Module 1. Sequence Formats and Retrieval. Charles Steward

Size: px
Start display at page:

Download "Module 1. Sequence Formats and Retrieval. Charles Steward"

Transcription

1 The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1

2 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases. Show how to access different genomic data from a variety of databases, using UniProt and GQuery (Entrez). Introduce BLAST. 2

3 Databases Nucleotide databases: DDBJ/EMBL/NCBI form the International Nucleotide Sequence Database Collaboration and store Genomic/cDNAs/ESTs sequences. Protein database: UniProt: Swiss-Prot (manually curated) and TrEMBL (automated annotation) sequences. Accession numbers (a unique number or combination of letters and numbers assigned to each record in a database) identify such sequences. e.g. (AL034553). 3

4 Information is mirrored daily between DDBJ/EMBL/NCBI. DDBJ/EMBL/GenBank: INSDC (International Nucleotide Sequence Database). DDBJ: DNA databank of Japan. CIB-DDBJ: Centre for Information Biology and DNA Data Banks of Japan. EBI: European Bioinformatics Institute. ENA: European Nucleotide Archive contains EMBL Nucleotide Sequence Database EMBL: European Molecular Biology Laboratory. NCBI: National Centre for Biotechnology Information. IAM: International Advisory Meeting. ICM: International Collaborative Meeting. 4

5 EMBL format See abbreviation table 5

6 Abbreviations found in the EMBL flat file: 6

7 NCBI format DDBJ format 7

8 Sequence Read Archive (SRA) for next-generation sequencing submission. INSDC now accept sequence data produced by next-generation sequencing machines. This screen shot is taken from the ENA hosted at EBI. For further information go here: 8

9 NGS file formats BAM format - A BAM file (.bam) is the binary version of a SAM file bigbed format indexed BED file (1 line per feature and at least 3 columns) BigWig format used for dense continuous data and displayed as a graphwiggle plot VCF format - for variants See here for more information: Next Generation Sequencing Courses Wellcome Trust Next Generation Sequencing course 6-13 April EBI - Monday, October 14, Thursday, October 17,

10 NCBI s ENTREZ system 10

11 GQuery (Entrez) entry point 11

12 Goal: One sequence entry for each naturally occurring DNA, RNA and protein molecule chromosome NC_ contig NT_ Reference Sequences mrna NM_ predicted mrna XM_ protein NP_ predicted protein XP_ Key: curated calculated non-coding RNA NR_ predicted non-coding RNA XR_ Multiple products for one gene are instantiated as separate RefSeqs with the same LocusID. 12

13 CCDS Comparison of common CDSs to form consensus gene set QC by UCSC (filter out possible pseudogenes) Build ,752 agreed CCDS IDs CCDS set is displayed in Ensembl/Vega/UCSC/NCBI Non redundant gene set agreed by all institutes 13

14 EBI databases 14

15 EBI search: access all databases 15

16 ENA sequence window! 16

17 ENA data view See here for a clone example: 17

18 UniProt! 18

19 PE (protein existence) line Format!! PE Level: Evidence;!! Values" " 1: Evidence at protein level" " 2: Evidence at transcript level" " 3: Inferred from homology" " 4: Predicted" " 5: Uncertain" " 19

20 TrEMBL entry All information is automatically generated 20

21 Swiss-Prot entry Manually curated entry containing more information than Trembl 21

22 BLAST similarity searching Basic Local Alignment Search Tool There are many different databases available to search against, which may vary depending on which site you start from. The most commonly used BLAST site is hosted by the NCBI: 22

23 Blast output. 1) The score is a measure of the similarity of the query sequence to the subject sequence." It is calculated from the number of gaps and substitutions associated with each aligned sequence. The higher the score, the more significant the alignment. Each score links to the corresponding pairwise alignment between query sequence and subject sequence." 2) E-value is estimate of the likelihood that a sequence match with that score has occurred by chance. The E-value is calculated from the size of the sequence, database and score (or scoring system used) and so is specific to that search. Thus, two results on different databases may not be directly comparable. But the take home message: The smaller the E-value, the smaller the likelihood that it has happened at random and is therefore more likely to be real. For example: in a million searches would produce a false positive with this score in 100 searches would produce a false positive with this score 1 1 match above threshold is likely to be FP matches above threshold are FP For further details see Karlin & Altschul - PNAS :

24 Worked examples Tasks start on page 18 24

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Module 3. Genome Browsing. Using Web Browsers to View Genome Annota4on. Kers4n Howe Wellcome Trust Sanger Ins4tute zfish- help@sanger.ac.

