Bioinformatics Resources at a Glance
|
|
|
- Daniel Brian Merritt
- 10 years ago
- Views:
Transcription
1 Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences that allows them to be read by a wide range of programs. This format is called FASTA format, and each nucleotide or amino acid is represented using a single letter. The first line of a FASTA is the comment line, identified with either the greater than symbol >. This line identifies the sequence and includes the accession number from NCBI, Genbank or another repository. The remaining lines contain the sequence, in lines of 80 or 120 characters per line. Many bioinformatics tools require that the sequence be terminated with two slashes // to indicate the end of a sequence. These may have to be added manually, as they are not always included in FASTA sequences online. If you locate a nucleotide or protein sequence, and it is not in FASTA format, you can easily convert it to FASTA in a word processing program. Often the sequences contain numbers at the beginning of each line, as well as spaces between the numbers and the sequence. I simply run a series of find and replace operations, replacing each of the digits 0 through 9 and a space with nothing. (In Word on a PC, open the find search box, enter what you are searching for in the find box, click on the replace tab, don t put anything in the replace field, and click replace all.) You can then wrap the text by clicking delete at the end of each line. If you have a long sequence, you ll discover that it is easier to start at the bottom and go up the sequence. I develop a rhythm delete, up arrow, delete, up arrow, etc. (If you start at the top, you have to add an extra step: delete, down arrow, end, delete, down arrow, end ) When putting a file into FASTA format, add the comment string AFTER you ve edited your sequence or you ll lose any digits in the accession number! I typically save nucleotide and protein sequences for a gene as separate Word documents within a single folder on my computer. This allows easy access for any of the manipulations I may do with the sequences. Obtaining Nucleotide and Protein Sequences 1. Go to NCBI ( this is a repository of nucleotide and protein sequences, with MANY associated resources. 2. Input protein name and select all databases 3. This will show the listing of all the resources in the NCBI related to your protein. Though the resources may appear overwhelming, it is worth your time and effort to do a little bit of exploring on this page just to see what is available. So many resources, so little time
2 4. Click on nucleotide or protein 5. Often there are numerous sequences; NCBI will frequently list the most likely candidates at the top of the screen. Since there are variations among species, be sure to select the protein from the appropriate species. 6. Click on the link to the protein you want to explore. This will bring up resource page in the NCBI this is a GREAT place to get links to journal articles related to your protein, and oftentimes as you explore the site and follow the links, you ll find a list of mutants and their impact, or even other proteins your protein associates with. 7. For nucleotide sequences, there is usually a gene map that depicts introns and exons, with an accession number on the left side of the map. If you click on the accession number and follow the links, you ll typically get the WHOLE clone that includes your gene but other genes as well. Depending on what you plan to do with the sequence, you may want to select the sequence in various forms: a. The clone will show the gene in context of other nearby genes on the chromosome. Though you won t use the WHOLE clone, if you intend to create an activity that explores the regulatory sequences (promoters, for instance), you ll need this information. This is often referred to as a genomic sequence. You ll need this sequence to show introns as well. b. An mrna sequence contains the protein coding sequence (with introns removed), as well as 5 regulatory sequences and 3 sequences through to the polyadenylation site. If you want to map the introns, you can easily overlay the mrna sequence on the genomic sequence. (When the files are in FASTA format, it is easy to locate the start of the mrna on the genomic sequence by searching for 5 10 nucleotides from the mrna. You can begin to annotate the genomic sequence by highlighting the mrna sequence. 8. Be sure to read the accompanying description for the sequences you find. Is the sequence complete, or just a part of the gene? Are there any mutations in the gene? Often the notes will identify introns. 9. If you want to start with mrna and protein sequences, scroll down towards the bottom of the screen. Often you ll see something that looks like this:
3 10. This reference sequence includes two accession numbers. The one beginning with NM is the mrna sequence; the one beginning with NP is the protein sequence. If you plan to look at both nucleotide and protein sequences, it is important that they come from the same gene. This reference sequence map ensures that the two sequences correspond. Once You Have Your Sequence(s) What do you want to do with your sequence(s)? There are many tools and resources available online. This is just a brief overview of some of the things you can do. 1. Look for similar sequences perhaps you d like to see if your protein (or something similar) is found in other species. Or you want to compare the protein from different species to identify conserved regions (often important in function). If you have the nucleotide and/or protein sequence, you can do a BLAST search. This will identify similar sequences in the database. Note that, due to the degeneracy of the genetic code, you may find protein sequences that are highly conserved but that there is significant variation in the nucleotide sequence. 2. Align two sequences to compare their similarity. You may know two sequences are similar from the literature or you may discover a sequence similar to your protein from a BLAST search. Sequence alignments can be done with either nucleotide or protein sequences. You may align two sequences, or, if you have multiple sequences, you may develop a phylogenetic 3. Annotate a gene identifying promoters, introns, polyadenylation sequences. There are two ways to approach this task. You should start with a genomic sequence. If you have an mrna sequence, you can easily highlight the processed mrna on the genomic map. There may be gaps in the mrna that are expressed in the genome these are introns. If you wish to identify the 3 reading frames and highlight the correct one, you would TRANSLATE the mrna sequence. It helps to have the protein sequence to identify the correct reading frame for your map.
