Module 1. Sequence Formats and Retrieval. Charles Steward
|
|
- Jason Mason
- 8 years ago
- Views:
Transcription
1 The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1
2 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases. Show how to access different genomic data from a variety of databases, using UniProt and GQuery (Entrez). Introduce BLAST. 2
3 Databases Nucleotide databases: DDBJ/EMBL/NCBI form the International Nucleotide Sequence Database Collaboration and store Genomic/cDNAs/ESTs sequences. Protein database: UniProt: Swiss-Prot (manually curated) and TrEMBL (automated annotation) sequences. Accession numbers (a unique number or combination of letters and numbers assigned to each record in a database) identify such sequences. e.g. (AL034553). 3
4 Information is mirrored daily between DDBJ/EMBL/NCBI. DDBJ/EMBL/GenBank: INSDC (International Nucleotide Sequence Database). DDBJ: DNA databank of Japan. CIB-DDBJ: Centre for Information Biology and DNA Data Banks of Japan. EBI: European Bioinformatics Institute. ENA: European Nucleotide Archive contains EMBL Nucleotide Sequence Database EMBL: European Molecular Biology Laboratory. NCBI: National Centre for Biotechnology Information. IAM: International Advisory Meeting. ICM: International Collaborative Meeting. 4
5 EMBL format See abbreviation table 5
6 Abbreviations found in the EMBL flat file: 6
7 NCBI format DDBJ format 7
8 Sequence Read Archive (SRA) for next-generation sequencing submission. INSDC now accept sequence data produced by next-generation sequencing machines. This screen shot is taken from the ENA hosted at EBI. For further information go here: 8
9 NGS file formats BAM format - A BAM file (.bam) is the binary version of a SAM file bigbed format indexed BED file (1 line per feature and at least 3 columns) BigWig format used for dense continuous data and displayed as a graphwiggle plot VCF format - for variants See here for more information: Next Generation Sequencing Courses Wellcome Trust Next Generation Sequencing course 6-13 April EBI - Monday, October 14, Thursday, October 17,
10 NCBI s ENTREZ system 10
11 GQuery (Entrez) entry point 11
12 Goal: One sequence entry for each naturally occurring DNA, RNA and protein molecule chromosome NC_ contig NT_ Reference Sequences mrna NM_ predicted mrna XM_ protein NP_ predicted protein XP_ Key: curated calculated non-coding RNA NR_ predicted non-coding RNA XR_ Multiple products for one gene are instantiated as separate RefSeqs with the same LocusID. 12
13 CCDS Comparison of common CDSs to form consensus gene set QC by UCSC (filter out possible pseudogenes) Build ,752 agreed CCDS IDs CCDS set is displayed in Ensembl/Vega/UCSC/NCBI Non redundant gene set agreed by all institutes 13
14 EBI databases 14
15 EBI search: access all databases 15
16 ENA sequence window! 16
17 ENA data view See here for a clone example: 17
18 UniProt! 18
19 PE (protein existence) line Format!! PE Level: Evidence;!! Values" " 1: Evidence at protein level" " 2: Evidence at transcript level" " 3: Inferred from homology" " 4: Predicted" " 5: Uncertain" " 19
20 TrEMBL entry All information is automatically generated 20
21 Swiss-Prot entry Manually curated entry containing more information than Trembl 21
22 BLAST similarity searching Basic Local Alignment Search Tool There are many different databases available to search against, which may vary depending on which site you start from. The most commonly used BLAST site is hosted by the NCBI: 22
23 Blast output. 1) The score is a measure of the similarity of the query sequence to the subject sequence." It is calculated from the number of gaps and substitutions associated with each aligned sequence. The higher the score, the more significant the alignment. Each score links to the corresponding pairwise alignment between query sequence and subject sequence." 2) E-value is estimate of the likelihood that a sequence match with that score has occurred by chance. The E-value is calculated from the size of the sequence, database and score (or scoring system used) and so is specific to that search. Thus, two results on different databases may not be directly comparable. But the take home message: The smaller the E-value, the smaller the likelihood that it has happened at random and is therefore more likely to be real. For example: in a million searches would produce a false positive with this score in 100 searches would produce a false positive with this score 1 1 match above threshold is likely to be FP matches above threshold are FP For further details see Karlin & Altschul - PNAS :
24 Worked examples Tasks start on page 18 24
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
More informationModule 3. Genome Browsing. Using Web Browsers to View Genome Annota4on. Kers4n Howe Wellcome Trust Sanger Ins4tute zfish- help@sanger.ac.