Module 3. Genome Browsing. Using Web Browsers to View Genome Annota4on. Kers4n Howe Wellcome Trust Sanger Ins4tute zfish- help@sanger.ac. Module 3 Genome Browsing Using Web Browsers to View Genome Annota4on Kers4n Howe Wellcome Trust Sanger Ins4tute zfish- help@sanger.ac.uk Introduc.on Genome browsing The Ensembl gene set Guided examples

More information

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:

More information

Committee on WIPO Standards (CWS)

Committee on WIPO Standards (CWS) E CWS/1/5 ORIGINAL: ENGLISH DATE: OCTOBER 13, 2010 Committee on WIPO Standards (CWS) First Session Geneva, October 25 to 29, 2010 PROPOSAL FOR THE PREPARATION OF A NEW WIPO STANDARD ON THE PRESENTATION

More information

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

NCBI resources III: GEO and ftp site. Yanbin Yin Spring 2013

NCBI resources III: GEO and ftp site. Yanbin Yin Spring 2013 NCBI resources III: GEO and ftp site Yanbin Yin Spring 2013 1 Homework assignment 2 Search colon cancer at GEO and find a data Series and perform a GEO2R analysis Write a report (in word or ppt) to include

More information

The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28.

The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28. Tutorial Module 5 BioMart You will learn about BioMart, a joint project developed and maintained at EBI and OiCR www.biomart.org How to use BioMart to quickly obtain lists of gene information from Ensembl

More information

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want 1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very

More information

org.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers.

org.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers. org.rn.eg.db December 16, 2015 org.rn.egaccnum Map Entrez Gene identifiers to GenBank Accession Numbers org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank

More information

Genome Viewing. Module 2. Using Genome Browsers to View Annotation of the Human Genome

Genome Viewing. Module 2. Using Genome Browsers to View Annotation of the Human Genome Module 2 Genome Viewing Using Genome Browsers to View Annotation of the Human Genome Bert Overduin, Ph.D. PANDA Coordination & Outreach EMBL - European Bioinformatics Institute Wellcome Trust Genome Campus

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

Data formats and file conversions

Data formats and file conversions Building Excellence in Genomics and Computational Bioscience s Richard Leggett (TGAC) John Walshaw (IFR) Common file formats FASTQ FASTA BAM SAM Raw sequence Alignments MSF EMBL UniProt BED WIG Databases

More information

BIOINFORMATICS TUTORIAL

BIOINFORMATICS TUTORIAL Bio 242 BIOINFORMATICS TUTORIAL Bio 242 α Amylase Lab Sequence Sequence Searches: BLAST Sequence Alignment: Clustal Omega 3d Structure & 3d Alignments DO NOT REMOVE FROM LAB. DO NOT WRITE IN THIS DOCUMENT.

More information

This document presents the new features available in ngklast release 4.4 and KServer 4.2.

This document presents the new features available in ngklast release 4.4 and KServer 4.2. This document presents the new features available in ngklast release 4.4 and KServer 4.2. 1) KLAST search engine optimization ngklast comes with an updated release of the KLAST sequence comparison tool.

More information

Searching Nucleotide Databases

Searching Nucleotide Databases Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames

More information

Challenges associated with analysis and storage of NGS data

Challenges associated with analysis and storage of NGS data Challenges associated with analysis and storage of NGS data Gabriella Rustici Research and training coordinator Functional Genomics Group gabry@ebi.ac.uk Next-generation sequencing Next-generation sequencing

More information

Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003

Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Similarity Searches on Sequence Databases: BLAST, FASTA Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Outline Importance of Similarity Heuristic Sequence Alignment:

More information

Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison

Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

Linear Sequence Analysis. 3-D Structure Analysis

Linear Sequence Analysis. 3-D Structure Analysis Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical properties Molecular weight (MW), isoelectric point (pi), amino acid content, hydropathy (hydrophilic

More information

The Galaxy workflow. George Magklaras PhD RHCE

The Galaxy workflow. George Magklaras PhD RHCE The Galaxy workflow George Magklaras PhD RHCE Biotechnology Center of Oslo & The Norwegian Center of Molecular Medicine University of Oslo, Norway http://www.biotek.uio.no http://www.ncmm.uio.no http://www.no.embnet.org

