for the class attribute which specifies the type of the pseudogenes, all other attributes, such as number of insertion, number of deletion, and number of frameshifts, were used to build the decision tree model. The whole data set was used as a training set and a 10-fold cross validation was used to validate the model. Following shows the result: The result shows that there were 21,258 instances correctly classified and 0 instance incorrectly classified. The resulted decision tree has a final size of five and consists of two nodes and three leaves. The root node is NumExons, which is the number of exons. When the number of exons is greater than 1, the instance will be classified as Duplicated, which is Duplicated Pseudogene. When the number of exons is less than or equal to 1, it comes to a child decision node Frac, which is the fraction of parent spanned by the pseudogene. If the instance spans 70% or more its parent, it will be classified as Processed, which is Processed Pseudogene. Otherwise, if it spans less than 70% of its parent, it will then be classified as Fragment, which is Pseudogene Fragment. The decision tree generated on the data successfully reproduced the pseudogene classification model which we already discussed in the previous section. The tree is clean and accurately represents the model underlying the data.
7 Selecting attributes for clustering Principle Components Analysis was used to select attributes for the clustering because it enhances visualization of the high dimensional data and the order of the components, each contains a set of the attributes, to certain extent represents their significance. Before the analysis, a subset of the attributes was chosen to reduce the dimension of the data and so the complexity of the analysis. The chosen attributes were QueryLength, Frac, NumIns, NumDels, NumShifts, NumStops, PcIdent, PolyA, Disable, and NumExons. After the analysis, there were 9 principle components generated and all of them were selected to transform the original data. The figure below shows the plot of the second principle component against the first principle component:
8 Clustering in the new feature space After the attribute selection process, the original data was transformed by the principle components and a K-means clustering was performed in the new feature space. By visualizing the previous plot of the second principle component against the first principle component, it can be seen that there could be 2 clusters in the feature space. As a result, k was set to 2 in the clustering. Following shows the result of the clustering: Figure on the left shows the data of the processed pseudogenes (blue), duplicated pseudogenes (red), and pseudogene fragments (green) plotted in 3D by the first three principle components. Figure on the right shows the data of cluster 1 (red) and cluster 2 (blue). From the patterns shown in the figures, it is very likely that cluster 1 represents duplicated pseudogenes and cluster 2 represents processed pseudogenes. However, these two clusters do not seem to represent the clusters visualized (see the arrows). And by removing the attribute Disable, these two visualized clusters disappeared. So they probably represent a group of pseudogenes having disablement and a group without disablement. And after removing the attribute PolyA, which probably accounted for 4 clusters in several other PCA plots, no observable clusters could be identified.
9 Building a prediction model The previous result showed that the clusters identified by K-means could be potentially used to predict the types of pseudogene fragments. However, a supervised learning technique may be more suitable to build such a model, given that our classification of processed pseudogenes and duplicated pseudogenes is significant. Bayesian Network was chosen to build a probabilistic prediction model for pseudogene fragments. The training data set was the original data set with the data of pseudogene fragments being removed. The attributes used in building the model were same as the attributes used in PCA, except that the NumExons and Frac attributes were removed since the information of these two attributes in the pseudogene fragments is weak. Following shows the Bayes Net trained by the data set aforementioned: The model has a 10-fold cross validation and the result shows that it correctly classified 14,293 instances (93.3%) and incorrectly classified 1,031 instances (6.7%). It has a 0.95 precision and recall, a true positive rate of 0.953, and a false positive rate of for classifying processed pseudogenes. And for duplicated pseudogenes, it has 0.88 precision and recall, a true positive rate of and a false positive rate of The prediction model for pseudogene fragments based on the Bayesian Network and the pseudogene data set shows a relatively high accuracy in classifying processed pseudogenes and duplicated pseduogenes.