Module 3 Genome Browsing Using Web Browsers to View Genome Annota4on Kers4n Howe Wellcome Trust Sanger Ins4tute zfish- help@sanger.ac.uk Introduc.on Genome browsing The Ensembl gene set Guided examples
More informationBIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:
More informationCommittee on WIPO Standards (CWS)
E CWS/1/5 ORIGINAL: ENGLISH DATE: OCTOBER 13, 2010 Committee on WIPO Standards (CWS) First Session Geneva, October 25 to 29, 2010 PROPOSAL FOR THE PREPARATION OF A NEW WIPO STANDARD ON THE PRESENTATION
More informationBioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
More informationNCBI resources III: GEO and ftp site. Yanbin Yin Spring 2013
NCBI resources III: GEO and ftp site Yanbin Yin Spring 2013 1 Homework assignment 2 Search colon cancer at GEO and find a data Series and perform a GEO2R analysis Write a report (in word or ppt) to include
More informationThe human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28.
Tutorial Module 5 BioMart You will learn about BioMart, a joint project developed and maintained at EBI and OiCR www.biomart.org How to use BioMart to quickly obtain lists of gene information from Ensembl
More informationWhen you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want
1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very
More informationorg.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers.
org.rn.eg.db December 16, 2015 org.rn.egaccnum Map Entrez Gene identifiers to GenBank Accession Numbers org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank
More informationGenome Viewing. Module 2. Using Genome Browsers to View Annotation of the Human Genome
Module 2 Genome Viewing Using Genome Browsers to View Annotation of the Human Genome Bert Overduin, Ph.D. PANDA Coordination & Outreach EMBL - European Bioinformatics Institute Wellcome Trust Genome Campus
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
More informationData formats and file conversions
Building Excellence in Genomics and Computational Bioscience s Richard Leggett (TGAC) John Walshaw (IFR) Common file formats FASTQ FASTA BAM SAM Raw sequence Alignments MSF EMBL UniProt BED WIG Databases
More informationBIOINFORMATICS TUTORIAL
Bio 242 BIOINFORMATICS TUTORIAL Bio 242 α Amylase Lab Sequence Sequence Searches: BLAST Sequence Alignment: Clustal Omega 3d Structure & 3d Alignments DO NOT REMOVE FROM LAB. DO NOT WRITE IN THIS DOCUMENT.
More informationThis document presents the new features available in ngklast release 4.4 and KServer 4.2.
This document presents the new features available in ngklast release 4.4 and KServer 4.2. 1) KLAST search engine optimization ngklast comes with an updated release of the KLAST sequence comparison tool.
More informationSearching Nucleotide Databases
Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames
More informationChallenges associated with analysis and storage of NGS data
Challenges associated with analysis and storage of NGS data Gabriella Rustici Research and training coordinator Functional Genomics Group gabry@ebi.ac.uk Next-generation sequencing Next-generation sequencing
More informationSimilarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003
Similarity Searches on Sequence Databases: BLAST, FASTA Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Outline Importance of Similarity Heuristic Sequence Alignment:
More informationIntroduction to Bioinformatics 2. DNA Sequence Retrieval and comparison
Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
More informationLinear Sequence Analysis. 3-D Structure Analysis
Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical properties Molecular weight (MW), isoelectric point (pi), amino acid content, hydropathy (hydrophilic
More informationThe Galaxy workflow. George Magklaras PhD RHCE
The Galaxy workflow George Magklaras PhD RHCE Biotechnology Center of Oslo & The Norwegian Center of Molecular Medicine University of Oslo, Norway http://www.biotek.uio.no http://www.ncmm.uio.no http://www.no.embnet.org
More informationGenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
More informationGenome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009
Genome and DNA Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Admin Reading: Chapters 1 & 2 Notes available in PDF format on-line (see class calendar page): http://www.soe.ucsc.edu/classes/bme110/spring09/bme110-calendar.html
More informationAGILENT S BIOINFORMATICS ANALYSIS SOFTWARE
ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS
More informationLibrary page. SRS first view. Different types of database in SRS. Standard query form
SRS & Entrez SRS Sequence Retrieval System Bengt Persson Whatis SRS? Sequence Retrieval System User-friendly interface to databases http://srs.ebi.ac.uk Developed by Thure Etzold and co-workers EMBL/EBI