More information

GenBank, Entrez, & FASTA

GenBank, Entrez, & FASTA GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,

More information

Genome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009

Genome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Genome and DNA Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Admin Reading: Chapters 1 & 2 Notes available in PDF format on-line (see class calendar page): http://www.soe.ucsc.edu/classes/bme110/spring09/bme110-calendar.html

More information

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS

More information

Library page. SRS first view. Different types of database in SRS. Standard query form

Library page. SRS first view. Different types of database in SRS. Standard query form SRS & Entrez SRS Sequence Retrieval System Bengt Persson Whatis SRS? Sequence Retrieval System User-friendly interface to databases http://srs.ebi.ac.uk Developed by Thure Etzold and co-workers EMBL/EBI

More information

Basic processing of next-generation sequencing (NGS) data

Basic processing of next-generation sequencing (NGS) data Basic processing of next-generation sequencing (NGS) data Getting from raw sequence data to expression analysis! 1 Reminder: we are measuring expression of protein coding genes by transcript abundance

More information

A Tutorial in Genetic Sequence Classification Tools and Techniques

A Tutorial in Genetic Sequence Classification Tools and Techniques A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University jakemdrew@gmail.com www.jakemdrew.com Sequence Characters IUPAC nucleotide

More information

A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques

A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques Proceedings of the 2007 WSEAS International Conference on Computer Engineering and Applications, Gold Coast, Australia, January 17-19, 2007 402 A Multiple DNA Sequence Translation Tool Incorporating Web

More information

ID of alternative translational initiation events. Description of gene function Reference of NCBI database access and relative literatures

ID of alternative translational initiation events. Description of gene function Reference of NCBI database access and relative literatures Data resource: In this database, 650 alternatively translated variants assigned to a total of 300 genes are contained. These database records of alternative translational initiation have been collected

More information

Bioinformatics Grid - Enabled Tools For Biologists.

Bioinformatics Grid - Enabled Tools For Biologists. Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis

More information

SRA File Formats Guide

SRA File Formats Guide SRA File Formats Guide Version 1.1 10 Mar 2010 National Center for Biotechnology Information National Library of Medicine EMBL European Bioinformatics Institute DNA Databank of Japan 1 Contents SRA File

More information

SUBMITTING DNA SEQUENCES TO THE DATABASES

SUBMITTING DNA SEQUENCES TO THE DATABASES Bioinformatics: A Practical Guide to the Analysis of Genes and Proteins, Second Edition Andreas D. Baxevanis, B.F. Francis Ouellette Copyright 2001 John Wiley & Sons, Inc. ISBNs: 0-471-38390-2 (Hardback);

More information

SGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD

SGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD White Paper SGI High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems Haruna Cofer*, PhD January, 2012 Abstract The SGI High Throughput Computing (HTC) Wrapper

More information

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Focusing on results not data comprehensive data analysis for targeted next generation sequencing Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes

More information

An agent-based layered middleware as tool integration

An agent-based layered middleware as tool integration An agent-based layered middleware as tool integration Flavio Corradini Leonardo Mariani Emanuela Merelli University of L Aquila University of Milano University of Camerino ITALY ITALY ITALY Helsinki FSE/ESEC

More information

THE UNIVERSITY OF MANCHESTER Unit Specification

THE UNIVERSITY OF MANCHESTER Unit Specification 1. GENERAL INFORMATION Title Unit code Credit rating 15 Level 7 Contact hours 30 Other Scheduled teaching and learning activities* Pre-requisite units Co-requisite units School responsible Member of staff

More information

Scientific databases. Biological data management

Scientific databases. Biological data management Scientific databases Biological data management The term paper within the framework of the course Principles of Modern Database Systems by Aleksejs Kontijevskis PhD student The Linnaeus Centre for Bioinformatics

More information

Tutorial. Reference Genome Tracks. Sample to Insight. November 27, 2015

Tutorial. Reference Genome Tracks. Sample to Insight. November 27, 2015 Reference Genome Tracks November 27, 2015 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com Reference

More information

Processing Genome Data using Scalable Database Technology. My Background

Processing Genome Data using Scalable Database Technology. My Background Johann Christoph Freytag, Ph.D. freytag@dbis.informatik.hu-berlin.de http://www.dbis.informatik.hu-berlin.de Stanford University, February 2004 PhD @ Harvard Univ. Visiting Scientist, Microsoft Res. (2002)