10 Conclusion The decision tree model successfully reproduced the pseudogene classification model from the date set generated by the PseudoPipe system. The K-means clustering on the data transformed into principle components identified two clusters, which could be labeled as processed pseudogene and duplicated pseudogene. However, no observable and unknown clusters have been identified in this investigation. And by using Bayesian Network, a highly accurate prediction model for predicting the types of pseudogene fragments has been built. References Literatures Gerstein, M & Zheng, D. The real life of pseudogenes. Sci Am 295: (2006). Zhang, Z, Carriero, N, Zheng, D, Karro, J, Harrison, PM & Gerstein, M. PseudoPipe: an automated pseudogene identification pipeline. Bioinformatics 22: (2006). Websites
Yale Pseudogene Analysis as part of GENCODE Project
Sanger Center 2009.01.20, 11:20-11:40 Mark B Gerstein Yale Illustra(on from Gerstein & Zheng (2006). Sci Am. (c) Mark Gerstein, 2002, (c) Yale, 1 1Lectures.GersteinLab.org 2007bioinfo.mbb.yale.edu Yale
How To Cluster
Data Clustering Dec 2nd, 2013 Kyrylo Bessonov Talk outline Introduction to clustering Types of clustering Supervised Unsupervised Similarity measures Main clustering algorithms k-means Hierarchical Main
Introduction to Data Mining
Introduction to Data Mining Jay Urbain Credits: Nazli Goharian & David Grossman @ IIT Outline Introduction Data Pre-processing Data Mining Algorithms Naïve Bayes Decision Tree Neural Network Association
Facebook Friend Suggestion Eytan Daniyalzade and Tim Lipus
Facebook Friend Suggestion Eytan Daniyalzade and Tim Lipus 1. Introduction Facebook is a social networking website with an open platform that enables developers to extract and utilize user information
Social Media Mining. Data Mining Essentials
Introduction Data production rate has been increased dramatically (Big Data) and we are able store much more data than before E.g., purchase data, social media data, mobile phone data Businesses and customers
An Introduction to Data Mining
An Introduction to Intel Beijing [email protected] January 17, 2014 Outline 1 DW Overview What is Notable Application of Conference, Software and Applications Major Process in 2 Major Tasks in Detail
International Journal of Computer Science Trends and Technology (IJCST) Volume 2 Issue 3, May-Jun 2014
RESEARCH ARTICLE OPEN ACCESS A Survey of Data Mining: Concepts with Applications and its Future Scope Dr. Zubair Khan 1, Ashish Kumar 2, Sunny Kumar 3 M.Tech Research Scholar 2. Department of Computer
Introduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
Analytics on Big Data
Analytics on Big Data Riccardo Torlone Università Roma Tre Credits: Mohamed Eltabakh (WPI) Analytics The discovery and communication of meaningful patterns in data (Wikipedia) It relies on data analysis
Master's projects at ITMO University. Daniil Chivilikhin PhD Student @ ITMO University
Master's projects at ITMO University Daniil Chivilikhin PhD Student @ ITMO University General information Guidance from our lab's researchers Publishable results 2 Research areas Research at ITMO Evolutionary
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
Performance Metrics for Graph Mining Tasks
Performance Metrics for Graph Mining Tasks 1 Outline Introduction to Performance Metrics Supervised Learning Performance Metrics Unsupervised Learning Performance Metrics Optimizing Metrics Statistical
Prof. Pietro Ducange Students Tutor and Practical Classes Course of Business Intelligence 2014 http://www.iet.unipi.it/p.ducange/esercitazionibi/
Prof. Pietro Ducange Students Tutor and Practical Classes Course of Business Intelligence 2014 http://www.iet.unipi.it/p.ducange/esercitazionibi/ Email: [email protected] Office: Dipartimento di Ingegneria
T-61.3050 : Email Classification as Spam or Ham using Naive Bayes Classifier. Santosh Tirunagari : 245577
T-61.3050 : Email Classification as Spam or Ham using Naive Bayes Classifier Santosh Tirunagari : 245577 January 20, 2011 Abstract This term project gives a solution how to classify an email as spam or
Gene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
A Demonstration of Hierarchical Clustering
Recitation Supplement: Hierarchical Clustering and Principal Component Analysis in SAS November 18, 2002 The Methods In addition to K-means clustering, SAS provides several other types of unsupervised