More informationBasic processing of next-generation sequencing (NGS) data
Basic processing of next-generation sequencing (NGS) data Getting from raw sequence data to expression analysis! 1 Reminder: we are measuring expression of protein coding genes by transcript abundance
More informationA Tutorial in Genetic Sequence Classification Tools and Techniques
A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University jakemdrew@gmail.com www.jakemdrew.com Sequence Characters IUPAC nucleotide
More informationA Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques
Proceedings of the 2007 WSEAS International Conference on Computer Engineering and Applications, Gold Coast, Australia, January 17-19, 2007 402 A Multiple DNA Sequence Translation Tool Incorporating Web
More informationID of alternative translational initiation events. Description of gene function Reference of NCBI database access and relative literatures
Data resource: In this database, 650 alternatively translated variants assigned to a total of 300 genes are contained. These database records of alternative translational initiation have been collected
More informationBioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
More informationSRA File Formats Guide
SRA File Formats Guide Version 1.1 10 Mar 2010 National Center for Biotechnology Information National Library of Medicine EMBL European Bioinformatics Institute DNA Databank of Japan 1 Contents SRA File
More informationSUBMITTING DNA SEQUENCES TO THE DATABASES
Bioinformatics: A Practical Guide to the Analysis of Genes and Proteins, Second Edition Andreas D. Baxevanis, B.F. Francis Ouellette Copyright 2001 John Wiley & Sons, Inc. ISBNs: 0-471-38390-2 (Hardback);
More informationSGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD
White Paper SGI High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems Haruna Cofer*, PhD January, 2012 Abstract The SGI High Throughput Computing (HTC) Wrapper
More informationFocusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
More informationAn agent-based layered middleware as tool integration
An agent-based layered middleware as tool integration Flavio Corradini Leonardo Mariani Emanuela Merelli University of L Aquila University of Milano University of Camerino ITALY ITALY ITALY Helsinki FSE/ESEC
More informationTHE UNIVERSITY OF MANCHESTER Unit Specification
1. GENERAL INFORMATION Title Unit code Credit rating 15 Level 7 Contact hours 30 Other Scheduled teaching and learning activities* Pre-requisite units Co-requisite units School responsible Member of staff
More informationScientific databases. Biological data management
Scientific databases Biological data management The term paper within the framework of the course Principles of Modern Database Systems by Aleksejs Kontijevskis PhD student The Linnaeus Centre for Bioinformatics
More informationTutorial. Reference Genome Tracks. Sample to Insight. November 27, 2015
Reference Genome Tracks November 27, 2015 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com Reference
More informationProcessing Genome Data using Scalable Database Technology. My Background
Johann Christoph Freytag, Ph.D. freytag@dbis.informatik.hu-berlin.de http://www.dbis.informatik.hu-berlin.de Stanford University, February 2004 PhD @ Harvard Univ. Visiting Scientist, Microsoft Res. (2002)
More informationDatabase searching with DNA and protein sequences: An introduction Clare Sansom Date received (in revised form): 12th November 1999
Dr Clare Sansom works part time at Birkbeck College, London, and part time as a freelance computer consultant and science writer At Birkbeck she coordinates an innovative graduate-level Advanced Certificate
More informationThree data delivery cases for EMBL- EBI s Embassy. Guy Cochrane www.ebi.ac.uk
Three data delivery cases for EMBL- EBI s Embassy Guy Cochrane www.ebi.ac.uk EMBL European Bioinformatics Institute Genes, genomes & variation European Nucleotide Archive 1000 Genomes Ensembl Ensembl Genomes
More informationDatabases and platforms for data analysis from NGS of MTB
Databases and platforms for data analysis from NGS of MTB Derrick Crook MMM Consortium MMM Consortium Linking Clinical record systems and NHS databases Translating next generation sequencing for patient
More informationImportance of Statistics in creating high dimensional data
Importance of Statistics in creating high dimensional data Hemant K. Tiwari, PhD Section on Statistical Genetics Department of Biostatistics University of Alabama at Birmingham History of Genomic Data
More informationTowards Integrating the Detection of Genetic Variants into an In-Memory Database
Towards Integrating the Detection of Genetic Variants into an 2nd International Workshop on Big Data in Bioinformatics and Healthcare Oct 27, 2014 Motivation Genome Data Analysis Process DNA Sample Base