More information

Database searching with DNA and protein sequences: An introduction Clare Sansom Date received (in revised form): 12th November 1999

Database searching with DNA and protein sequences: An introduction Clare Sansom Date received (in revised form): 12th November 1999 Dr Clare Sansom works part time at Birkbeck College, London, and part time as a freelance computer consultant and science writer At Birkbeck she coordinates an innovative graduate-level Advanced Certificate

More information

Three data delivery cases for EMBL- EBI s Embassy. Guy Cochrane www.ebi.ac.uk

Three data delivery cases for EMBL- EBI s Embassy. Guy Cochrane www.ebi.ac.uk Three data delivery cases for EMBL- EBI s Embassy Guy Cochrane www.ebi.ac.uk EMBL European Bioinformatics Institute Genes, genomes & variation European Nucleotide Archive 1000 Genomes Ensembl Ensembl Genomes

More information

Databases and platforms for data analysis from NGS of MTB

Databases and platforms for data analysis from NGS of MTB Databases and platforms for data analysis from NGS of MTB Derrick Crook MMM Consortium MMM Consortium Linking Clinical record systems and NHS databases Translating next generation sequencing for patient

More information

Importance of Statistics in creating high dimensional data

Importance of Statistics in creating high dimensional data Importance of Statistics in creating high dimensional data Hemant K. Tiwari, PhD Section on Statistical Genetics Department of Biostatistics University of Alabama at Birmingham History of Genomic Data

More information

Towards Integrating the Detection of Genetic Variants into an In-Memory Database

Towards Integrating the Detection of Genetic Variants into an In-Memory Database Towards Integrating the Detection of Genetic Variants into an 2nd International Workshop on Big Data in Bioinformatics and Healthcare Oct 27, 2014 Motivation Genome Data Analysis Process DNA Sample Base

More information

Comparing Methods for Identifying Transcription Factor Target Genes

Comparing Methods for Identifying Transcription Factor Target Genes Comparing Methods for Identifying Transcription Factor Target Genes Alena van Bömmel (R 3.3.73) Matthew Huska (R 3.3.18) Max Planck Institute for Molecular Genetics Folie 1 Transcriptional Regulation TF

More information

Biological Sequence Data Formats

Biological Sequence Data Formats Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA

More information

Sequencing the Human Genome

Sequencing the Human Genome Revised and Updated Edvo-Kit #339 Sequencing the Human Genome 339 Experiment Objective: In this experiment, students will read DNA sequences obtained from automated DNA sequencing techniques. The data

More information

Molecular Databases and Tools

Molecular Databases and Tools NWeHealth, The University of Manchester Molecular Databases and Tools Afternoon Session: NCBI/EBI resources, pairwise alignment, BLAST, multiple sequence alignment and primer finding. Dr. Georgina Moulton

More information

Data Analysis & Management of High-throughput Sequencing Data. Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute

Data Analysis & Management of High-throughput Sequencing Data. Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute Data Analysis & Management of High-throughput Sequencing Data Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute Current Issues Current Issues The QSEQ file Number files per

More information

PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org

PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,

More information

Bioinformatics, Sequences and Genomes

Bioinformatics, Sequences and Genomes Bioinformatics, Sequences and Genomes BL4273 Bioinformatics for Biologists Week 1 Daniel Barker, School of Biology, University of St Andrews Email db60@st-andrews.ac.uk BL4273 and 4273π 4273π is a custom

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took

More information

BIO 3352: BIOINFORMATICS II HYBRID COURSE SYLLABUS

BIO 3352: BIOINFORMATICS II HYBRID COURSE SYLLABUS BIO 3352: BIOINFORMATICS II HYBRID COURSE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title: Bioinformatics

More information

Core Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1

Core Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1 Core Bioinformatics 2014/2015 Code: 42397 ECTS Credits: 12 Degree Type Year Semester 4313473 Bioinformàtica/Bioinformatics OB 0 1 Contact Name: Sònia Casillas Viladerrams Email: Sonia.Casillas@uab.cat

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

Removing Sequential Bottlenecks in Analysis of Next-Generation Sequencing Data

Removing Sequential Bottlenecks in Analysis of Next-Generation Sequencing Data Removing Sequential Bottlenecks in Analysis of Next-Generation Sequencing Data Yi Wang, Gagan Agrawal, Gulcin Ozer and Kun Huang The Ohio State University HiCOMB 2014 May 19 th, Phoenix, Arizona 1 Outline