Data Mining Algorithms Part 1. Dejan Sarka
Data Mining Algorithms Part 1 Dejan Sarka Join the conversation on Twitter: @DevWeek #DW2015 Instructor Bio Dejan Sarka ([email protected]) 30 years of experience SQL Server MVP, MCT, 13 books 7+ courses
Unsupervised and supervised dimension reduction: Algorithms and connections
Unsupervised and supervised dimension reduction: Algorithms and connections Jieping Ye Department of Computer Science and Engineering Evolutionary Functional Genomics Center The Biodesign Institute Arizona
Supervised Feature Selection & Unsupervised Dimensionality Reduction
Supervised Feature Selection & Unsupervised Dimensionality Reduction Feature Subset Selection Supervised: class labels are given Select a subset of the problem features Why? Redundant features much or
Comparison of Non-linear Dimensionality Reduction Techniques for Classification with Gene Expression Microarray Data
CMPE 59H Comparison of Non-linear Dimensionality Reduction Techniques for Classification with Gene Expression Microarray Data Term Project Report Fatma Güney, Kübra Kalkan 1/15/2013 Keywords: Non-linear
Introduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Active Learning SVM for Blogs recommendation
Active Learning SVM for Blogs recommendation Xin Guan Computer Science, George Mason University Ⅰ.Introduction In the DH Now website, they try to review a big amount of blogs and articles and find the
Using Data Mining for Mobile Communication Clustering and Characterization
Using Data Mining for Mobile Communication Clustering and Characterization A. Bascacov *, C. Cernazanu ** and M. Marcu ** * Lasting Software, Timisoara, Romania ** Politehnica University of Timisoara/Computer
1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
BIRCH: An Efficient Data Clustering Method For Very Large Databases
BIRCH: An Efficient Data Clustering Method For Very Large Databases Tian Zhang, Raghu Ramakrishnan, Miron Livny CPSC 504 Presenter: Discussion Leader: Sophia (Xueyao) Liang HelenJr, Birches. Online Image.
Data, Measurements, Features
Data, Measurements, Features Middle East Technical University Dep. of Computer Engineering 2009 compiled by V. Atalay What do you think of when someone says Data? We might abstract the idea that data are
Introduction to Data Mining and Machine Learning Techniques. Iza Moise, Evangelos Pournaras, Dirk Helbing
Introduction to Data Mining and Machine Learning Techniques Iza Moise, Evangelos Pournaras, Dirk Helbing Iza Moise, Evangelos Pournaras, Dirk Helbing 1 Overview Main principles of data mining Definition
COC131 Data Mining - Clustering
COC131 Data Mining - Clustering Martin D. Sykora [email protected] Tutorial 05, Friday 20th March 2009 1. Fire up Weka (Waikako Environment for Knowledge Analysis) software, launch the explorer window
Machine Learning. Mausam (based on slides by Tom Mitchell, Oren Etzioni and Pedro Domingos)
Machine Learning Mausam (based on slides by Tom Mitchell, Oren Etzioni and Pedro Domingos) What Is Machine Learning? A computer program is said to learn from experience E with respect to some class of
Machine Learning. Chapter 18, 21. Some material adopted from notes by Chuck Dyer
Machine Learning Chapter 18, 21 Some material adopted from notes by Chuck Dyer What is learning? Learning denotes changes in a system that... enable a system to do the same task more efficiently the next
Analysis Tools and Libraries for BigData
+ Analysis Tools and Libraries for BigData Lecture 02 Abhijit Bendale + Office Hours 2 n Terry Boult (Waiting to Confirm) n Abhijit Bendale (Tue 2:45 to 4:45 pm). Best if you email me in advance, but I
8. Machine Learning Applied Artificial Intelligence
8. Machine Learning Applied Artificial Intelligence Prof. Dr. Bernhard Humm Faculty of Computer Science Hochschule Darmstadt University of Applied Sciences 1 Retrospective Natural Language Processing Name
BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16
Course Director: Dr. Barry Grant (DCM&B, [email protected]) Description: This is a three module course covering (1) Foundations of Bioinformatics, (2) Statistics in Bioinformatics, and (3) Systems
from Larson Text By Susan Miertschin
Decision Tree Data Mining Example from Larson Text By Susan Miertschin 1 Problem The Maximum Miniatures Marketing Department wants to do a targeted mailing gpromoting the Mythic World line of figurines.