More informationComparing Methods for Identifying Transcription Factor Target Genes
Comparing Methods for Identifying Transcription Factor Target Genes Alena van Bömmel (R 3.3.73) Matthew Huska (R 3.3.18) Max Planck Institute for Molecular Genetics Folie 1 Transcriptional Regulation TF
More informationBiological Sequence Data Formats
Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA
More informationSequencing the Human Genome
Revised and Updated Edvo-Kit #339 Sequencing the Human Genome 339 Experiment Objective: In this experiment, students will read DNA sequences obtained from automated DNA sequencing techniques. The data
More informationMolecular Databases and Tools
NWeHealth, The University of Manchester Molecular Databases and Tools Afternoon Session: NCBI/EBI resources, pairwise alignment, BLAST, multiple sequence alignment and primer finding. Dr. Georgina Moulton
More informationData Analysis & Management of High-throughput Sequencing Data. Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute
Data Analysis & Management of High-throughput Sequencing Data Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute Current Issues Current Issues The QSEQ file Number files per
More informationPROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org
BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,
More informationBioinformatics, Sequences and Genomes
Bioinformatics, Sequences and Genomes BL4273 Bioinformatics for Biologists Week 1 Daniel Barker, School of Biology, University of St Andrews Email db60@st-andrews.ac.uk BL4273 and 4273π 4273π is a custom
More informationNext Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took
More informationBIO 3352: BIOINFORMATICS II HYBRID COURSE SYLLABUS
BIO 3352: BIOINFORMATICS II HYBRID COURSE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title: Bioinformatics
More informationCore Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1
Core Bioinformatics 2014/2015 Code: 42397 ECTS Credits: 12 Degree Type Year Semester 4313473 Bioinformàtica/Bioinformatics OB 0 1 Contact Name: Sònia Casillas Viladerrams Email: Sonia.Casillas@uab.cat
More informationIntroduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
More informationRemoving Sequential Bottlenecks in Analysis of Next-Generation Sequencing Data
Removing Sequential Bottlenecks in Analysis of Next-Generation Sequencing Data Yi Wang, Gagan Agrawal, Gulcin Ozer and Kun Huang The Ohio State University HiCOMB 2014 May 19 th, Phoenix, Arizona 1 Outline
More informationDelivering the power of the world s most successful genomics platform
Delivering the power of the world s most successful genomics platform NextCODE Health is bringing the full power of the world s largest and most successful genomics platform to everyday clinical care NextCODE
More informationVersion 5.0 Release Notes
Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com
More informationDatabases and mapping BWA. Samtools
Databases and mapping BWA Samtools FASTQ, SFF, bax.h5 ACE, FASTG FASTA BAM/SAM GFF, BED GenBank/Embl/DDJB many more File formats FASTQ Output format from Illumina and IonTorrent sequencers. Quality scores:
More informationGenBank: A Database of Genetic Sequence Data
GenBank: A Database of Genetic Sequence Data Computer Science 105 Boston University David G. Sullivan, Ph.D. An Explosion of Scientific Data Scientists are generating ever increasing amounts of data. Relevant
More informationNew solutions for Big Data Analysis and Visualization
New solutions for Big Data Analysis and Visualization From HPC to cloud-based solutions Barcelona, February 2013 Nacho Medina imedina@cipf.es http://bioinfo.cipf.es/imedina Head of the Computational Biology
More informationG E N OM I C S S E RV I C ES
GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E
More informationACAAGGGACTAGAGAAACCAAAA AGAAACCAAAACGAAAGGTGCAGAA AACGAAAGGTGCAGAAGGGGAAACAGATGCAGA CHAPTER 3
ACAAGGGACTAGAGAAACCAAAA AGAAACCAAAACGAAAGGTGCAGAA AACGAAAGGTGCAGAAGGGGAAACAGATGCAGA CHAPTER 3 GAAGGGGAAACAGATGCAGAAAGCATC AGAAAGCATC ACAAGGGACTAGAGAAACCAAAACGAAAGGTGCAGAAGGGGAAACAGATGCAGAAAGCATC Introduction
More informationFlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem
FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert September 24, 2013 Abstract FlipFlop implements a fast method for de novo transcript
More informationBLAST. Anders Gorm Pedersen & Rasmus Wernersson
BLAST Anders Gorm Pedersen & Rasmus Wernersson Database searching Using pairwise alignments to search databases for similar sequences Query sequence Database Database searching Most common use of pairwise
More informationSequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011
Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear
More informationBiological Databases and Protein Sequence Analysis
Biological Databases and Protein Sequence Analysis Introduction M. Madan Babu, Center for Biotechnology, Anna University, Chennai 25, India Bioinformatics is the application of Information technology to
More informationEMBL-EBI Web Services
EMBL-EBI Web Services Rodrigo Lopez Head of the External Services Team SME Workshop Piemonte 2011 EBI is an Outstation of the European Molecular Biology Laboratory. Summary Introduction The JDispatcher
More informationOutline. MicroRNA Bioinformatics. microrna biogenesis. short non-coding RNAs not considered in this lecture. ! Introduction
Outline MicroRNA Bioinformatics Rickard Sandberg Dept. of Cell and Molecular Biology (CMB) Karolinska Institutet! Introduction! microrna target site prediction! Useful resources 2 short non-coding RNAs
More informationBIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16
Course Director: Dr. Barry Grant (DCM&B, bjgrant@med.umich.edu) Description: This is a three module course covering (1) Foundations of Bioinformatics, (2) Statistics in Bioinformatics, and (3) Systems
More informationIntroduction to NGS data analysis
Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High
More informationPPInterFinder A Web Server for Mining Human Protein Protein Interaction
PPInterFinder A Web Server for Mining Human Protein Protein Interaction Kalpana Raja, Suresh Subramani, Jeyakumar Natarajan Data Mining and Text Mining Laboratory, Department of Bioinformatics, Bharathiar
More informationHaving a BLAST: Analyzing Gene Sequence Data with BlastQuest
Having a BLAST: Analyzing Gene Sequence Data with BlastQuest William G. Farmerie 1, Joachim Hammer 2, Li Liu 1, and Markus Schneider 2 University of Florida Gainesville, FL 32611, U.S.A. Abstract An essential
More informationPairwise Sequence Alignment
Pairwise Sequence Alignment carolin.kosiol@vetmeduni.ac.at SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What
More informationBioinformatics: course introduction
Bioinformatics: course introduction Filip Železný Czech Technical University in Prague Faculty of Electrical Engineering Department of Cybernetics Intelligent Data Analysis lab http://ida.felk.cvut.cz
More informationOntology-Driven Workflow Management for Biosequence Processing Systems
Ontology-Driven Workflow Management for Biosequence Processing Systems Melissa Lemos 1, Marco A. Casanova 1, Luiz Fernando Bessa Seibel 1, José Antonio F. de Macedo 1, Antonio Basílio de Miranda 2 1 Department
More informationDatabase schema documentation for SNPdbe
Database schema documentation for SNPdbe Changes 02/27/12: seqs_containingsnps.taxid removed dbsnp_snp.tax_id renamed to dbsnp_snp.taxid General information: Data in SNPdbe is organized on several levels.
More informationIntroduction. Overview of Bioconductor packages for short read analysis
Overview of Bioconductor packages for short read analysis Introduction General introduction SRAdb Pseudo code (Shortread) Short overview of some packages Quality assessment Example sequencing data in Bioconductor
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene
More informationProtein & DNA Sequence Analysis. Bobbie-Jo Webb-Robertson May 3, 2004
Protein & DNA Sequence Analysis Bobbie-Jo Webb-Robertson May 3, 2004 Sequence Analysis Anything connected to identifying higher biological meaning out of raw sequence data. 2 Genomic & Proteomic Data Sequence
More informationISSN 0103-9741. Monografias em Ciência da Computação n 27/09
PUC ISSN 0103-9741 Monografias em Ciência da Computação n 27/09 A Conceptual Data Model Involving Protein Sets from Complete Genomes: a biological point of view Cristian Tristão Antonio Basílio de Miranda
More informationThe EcoCyc Curation Process
The EcoCyc Curation Process Ingrid M. Keseler SRI International 1 HOW OFTEN IS THE GOLDEN GATE BRIDGE PAINTED? Many misconceptions exist about how often the Bridge is painted. Some say once every seven
More informationCD-HIT User s Guide. Last updated: April 5, 2010. http://cd-hit.org http://bioinformatics.org/cd-hit/
CD-HIT User s Guide Last updated: April 5, 2010 http://cd-hit.org http://bioinformatics.org/cd-hit/ Program developed by Weizhong Li s lab at UCSD http://weizhong-lab.ucsd.edu liwz@sdsc.edu 1. Introduction
More informationGenome Science Education for Engineering Majors
Genome Science Education for Engineering Majors Leslie Guadron 1, Alen M. Sajan 2, Olivia Plante 3, Stanley George 4, Yuying Gosser 5 1. Biomedical Engineering Junior, Peer-Leader, President of the Genomics
More informationUGENE Quick Start Guide
Quick Start Guide This document contains a quick introduction to UGENE. For more detailed information, you can find the UGENE User Manual and other special manuals in project website: http://ugene.unipro.ru.