4 BLAST Search: Search using: Search databases: Use tool: Nucleotide sequence Nucleotide database Nucleotide blast Protein sequence Protein database Protein blast Nucleotide sequence Protein database Blastx translated to protein Protein sequence Translated nucleotide Tblastn database Nucleotide sequence translated to protein Translated nucleotide database Tblastx TRANSLATE 1. Go to 2. Cut and paste DNA sequence Aligning sequences 1. Aligning protein sequences: prot.html 2. Multiple sequence alignment (nucleotide or peptide) slow server: Other Bioinformatics Tools (a few of many similar resources!) 1. scroll down to DNA > Protein tools.ca/ includes background information Generating a Gene Map of a Protein 1. Go to NCBI a. Search for protein in all databases b. Select nucleotide databases c. Locate gene map (will show introns and exons) d. Download DNA sequence (left click on black code above sequence map) i. Select FASTA save in Word file e. Download mrna sequence (left click on blue code to left of sequence map) i. Select FASTA save in Word file f. Download protein sequence (left click on red code to left of sequence map)
5 i. Select FASTA save in Word file 2. Translating DNA Sequence a. Go to b. Cut and paste DNA sequence into the box omit the header information, and make sure the end of the sequence includes // (this is the FASTA code that says I m done ) It s okay to leave in the numbers and spaces. c. Keep all the settings as they are, and click Translate d. Cut and paste the results into another Word document this is your gene map, with the three forward reading frames e. If you want to have Mark generate a paper bioinformatics strip after translating to get all 3 reading frames translate each one separately: i. Use the back arrow on the web browser to get back to the translate page. Just change the settings: 1. Translate entire sequence and select reading frame select 1 2. Output options: uncheck Map of DNA sequence ii. Copy the results in a Word document called frame 1 iii. Repeat i and ii for reading frames 2 and 3 3. Formatting data to generate info for bioinformatics strips a. DNA: i. Use find and replace iteratively to replace the numerals 1 0 and a space with NOTHING. This will remove all the numbers and spaces. Do a find and replace to change t to u if you want to have an RNA map. ii. Go to the bottom of the file, next to last row, at the right side of the row. Iteratively click Delete followed by up arrow until you get to the top of the file. This will wrap all the text into a long string. b. Protein: i. Paste the three frames into the same file (to avoid having to run the steps three times). Place them in order (1,2,3) and separate with a divider that is non alphanumeric. DO NOT label until after completing the find and replace steps! Save early and often. ii. Use find and replace iteratively to replace the numerals 1 0 and a space with NOTHING. This will remove all the numbers and spaces. iii. Go to the bottom of the file, next to last row, at the right side of the row. Iteratively click Delete followed by up arrow until you get to the top of the file. This will wrap all the text into a long string. iv. Next, to get the spacing correct, use find and replace to change each amino acid to be followed by two spaces: 1. Find A replace A A followed by 2 spaces
6 2. Do this for all amino acids and the stop codon: A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, Y and * 3. Label the three reading frames and save the file!