Biological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
Maschinelles Lernen mit MATLAB
Maschinelles Lernen mit MATLAB Jérémy Huard Applikationsingenieur The MathWorks GmbH 2015 The MathWorks, Inc. 1 Machine Learning is Everywhere Image Recognition Speech Recognition Stock Prediction Medical
Knowledge Discovery from patents using KMX Text Analytics
Knowledge Discovery from patents using KMX Text Analytics Dr. Anton Heijs [email protected] Treparel Abstract In this white paper we discuss how the KMX technology of Treparel can help searchers
COURSE RECOMMENDER SYSTEM IN E-LEARNING
International Journal of Computer Science and Communication Vol. 3, No. 1, January-June 2012, pp. 159-164 COURSE RECOMMENDER SYSTEM IN E-LEARNING Sunita B Aher 1, Lobo L.M.R.J. 2 1 M.E. (CSE)-II, Walchand
Comparison of Data Mining Techniques used for Financial Data Analysis
Comparison of Data Mining Techniques used for Financial Data Analysis Abhijit A. Sawant 1, P. M. Chawan 2 1 Student, 2 Associate Professor, Department of Computer Technology, VJTI, Mumbai, INDIA Abstract
SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE
AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,
Environmental Remote Sensing GEOG 2021
Environmental Remote Sensing GEOG 2021 Lecture 4 Image classification 2 Purpose categorising data data abstraction / simplification data interpretation mapping for land cover mapping use land cover class
Effective Analysis and Predictive Model of Stroke Disease using Classification Methods
Effective Analysis and Predictive Model of Stroke Disease using Classification Methods A.Sudha Student, M.Tech (CSE) VIT University Vellore, India P.Gayathri Assistant Professor VIT University Vellore,
A Systemic Artificial Intelligence (AI) Approach to Difficult Text Analytics Tasks
A Systemic Artificial Intelligence (AI) Approach to Difficult Text Analytics Tasks Text Analytics World, Boston, 2013 Lars Hard, CTO Agenda Difficult text analytics tasks Feature extraction Bio-inspired
Classification algorithm in Data mining: An Overview
Classification algorithm in Data mining: An Overview S.Neelamegam #1, Dr.E.Ramaraj *2 #1 M.phil Scholar, Department of Computer Science and Engineering, Alagappa University, Karaikudi. *2 Professor, Department
Classification of Titanic Passenger Data and Chances of Surviving the Disaster Data Mining with Weka and Kaggle Competition Data
Proceedings of Student-Faculty Research Day, CSIS, Pace University, May 2 nd, 2014 Classification of Titanic Passenger Data and Chances of Surviving the Disaster Data Mining with Weka and Kaggle Competition
BIOINF 585 Fall 2015 Machine Learning for Systems Biology & Clinical Informatics http://www.ccmb.med.umich.edu/node/1376
Course Director: Dr. Kayvan Najarian (DCM&B, [email protected]) Lectures: Labs: Mondays and Wednesdays 9:00 AM -10:30 AM Rm. 2065 Palmer Commons Bldg. Wednesdays 10:30 AM 11:30 AM (alternate weeks) Rm.
Neural Networks Lesson 5 - Cluster Analysis
Neural Networks Lesson 5 - Cluster Analysis Prof. Michele Scarpiniti INFOCOM Dpt. - Sapienza University of Rome http://ispac.ing.uniroma1.it/scarpiniti/index.htm [email protected] Rome, 29
A Survey on Outlier Detection Techniques for Credit Card Fraud Detection
IOSR Journal of Computer Engineering (IOSR-JCE) e-issn: 2278-0661, p- ISSN: 2278-8727Volume 16, Issue 2, Ver. VI (Mar-Apr. 2014), PP 44-48 A Survey on Outlier Detection Techniques for Credit Card Fraud
Data Mining with Weka
Data Mining with Weka Class 1 Lesson 1 Introduction Ian H. Witten Department of Computer Science University of Waikato New Zealand weka.waikato.ac.nz Data Mining with Weka a practical course on how to
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
Data Mining Techniques for Prognosis in Pancreatic Cancer
Data Mining Techniques for Prognosis in Pancreatic Cancer by Stuart Floyd A Thesis Submitted to the Faculty of the WORCESTER POLYTECHNIC INSTITUE In partial fulfillment of the requirements for the Degree
Detection. Perspective. Network Anomaly. Bhattacharyya. Jugal. A Machine Learning »C) Dhruba Kumar. Kumar KaKta. CRC Press J Taylor & Francis Croup
Network Anomaly Detection A Machine Learning Perspective Dhruba Kumar Bhattacharyya Jugal Kumar KaKta»C) CRC Press J Taylor & Francis Croup Boca Raton London New York CRC Press is an imprint of the Taylor
Université de Montpellier 2 Hugo Alatrista-Salas : [email protected]
Université de Montpellier 2 Hugo Alatrista-Salas : [email protected] WEKA Gallirallus Zeland) australis : Endemic bird (New Characteristics Waikato university Weka is a collection
Using multiple models: Bagging, Boosting, Ensembles, Forests
Using multiple models: Bagging, Boosting, Ensembles, Forests Bagging Combining predictions from multiple models Different models obtained from bootstrap samples of training data Average predictions or
Machine Learning using MapReduce
Machine Learning using MapReduce What is Machine Learning Machine learning is a subfield of artificial intelligence concerned with techniques that allow computers to improve their outputs based on previous
Keywords Data mining, Classification Algorithm, Decision tree, J48, Random forest, Random tree, LMT, WEKA 3.7. Fig.1. Data mining techniques.