More informationGene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
More informationLecture Outline. Introduction to Databases. Introduction. Data Formats Sample databases How to text search databases. Shifra Ben-Dor Irit Orr
Introduction to Databases Shifra Ben-Dor Irit Orr Lecture Outline Introduction Data and Database types Database components Data Formats Sample databases How to text search databases What units of information
More informationA demonstration of the use of Datagrid testbed and services for the biomedical community
A demonstration of the use of Datagrid testbed and services for the biomedical community Biomedical applications work package V. Breton, Y Legré (CNRS/IN2P3) R. Météry (CS) Credits : C. Blanchet, T. Contamine,
More informationCustom TaqMan Assays For New SNP Genotyping and Gene Expression Assays. Design and Ordering Guide
Custom TaqMan Assays For New SNP Genotyping and Gene Expression Assays Design and Ordering Guide For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in
More informationDNA and the Cell. Version 2.3. English version. ELLS European Learning Laboratory for the Life Sciences
DNA and the Cell Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Version 2.3 English version ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra Manaia and
More informationEuropean Genome-phenome Archive database of human data consented for use in biomedical research at the European Bioinformatics Institute
European Genome-phenome Archive database of human data consented for use in biomedical research at the European Bioinformatics Institute Justin Paschall Team Leader Genetic Variation / EGA ! European Genome-phenome
More informationThe Integrated Microbial Genomes (IMG) System: A Case Study in Biological Data Management
The Integrated Microbial Genomes (IMG) System: A Case Study in Biological Data Management Victor M. Markowitz 1, Frank Korzeniewski 1, Krishna Palaniappan 1, Ernest Szeto 1, Natalia Ivanova 2, and Nikos
More informationTutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment
Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249
More informationMODULE 2: Advanced methodologies and tools for research. Research funding and innovation.
MODULE 2: Advanced methodologies and tools for research. Research funding and innovation. Code: 43642 Credits: 6 ECTS Type: Compulsory Language: English/Spanish Module s Coordinator: Àlex Sánchez alex.sanchez@vhir.org
More informationNext generation sequencing (NGS)
Next generation sequencing (NGS) Vijayachitra Modhukur BIIT modhukur@ut.ee 1 Bioinformatics course 11/13/12 Sequencing 2 Bioinformatics course 11/13/12 Microarrays vs NGS Sequences do not need to be known
More informationPeptidomicsDB: a new platform for sharing MS/MS data.
PeptidomicsDB: a new platform for sharing MS/MS data. Federica Viti, Ivan Merelli, Dario Di Silvestre, Pietro Brunetti, Luciano Milanesi, Pierluigi Mauri NETTAB2010 Napoli, 01/12/2010 Mass Spectrometry
More informationA Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
More informationOpenCB a next generation big data analytics and visualisation platform for the Omics revolution
OpenCB a next generation big data analytics and visualisation platform for the Omics revolution Development at the University of Cambridge - Closing the Omics / Moore s law gap with Dell & Intel Ignacio
More informationGAST, A GENOMIC ALIGNMENT SEARCH TOOL
Kalle Karhu, Juho Mäkinen, Jussi Rautio, Jorma Tarhio Department of Computer Science and Engineering, Aalto University, Espoo, Finland {kalle.karhu, jorma.tarhio}@aalto.fi Hugh Salamon AbaSci, LLC, San
More informationTranslation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
More information