More information

Delivering the power of the world s most successful genomics platform

Delivering the power of the world s most successful genomics platform Delivering the power of the world s most successful genomics platform NextCODE Health is bringing the full power of the world s largest and most successful genomics platform to everyday clinical care NextCODE

More information

Version 5.0 Release Notes

Version 5.0 Release Notes Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com

More information

Databases and mapping BWA. Samtools

Databases and mapping BWA. Samtools Databases and mapping BWA Samtools FASTQ, SFF, bax.h5 ACE, FASTG FASTA BAM/SAM GFF, BED GenBank/Embl/DDJB many more File formats FASTQ Output format from Illumina and IonTorrent sequencers. Quality scores:

More information

GenBank: A Database of Genetic Sequence Data

GenBank: A Database of Genetic Sequence Data GenBank: A Database of Genetic Sequence Data Computer Science 105 Boston University David G. Sullivan, Ph.D. An Explosion of Scientific Data Scientists are generating ever increasing amounts of data. Relevant

More information

New solutions for Big Data Analysis and Visualization

New solutions for Big Data Analysis and Visualization New solutions for Big Data Analysis and Visualization From HPC to cloud-based solutions Barcelona, February 2013 Nacho Medina imedina@cipf.es http://bioinfo.cipf.es/imedina Head of the Computational Biology

More information

G E N OM I C S S E RV I C ES

G E N OM I C S S E RV I C ES GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E

More information

ACAAGGGACTAGAGAAACCAAAA AGAAACCAAAACGAAAGGTGCAGAA AACGAAAGGTGCAGAAGGGGAAACAGATGCAGA CHAPTER 3

ACAAGGGACTAGAGAAACCAAAA AGAAACCAAAACGAAAGGTGCAGAA AACGAAAGGTGCAGAAGGGGAAACAGATGCAGA CHAPTER 3 ACAAGGGACTAGAGAAACCAAAA AGAAACCAAAACGAAAGGTGCAGAA AACGAAAGGTGCAGAAGGGGAAACAGATGCAGA CHAPTER 3 GAAGGGGAAACAGATGCAGAAAGCATC AGAAAGCATC ACAAGGGACTAGAGAAACCAAAACGAAAGGTGCAGAAGGGGAAACAGATGCAGAAAGCATC Introduction

More information

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert September 24, 2013 Abstract FlipFlop implements a fast method for de novo transcript

More information

BLAST. Anders Gorm Pedersen & Rasmus Wernersson

BLAST. Anders Gorm Pedersen & Rasmus Wernersson BLAST Anders Gorm Pedersen & Rasmus Wernersson Database searching Using pairwise alignments to search databases for similar sequences Query sequence Database Database searching Most common use of pairwise

More information

Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011

Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011 Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear

More information

Biological Databases and Protein Sequence Analysis

Biological Databases and Protein Sequence Analysis Biological Databases and Protein Sequence Analysis Introduction M. Madan Babu, Center for Biotechnology, Anna University, Chennai 25, India Bioinformatics is the application of Information technology to

More information

EMBL-EBI Web Services

EMBL-EBI Web Services EMBL-EBI Web Services Rodrigo Lopez Head of the External Services Team SME Workshop Piemonte 2011 EBI is an Outstation of the European Molecular Biology Laboratory. Summary Introduction The JDispatcher

More information

Outline. MicroRNA Bioinformatics. microrna biogenesis. short non-coding RNAs not considered in this lecture. ! Introduction

Outline. MicroRNA Bioinformatics. microrna biogenesis. short non-coding RNAs not considered in this lecture. ! Introduction Outline MicroRNA Bioinformatics Rickard Sandberg Dept. of Cell and Molecular Biology (CMB) Karolinska Institutet! Introduction! microrna target site prediction! Useful resources 2 short non-coding RNAs

More information

BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16

BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16 Course Director: Dr. Barry Grant (DCM&B, bjgrant@med.umich.edu) Description: This is a three module course covering (1) Foundations of Bioinformatics, (2) Statistics in Bioinformatics, and (3) Systems

More information

Introduction to NGS data analysis

Introduction to NGS data analysis Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High