International Journal of Emerging Research in Management &Technology Research Article October 2015 Comparative Study of Various Decision Tree Classification Algorithm Using WEKA Purva Sewaiwar, Kamal Kant
Chapter 6. The stacking ensemble approach
82 This chapter proposes the stacking ensemble approach for combining different data mining classifiers to get better performance. Other combination techniques like voting, bagging etc are also described
Presentation by: Ahmad Alsahaf. Research collaborator at the Hydroinformatics lab - Politecnico di Milano MSc in Automation and Control Engineering
Johann Bernoulli Institute for Mathematics and Computer Science, University of Groningen 9-October 2015 Presentation by: Ahmad Alsahaf Research collaborator at the Hydroinformatics lab - Politecnico di
An Overview of Knowledge Discovery Database and Data mining Techniques
An Overview of Knowledge Discovery Database and Data mining Techniques Priyadharsini.C 1, Dr. Antony Selvadoss Thanamani 2 M.Phil, Department of Computer Science, NGM College, Pollachi, Coimbatore, Tamilnadu,
Medical Information Management & Mining. You Chen Jan,15, 2013 [email protected]
Medical Information Management & Mining You Chen Jan,15, 2013 [email protected] 1 Trees Building Materials Trees cannot be used to build a house directly. How can we transform trees to building materials?
Predict the Popularity of YouTube Videos Using Early View Data
000 001 002 003 004 005 006 007 008 009 010 011 012 013 014 015 016 017 018 019 020 021 022 023 024 025 026 027 028 029 030 031 032 033 034 035 036 037 038 039 040 041 042 043 044 045 046 047 048 049 050
Data Mining for Customer Service Support. Senioritis Seminar Presentation Megan Boice Jay Carter Nick Linke KC Tobin
Data Mining for Customer Service Support Senioritis Seminar Presentation Megan Boice Jay Carter Nick Linke KC Tobin Traditional Hotline Services Problem Traditional Customer Service Support (manufacturing)
Non-negative Matrix Factorization (NMF) in Semi-supervised Learning Reducing Dimension and Maintaining Meaning
Non-negative Matrix Factorization (NMF) in Semi-supervised Learning Reducing Dimension and Maintaining Meaning SAMSI 10 May 2013 Outline Introduction to NMF Applications Motivations NMF as a middle step
Analysis of kiva.com Microlending Service! Hoda Eydgahi Julia Ma Andy Bardagjy December 9, 2010 MAS.622j
Analysis of kiva.com Microlending Service! Hoda Eydgahi Julia Ma Andy Bardagjy December 9, 2010 MAS.622j What is Kiva? An organization that allows people to lend small amounts of money via the Internet
Big Data Text Mining and Visualization. Anton Heijs
Copyright 2007 by Treparel Information Solutions BV. This report nor any part of it may be copied, circulated, quoted without prior written approval from Treparel7 Treparel Information Solutions BV Delftechpark
Supervised Learning (Big Data Analytics)
Supervised Learning (Big Data Analytics) Vibhav Gogate Department of Computer Science The University of Texas at Dallas Practical advice Goal of Big Data Analytics Uncover patterns in Data. Can be used
A Content based Spam Filtering Using Optical Back Propagation Technique
A Content based Spam Filtering Using Optical Back Propagation Technique Sarab M. Hameed 1, Noor Alhuda J. Mohammed 2 Department of Computer Science, College of Science, University of Baghdad - Iraq ABSTRACT
A Toolbox for Bicluster Analysis in R
Sebastian Kaiser and Friedrich Leisch A Toolbox for Bicluster Analysis in R Technical Report Number 028, 2008 Department of Statistics University of Munich http://www.stat.uni-muenchen.de A Toolbox for
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data The Illumina TopHat Alignment and Cufflinks Assembly and Differential Expression apps make RNA data analysis accessible to any user, regardless