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
GenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
Biological Sequence Data Formats
Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
Analyzing A DNA Sequence Chromatogram
LESSON 9 HANDOUT Analyzing A DNA Sequence Chromatogram Student Researcher Background: DNA Analysis and FinchTV DNA sequence data can be used to answer many types of questions. Because DNA sequences differ
A Tutorial in Genetic Sequence Classification Tools and Techniques
A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University [email protected] www.jakemdrew.com Sequence Characters IUPAC nucleotide
Searching Nucleotide Databases
Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames
When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want
1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very
Gene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE
AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,
Tutorial. Reference Genome Tracks. Sample to Insight. November 27, 2015
Reference Genome Tracks November 27, 2015 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com [email protected] Reference
Bioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
Pairwise Sequence Alignment
Pairwise Sequence Alignment [email protected] SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What
Human Genome Organization: An Update. Genome Organization: An Update
Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion
Version 5.0 Release Notes
Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com
Introduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
Genomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
LESSON 9. Analyzing DNA Sequences and DNA Barcoding. Introduction. Learning Objectives
9 Analyzing DNA Sequences and DNA Barcoding Introduction DNA sequencing is performed by scientists in many different fields of biology. Many bioinformatics programs are used during the process of analyzing
SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications
Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each
Module 10: Bioinformatics
Module 10: Bioinformatics 1.) Goal: To understand the general approaches for basic in silico (computer) analysis of DNA- and protein sequences. We are going to discuss sequence formatting required prior
Concluding lesson. Student manual. What kind of protein are you? (Basic)
Concluding lesson Student manual What kind of protein are you? (Basic) Part 1 The hereditary material of an organism is stored in a coded way on the DNA. This code consists of four different nucleotides:
Becker Muscular Dystrophy
Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency
Module 1. Sequence Formats and Retrieval. Charles Steward
The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.
Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011
Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003
Similarity Searches on Sequence Databases: BLAST, FASTA Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Outline Importance of Similarity Heuristic Sequence Alignment:
GENE CONSTRUCTION KIT 4
GENE CONSTRUCTION KIT 4 Tutorials & User Manual from Textco BioSoftware, Inc. September 2012, First Edition Gene Construction Kit 4 Manual is Copyright Textco Bio- Software, Inc. 2003-2012. All rights
Transcription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
Guide for Bioinformatics Project Module 3
Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first
How to Make the Most of Excel Spreadsheets
How to Make the Most of Excel Spreadsheets Analyzing data is often easier when it s in an Excel spreadsheet rather than a PDF for example, you can filter to view just a particular grade, sort to view which
Name: Date: Period: DNA Unit: DNA Webquest
Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History http://www.dnaftb.org/dnaftb/1/concept/index.html Read the text and answer the following questions.
PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: [email protected]
BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,
Hidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006
Hidden Markov Models in Bioinformatics By Máthé Zoltán Kőrösi Zoltán 2006 Outline Markov Chain HMM (Hidden Markov Model) Hidden Markov Models in Bioinformatics Gene Finding Gene Finding Model Viterbi algorithm
BLAST. Anders Gorm Pedersen & Rasmus Wernersson
BLAST Anders Gorm Pedersen & Rasmus Wernersson Database searching Using pairwise alignments to search databases for similar sequences Query sequence Database Database searching Most common use of pairwise
AS4.1 190509 Replaces 260806 Page 1 of 50 ATF. Software for. DNA Sequencing. Operators Manual. Assign-ATF is intended for Research Use Only (RUO):
Replaces 260806 Page 1 of 50 ATF Software for DNA Sequencing Operators Manual Replaces 260806 Page 2 of 50 1 About ATF...5 1.1 Compatibility...5 1.1.1 Computer Operator Systems...5 1.1.2 DNA Sequencing
Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:
DNA Sequence Alignment Analysis
Analysis of DNA sequence data p. 1 Analysis of DNA sequence data using MEGA and DNAsp. Analysis of two genes from the X and Y chromosomes of plant species from the genus Silene The first two computer classes