More information

PPInterFinder A Web Server for Mining Human Protein Protein Interaction

PPInterFinder A Web Server for Mining Human Protein Protein Interaction PPInterFinder A Web Server for Mining Human Protein Protein Interaction Kalpana Raja, Suresh Subramani, Jeyakumar Natarajan Data Mining and Text Mining Laboratory, Department of Bioinformatics, Bharathiar

More information

Having a BLAST: Analyzing Gene Sequence Data with BlastQuest

Having a BLAST: Analyzing Gene Sequence Data with BlastQuest Having a BLAST: Analyzing Gene Sequence Data with BlastQuest William G. Farmerie 1, Joachim Hammer 2, Li Liu 1, and Markus Schneider 2 University of Florida Gainesville, FL 32611, U.S.A. Abstract An essential

More information

Pairwise Sequence Alignment

Pairwise Sequence Alignment Pairwise Sequence Alignment carolin.kosiol@vetmeduni.ac.at SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What

More information

Bioinformatics: course introduction

Bioinformatics: course introduction Bioinformatics: course introduction Filip Železný Czech Technical University in Prague Faculty of Electrical Engineering Department of Cybernetics Intelligent Data Analysis lab http://ida.felk.cvut.cz

More information

Ontology-Driven Workflow Management for Biosequence Processing Systems

Ontology-Driven Workflow Management for Biosequence Processing Systems Ontology-Driven Workflow Management for Biosequence Processing Systems Melissa Lemos 1, Marco A. Casanova 1, Luiz Fernando Bessa Seibel 1, José Antonio F. de Macedo 1, Antonio Basílio de Miranda 2 1 Department

More information

Database schema documentation for SNPdbe

Database schema documentation for SNPdbe Database schema documentation for SNPdbe Changes 02/27/12: seqs_containingsnps.taxid removed dbsnp_snp.tax_id renamed to dbsnp_snp.taxid General information: Data in SNPdbe is organized on several levels.

More information

Introduction. Overview of Bioconductor packages for short read analysis

Introduction. Overview of Bioconductor packages for short read analysis Overview of Bioconductor packages for short read analysis Introduction General introduction SRAdb Pseudo code (Shortread) Short overview of some packages Quality assessment Example sequencing data in Bioconductor

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene

More information

Protein & DNA Sequence Analysis. Bobbie-Jo Webb-Robertson May 3, 2004

Protein & DNA Sequence Analysis. Bobbie-Jo Webb-Robertson May 3, 2004 Protein & DNA Sequence Analysis Bobbie-Jo Webb-Robertson May 3, 2004 Sequence Analysis Anything connected to identifying higher biological meaning out of raw sequence data. 2 Genomic & Proteomic Data Sequence

More information

ISSN 0103-9741. Monografias em Ciência da Computação n 27/09

ISSN 0103-9741. Monografias em Ciência da Computação n 27/09 PUC ISSN 0103-9741 Monografias em Ciência da Computação n 27/09 A Conceptual Data Model Involving Protein Sets from Complete Genomes: a biological point of view Cristian Tristão Antonio Basílio de Miranda

More information

The EcoCyc Curation Process

The EcoCyc Curation Process The EcoCyc Curation Process Ingrid M. Keseler SRI International 1 HOW OFTEN IS THE GOLDEN GATE BRIDGE PAINTED? Many misconceptions exist about how often the Bridge is painted. Some say once every seven

More information

CD-HIT User s Guide. Last updated: April 5, 2010. http://cd-hit.org http://bioinformatics.org/cd-hit/

CD-HIT User s Guide. Last updated: April 5, 2010. http://cd-hit.org http://bioinformatics.org/cd-hit/ CD-HIT User s Guide Last updated: April 5, 2010 http://cd-hit.org http://bioinformatics.org/cd-hit/ Program developed by Weizhong Li s lab at UCSD http://weizhong-lab.ucsd.edu liwz@sdsc.edu 1. Introduction

More information

Genome Science Education for Engineering Majors

Genome Science Education for Engineering Majors Genome Science Education for Engineering Majors Leslie Guadron 1, Alen M. Sajan 2, Olivia Plante 3, Stanley George 4, Yuying Gosser 5 1. Biomedical Engineering Junior, Peer-Leader, President of the Genomics

More information

UGENE Quick Start Guide

UGENE Quick Start Guide Quick Start Guide This document contains a quick introduction to UGENE. For more detailed information, you can find the UGENE User Manual and other special manuals in project website: http://ugene.unipro.ru.