Performance Analysis of Naive Bayes and J48 Classification Algorithm for Data Classification
Performance Analysis of Naive Bayes and J48 Classification Algorithm for Data Classification Tina R. Patil, Mrs. S. S. Sherekar Sant Gadgebaba Amravati University, Amravati [email protected], [email protected]
BEHAVIOR BASED CREDIT CARD FRAUD DETECTION USING SUPPORT VECTOR MACHINES
BEHAVIOR BASED CREDIT CARD FRAUD DETECTION USING SUPPORT VECTOR MACHINES 123 CHAPTER 7 BEHAVIOR BASED CREDIT CARD FRAUD DETECTION USING SUPPORT VECTOR MACHINES 7.1 Introduction Even though using SVM presents
PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: [email protected]
BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,
BOOSTING - A METHOD FOR IMPROVING THE ACCURACY OF PREDICTIVE MODEL
The Fifth International Conference on e-learning (elearning-2014), 22-23 September 2014, Belgrade, Serbia BOOSTING - A METHOD FOR IMPROVING THE ACCURACY OF PREDICTIVE MODEL SNJEŽANA MILINKOVIĆ University
Using Trace Clustering for Configurable Process Discovery Explained by Event Log Data
Master of Business Information Systems, Department of Mathematics and Computer Science Using Trace Clustering for Configurable Process Discovery Explained by Event Log Data Master Thesis Author: ing. Y.P.J.M.
DATA MINING CLUSTER ANALYSIS: BASIC CONCEPTS
DATA MINING CLUSTER ANALYSIS: BASIC CONCEPTS 1 AND ALGORITHMS Chiara Renso KDD-LAB ISTI- CNR, Pisa, Italy WHAT IS CLUSTER ANALYSIS? Finding groups of objects such that the objects in a group will be similar
Introduction to Principal Components and FactorAnalysis
Introduction to Principal Components and FactorAnalysis Multivariate Analysis often starts out with data involving a substantial number of correlated variables. Principal Component Analysis (PCA) is a
Principal Component Analysis
Principal Component Analysis ERS70D George Fernandez INTRODUCTION Analysis of multivariate data plays a key role in data analysis. Multivariate data consists of many different attributes or variables recorded
EM Clustering Approach for Multi-Dimensional Analysis of Big Data Set
EM Clustering Approach for Multi-Dimensional Analysis of Big Data Set Amhmed A. Bhih School of Electrical and Electronic Engineering Princy Johnson School of Electrical and Electronic Engineering Martin
A Comparative Analysis of Classification Techniques on Categorical Data in Data Mining
A Comparative Analysis of Classification Techniques on Categorical Data in Data Mining Sakshi Department Of Computer Science And Engineering United College of Engineering & Research Naini Allahabad [email protected]
LVQ Plug-In Algorithm for SQL Server
LVQ Plug-In Algorithm for SQL Server Licínia Pedro Monteiro Instituto Superior Técnico [email protected] I. Executive Summary In this Resume we describe a new functionality implemented
International Journal of Computer Science Trends and Technology (IJCST) Volume 3 Issue 3, May-June 2015
RESEARCH ARTICLE OPEN ACCESS Data Mining Technology for Efficient Network Security Management Ankit Naik [1], S.W. Ahmad [2] Student [1], Assistant Professor [2] Department of Computer Science and Engineering
Tutorial for proteome data analysis using the Perseus software platform
Tutorial for proteome data analysis using the Perseus software platform Laboratory of Mass Spectrometry, LNBio, CNPEM Tutorial version 1.0, January 2014. Note: This tutorial was written based on the information
MACHINE LEARNING BASICS WITH R
MACHINE LEARNING [Hands-on Introduction of Supervised Machine Learning Methods] DURATION 2 DAY The field of machine learning is concerned with the question of how to construct computer programs that automatically
Data Mining Practical Machine Learning Tools and Techniques
Ensemble learning Data Mining Practical Machine Learning Tools and Techniques Slides for Chapter 8 of Data Mining by I. H. Witten, E. Frank and M. A. Hall Combining multiple models Bagging The basic idea