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
Custom TaqMan Assays For New SNP Genotyping and Gene Expression Assays. Design and Ordering Guide
Custom TaqMan Assays For New SNP Genotyping and Gene Expression Assays Design and Ordering Guide For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in
A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques
Proceedings of the 2007 WSEAS International Conference on Computer Engineering and Applications, Gold Coast, Australia, January 17-19, 2007 402 A Multiple DNA Sequence Translation Tool Incorporating Web
1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
Biological Databases and Protein Sequence Analysis
Biological Databases and Protein Sequence Analysis Introduction M. Madan Babu, Center for Biotechnology, Anna University, Chennai 25, India Bioinformatics is the application of Information technology to
Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment
Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249
The Steps. 1. Transcription. 2. Transferal. 3. Translation
Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order
Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at
Woods Hole Zebrafish Genetics and Development Bioinformatics/Genomics Lab Ian Woods Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at http://faculty.ithaca.edu/iwoods/docs/wh/
CLC Sequence Viewer USER MANUAL
CLC Sequence Viewer USER MANUAL Manual for CLC Sequence Viewer 7.6.1 Windows, Mac OS X and Linux September 3, 2015 This software is for research purposes only. QIAGEN Aarhus A/S Silkeborgvej 2 Prismet
Protein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
Vector NTI Advance 11 Quick Start Guide
Vector NTI Advance 11 Quick Start Guide Catalog no. 12605050, 12605099, 12605103 Version 11.0 December 15, 2008 12605022 Published by: Invitrogen Corporation 5791 Van Allen Way Carlsbad, CA 92008 U.S.A.
Molecular Databases and Tools
NWeHealth, The University of Manchester Molecular Databases and Tools Afternoon Session: NCBI/EBI resources, pairwise alignment, BLAST, multiple sequence alignment and primer finding. Dr. Georgina Moulton
Ms. Campbell Protein Synthesis Practice Questions Regents L.E.
Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide
BIOINFORMATICS TUTORIAL
Bio 242 BIOINFORMATICS TUTORIAL Bio 242 α Amylase Lab Sequence Sequence Searches: BLAST Sequence Alignment: Clustal Omega 3d Structure & 3d Alignments DO NOT REMOVE FROM LAB. DO NOT WRITE IN THIS DOCUMENT.
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want
1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very
Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6
Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6 In the last lab, you learned how to perform basic multiple sequence alignments. While useful in themselves for determining conserved residues
Frequently Asked Questions Next Generation Sequencing
Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided
Configure Outlook 2013 to connect to Hosted Exchange
Configure Outlook 2013 to connect to Hosted Exchange Anglia IT Solutions Hosted Exchange supports: Windows XP, 7 and 8 Microsoft Office 2007 / 2010 / 2013 These instructions describe how to setup Outlook
Final Project Report
CPSC545 by Introduction to Data Mining Prof. Martin Schultz & Prof. Mark Gerstein Student Name: Yu Kor Hugo Lam Student ID : 904907866 Due Date : May 7, 2007 Introduction Final Project Report Pseudogenes
Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS
Lab 2/Phylogenetics/September 16, 2002 1 Read: Tudge Chapter 2 PHYLOGENETICS Objective of the Lab: To understand how DNA and protein sequence information can be used to make comparisons and assess evolutionary
Database manager does something that sounds trivial. It makes it easy to setup a new database for searching with Mascot. It also makes it easy to
1 Database manager does something that sounds trivial. It makes it easy to setup a new database for searching with Mascot. It also makes it easy to automate regular updates of these databases. 2 However,
Activity 7.21 Transcription factors
Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation
Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS
Period Date REGENTS REVIEW: PROTEIN SYNTHESIS 1. The diagram at the right represents a portion of a type of organic molecule present in the cells of organisms. What will most likely happen if there is
Google Drive: Access and organize your files
Google Drive: Access and organize your files Use Google Drive to store and access your files, folders, and Google Docs, Sheets, and Slides anywhere. Change a file on the web, your computer, tablet, or
DNA Sequencing Overview
DNA Sequencing Overview DNA sequencing involves the determination of the sequence of nucleotides in a sample of DNA. It is presently conducted using a modified PCR reaction where both normal and labeled
RNA & Protein Synthesis
RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis
Integration of data management and analysis for genome research
Integration of data management and analysis for genome research Volker Brendel Deparment of Zoology & Genetics and Department of Statistics Iowa State University 2112 Molecular Biology Building Ames, Iowa
org.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers.