More information

Gene Models & Bed format: What they represent.

Gene Models & Bed format: What they represent. GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,

More information

Lecture Outline. Introduction to Databases. Introduction. Data Formats Sample databases How to text search databases. Shifra Ben-Dor Irit Orr

Lecture Outline. Introduction to Databases. Introduction. Data Formats Sample databases How to text search databases. Shifra Ben-Dor Irit Orr Introduction to Databases Shifra Ben-Dor Irit Orr Lecture Outline Introduction Data and Database types Database components Data Formats Sample databases How to text search databases What units of information

More information

A demonstration of the use of Datagrid testbed and services for the biomedical community

A demonstration of the use of Datagrid testbed and services for the biomedical community A demonstration of the use of Datagrid testbed and services for the biomedical community Biomedical applications work package V. Breton, Y Legré (CNRS/IN2P3) R. Météry (CS) Credits : C. Blanchet, T. Contamine,

More information

Custom TaqMan Assays For New SNP Genotyping and Gene Expression Assays. Design and Ordering Guide

Custom TaqMan Assays For New SNP Genotyping and Gene Expression Assays. Design and Ordering Guide Custom TaqMan Assays For New SNP Genotyping and Gene Expression Assays Design and Ordering Guide For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in

More information

DNA and the Cell. Version 2.3. English version. ELLS European Learning Laboratory for the Life Sciences

DNA and the Cell. Version 2.3. English version. ELLS European Learning Laboratory for the Life Sciences DNA and the Cell Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Version 2.3 English version ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra Manaia and

More information

European Genome-phenome Archive database of human data consented for use in biomedical research at the European Bioinformatics Institute

European Genome-phenome Archive database of human data consented for use in biomedical research at the European Bioinformatics Institute European Genome-phenome Archive database of human data consented for use in biomedical research at the European Bioinformatics Institute Justin Paschall Team Leader Genetic Variation / EGA ! European Genome-phenome

More information

The Integrated Microbial Genomes (IMG) System: A Case Study in Biological Data Management

The Integrated Microbial Genomes (IMG) System: A Case Study in Biological Data Management The Integrated Microbial Genomes (IMG) System: A Case Study in Biological Data Management Victor M. Markowitz 1, Frank Korzeniewski 1, Krishna Palaniappan 1, Ernest Szeto 1, Natalia Ivanova 2, and Nikos

More information

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249

More information

MODULE 2: Advanced methodologies and tools for research. Research funding and innovation.

MODULE 2: Advanced methodologies and tools for research. Research funding and innovation. MODULE 2: Advanced methodologies and tools for research. Research funding and innovation. Code: 43642 Credits: 6 ECTS Type: Compulsory Language: English/Spanish Module s Coordinator: Àlex Sánchez alex.sanchez@vhir.org

More information

Next generation sequencing (NGS)

Next generation sequencing (NGS) Next generation sequencing (NGS) Vijayachitra Modhukur BIIT modhukur@ut.ee 1 Bioinformatics course 11/13/12 Sequencing 2 Bioinformatics course 11/13/12 Microarrays vs NGS Sequences do not need to be known

More information

PeptidomicsDB: a new platform for sharing MS/MS data.

PeptidomicsDB: a new platform for sharing MS/MS data. PeptidomicsDB: a new platform for sharing MS/MS data. Federica Viti, Ivan Merelli, Dario Di Silvestre, Pietro Brunetti, Luciano Milanesi, Pierluigi Mauri NETTAB2010 Napoli, 01/12/2010 Mass Spectrometry

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

OpenCB a next generation big data analytics and visualisation platform for the Omics revolution

OpenCB a next generation big data analytics and visualisation platform for the Omics revolution OpenCB a next generation big data analytics and visualisation platform for the Omics revolution Development at the University of Cambridge - Closing the Omics / Moore s law gap with Dell & Intel Ignacio

More information

GAST, A GENOMIC ALIGNMENT SEARCH TOOL

GAST, A GENOMIC ALIGNMENT SEARCH TOOL Kalle Karhu, Juho Mäkinen, Jussi Rautio, Jorma Tarhio Department of Computer Science and Engineering, Aalto University, Espoo, Finland {kalle.karhu, jorma.tarhio}@aalto.fi Hugh Salamon AbaSci, LLC, San

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information