CNFSAT: Predictive Models, Dimensional Reduction, and Phase Transition
CNFSAT: Predictive Models, Dimensional Reduction, and Phase Transition Neil P. Slagle College of Computing Georgia Institute of Technology Atlanta, GA [email protected] Abstract CNFSAT embodies the P
Algorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
Dimensionality Reduction: Principal Components Analysis
Dimensionality Reduction: Principal Components Analysis In data mining one often encounters situations where there are a large number of variables in the database. In such situations it is very likely
Clustering Big Data. Anil K. Jain. (with Radha Chitta and Rong Jin) Department of Computer Science Michigan State University November 29, 2012
Clustering Big Data Anil K. Jain (with Radha Chitta and Rong Jin) Department of Computer Science Michigan State University November 29, 2012 Outline Big Data How to extract information? Data clustering
Experiments in Web Page Classification for Semantic Web
Experiments in Web Page Classification for Semantic Web Asad Satti, Nick Cercone, Vlado Kešelj Faculty of Computer Science, Dalhousie University E-mail: {rashid,nick,vlado}@cs.dal.ca Abstract We address
Index Contents Page No. Introduction . Data Mining & Knowledge Discovery
Index Contents Page No. 1. Introduction 1 1.1 Related Research 2 1.2 Objective of Research Work 3 1.3 Why Data Mining is Important 3 1.4 Research Methodology 4 1.5 Research Hypothesis 4 1.6 Scope 5 2.
CS Master Level Courses and Areas COURSE DESCRIPTIONS. CSCI 521 Real-Time Systems. CSCI 522 High Performance Computing
CS Master Level Courses and Areas The graduate courses offered may change over time, in response to new developments in computer science and the interests of faculty and students; the list of graduate
The Optimality of Naive Bayes
The Optimality of Naive Bayes Harry Zhang Faculty of Computer Science University of New Brunswick Fredericton, New Brunswick, Canada email: hzhang@unbca E3B 5A3 Abstract Naive Bayes is one of the most
Protein Protein Interaction Networks
Functional Pattern Mining from Genome Scale Protein Protein Interaction Networks Young-Rae Cho, Ph.D. Assistant Professor Department of Computer Science Baylor University it My Definition of Bioinformatics
Supervised DNA barcodes species classification: analysis, comparisons and results. Tutorial. Citations
Supervised DNA barcodes species classification: analysis, comparisons and results Emanuel Weitschek, Giulia Fiscon, and Giovanni Felici Citations If you use this procedure please cite: Weitschek E, Fiscon
15.062 Data Mining: Algorithms and Applications Matrix Math Review
.6 Data Mining: Algorithms and Applications Matrix Math Review The purpose of this document is to give a brief review of selected linear algebra concepts that will be useful for the course and to develop
Data Mining and Knowledge Discovery in Databases (KDD) State of the Art. Prof. Dr. T. Nouri Computer Science Department FHNW Switzerland
Data Mining and Knowledge Discovery in Databases (KDD) State of the Art Prof. Dr. T. Nouri Computer Science Department FHNW Switzerland 1 Conference overview 1. Overview of KDD and data mining 2. Data
Mathematical Models of Supervised Learning and their Application to Medical Diagnosis
Genomic, Proteomic and Transcriptomic Lab High Performance Computing and Networking Institute National Research Council, Italy Mathematical Models of Supervised Learning and their Application to Medical
Data Mining. Cluster Analysis: Advanced Concepts and Algorithms
Data Mining Cluster Analysis: Advanced Concepts and Algorithms Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 1 More Clustering Methods Prototype-based clustering Density-based clustering Graph-based