org.rn.eg.db December 16, 2015 org.rn.egaccnum Map Entrez Gene identifiers to GenBank Accession Numbers org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank
Introduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]
Clone Manager. Getting Started
Clone Manager for Windows Professional Edition Volume 2 Alignment, Primer Operations Version 9.5 Getting Started Copyright 1994-2015 Scientific & Educational Software. All rights reserved. The software
DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3
DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
Introduction to GCG and SeqLab
Oxford University Bioinformatics Centre Introduction to GCG and SeqLab 31 July 2001 Oxford University Bioinformatics Centre, 2001 Sir William Dunn School of Pathology South Parks Road Oxford, OX1 3RE Contents
mrna EDITING Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005
mrna EDITING mrna EDITING http://dbb.urmc.rochester.edu/labs/smith/research_2.htm The number of A to I sites in the human transcriptome >15;000 the vast majority of these sites occurring in Alu repeats
Lecture Outline. Introduction to Databases. Introduction. Data Formats Sample databases How to text search databases. Shifra Ben-Dor Irit Orr
Introduction to Databases Shifra Ben-Dor Irit Orr Lecture Outline Introduction Data and Database types Database components Data Formats Sample databases How to text search databases What units of information
Lecture 3: Mutations
Lecture 3: Mutations Recall that the flow of information within a cell involves the transcription of DNA to mrna and the translation of mrna to protein. Recall also, that the flow of information between
DNA and the Cell. Version 2.3. English version. ELLS European Learning Laboratory for the Life Sciences
DNA and the Cell Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Version 2.3 English version ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra Manaia and
HOW TO MAKE YOUR WEBSITE
HOW TO MAKE YOUR WEBSITE Use Netscape Composer to make your web page presentation of a 3D structure of your choosing. You will need to download a few template web pages from the biochemistry website, and
From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
(A GUIDE for the Graphical User Interface (GUI) GDE)
The Genetic Data Environment: A User Modifiable and Expandable Multiple Sequence Analysis Package (A GUIDE for the Graphical User Interface (GUI) GDE) Jonathan A. Eisen Department of Biological Sciences
Dreamweaver Tutorials Creating a Web Contact Form
Dreamweaver Tutorials This tutorial will explain how to create an online contact form. There are two pages involved: the form and the confirmation page. When a user presses the submit button on the form,
GenBank: A Database of Genetic Sequence Data
GenBank: A Database of Genetic Sequence Data Computer Science 105 Boston University David G. Sullivan, Ph.D. An Explosion of Scientific Data Scientists are generating ever increasing amounts of data. Relevant
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
Translation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
PloneSurvey User Guide (draft 3)
- 1 - PloneSurvey User Guide (draft 3) This short document will hopefully contain enough information to allow people to begin creating simple surveys using the new Plone online survey tool. Caveat PloneSurvey
Microsoft Office 365 includes the entire Office Suite (Word, Excel, PowerPoint, Access, Publisher, Lync, Outlook, etc ) and an OneDrive account.
Microsoft Office 365 Contents What is Office 365?... 2 What is OneDrive?... 2 What if you already have a Microsoft Account?... 2 Download Office for FREE... 3 How to Access OneDrive... 4 Office Online...
Worksheet - COMPARATIVE MAPPING 1
Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that
CLC Bioinformatics Database
CLC Bioinformatics Database End User USER MANUAL Manual for CLC Bioinformatics Database 4.6 Windows, Mac OS X and Linux September 3, 2015 This software is for research purposes only. QIAGEN Aarhus A/S
AP BIOLOGY 2010 SCORING GUIDELINES (Form B)
AP BIOLOGY 2010 SCORING GUIDELINES (Form B) Question 2 Certain human genetic conditions, such as sickle cell anemia, result from single base-pair mutations in DNA. (a) Explain how a single base-pair mutation
2006 7.012 Problem Set 3 KEY
2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each
Focusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
Bob Jesberg. Boston, MA April 3, 2014
DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double
DNA Sequence formats
DNA Sequence formats [Plain] [EMBL] [FASTA] [GCG] [GenBank] [IG] [IUPAC] [How Genomatix represents sequence annotation] Plain sequence format A sequence in plain format may contain only IUPAC characters
