Introduction to Bioinformatics 3. DNA editing and contig assembly
|
|
|
- Shanon Francis
- 9 years ago
- Views:
Transcription
1 Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD What we will cover today DNA editing Phred Sequence assembly (Contig building) Phrap Consed CAP3 DNA Star - commercial software
2 What we will cover today DNA Sequencing software DNA sequence assembly Similarity searching with a DNA sequence BLAST You cloned a cdna Isolated mrna Reverse transcribed Placed into vector Transformed and grew bacteria Harvested plasmid Sequenced insert
3 DNA sequence analysis Is full-length cdna cloned? What are its properties What is function of encoded protein? Are there family members? Is it cloned from other organisms?
4 DNA sequence analysis DNA sequencing software Phred Reads DNA sequencer trace files, calls bases, assigns quality values to each called base (for Phred, Phrap, Consed) Phrap A program for assembling shotgun DNA sequence data into contig sequence; provides consensus quality estimates Consed/Autofinish A tool for viewing, editing, and finishing sequence assemblies CAP3 Assembly program Sequence assembly
5 DNA editing and sequence assembly - building contiguous sequences (contigs) Phil Green Genome Sciences, University of Washington Provides software and documentation
6 Phred Software reads sequencing trace files Calls bases Assigns a quality value to each called base Correct and incorrect base calls Quality values allow sequence trimming Works with Amersham Biosciences, Applied Biosystems, Beckman, LI-COR Life Sciences instruments Which base reads are reliable GATCATGAGCTC Phred
7 Vector sequences must be trimmed from both ends Poor quality bases must be edited PolyA tail indicates 3 end PolyT tail indicates 3 end reverse sequence 5 end TTTATCATGGCTGCCCCTAGGGGCGAT GAATGATCGTATGCCAGCTAAAAAAA AAAATCCGCCG 3 end From 5 end: ATG = methionine - possible start site TGA=STOP site AAAAA = possible polya tail Remaining 3 sequence may be cloning vector sequence
8 Phrap Assembling shotgun DNA sequence data Improves assembly accuracy in presence of repeats Provides extensive assembly information to assist in trouble-shooting assembly problems Handles large data sets Consed Automatically chooses finishing reads Speeds up finishing Integrated with Phrap DNA editing more efficient
9 Sequence from your cdna clone TACAGCGCGTCCCCCTCCGGCGTCGCGCTTCTCGATTCCAAGGGGAATGTTTTT AAAGGCTCTTACATTGAGTCCGCTGCTTATAACCCCAGCTTGGGACCGCTTCA GGCCGCCATCGTCGCCTTCATCGCCGGCGGCGGTGGGGATTATGAAGAGATTG TTGCGGCGGTGTTGGTGGAGAAGGAAGGGGCGGTCATCAAACAGGATCACAC TGCAAGGTTGCTGCTCCATTCCATAGCGCCACGCTGCCACTTCAACAATTTTCT TGCTTCTCAATCTC
10 DNA sequence assembly PHRAP ConSED CAP3 DNASTAR by Lasergene Commercial - Sequencher- commercial automated sequencers - Sequencher protocol cystein protease GGAGCTCCACCGCGGTGGCGGCCGTTCTAGAACTAGTGGATCCCCCGGGCTGCAGGAATTCGGCACCAGAACAGTGG GAG GGAGATCCAAAAAGAGAGAGTGGAAAAGATGGCGCGGTTGATCACAGTGGTGTGGTGCGCGGTGGCGGTGCTATTATG CG CCGCGGCCGGTGCGTCGTGGGTGGAGGAGGCGGCGAACCCGATACGAATGGTGTCTGGCGTGGAGGCGGAGGTGGTTC GG GTGATCGGGGAGTGCCGGCGTGCGTTGAAGTTTGCTAGGTTCGTGAGCAGGTTCGGGAAGAGTTACCAAAGCGAGGAA GA GATGAAGAGAGGTACGAGATATTCTCGCAGAATCTCAGGTTCATCCGCTCCCACAACAAGAAGCGTTTGCCCTATACTC T CTCTGTTAATCATTGTGCTGATTGGACTTGGGAGGAGTTCAAAAGACACAGACTAGGAGCTGCCCAAAATTGCTCTGCC A CTCTTAACGGCAACCACAAGCTCACCGATGCTGTTCTTCCTCCAACGAAAGACTGGAGAAAAGAAGGTATAGTGAGTT CA GTTAAAGATCAAGGCAGCTGCGGATCATGCTGGACATTCAGCACAACTGGGGCTTTAGAAGCAGCCTATGCACAAGCA TT TGGGAAGAGTATCTCTCTTTCTGAGCAGCAGCTAGTGGACTGTGCTGGCCCTTTCAACAACTTTGGCTGCCATGGTGGG T TGCCATCACAAGCCTTTGAGTACATTAAATACAATGGTGGACTAGAGACAGAGGAAGCATATCCCTACACAGGAAAAG AT GGTGTCTGCAAATTCTCAGCTGAAAATGTTGCTGTTCAAGTCCTTGACTCTGTGAATATCACCTTGGGTGCTGAAGATG A ACTAAAACATGCAGTTGCATTTGTTCGGCCAGTTAGTGTGGCCTTTCAGGTGGTGAATGGGTTCCATTTCTACGAGAAT G GAGTTTTCACTAGTGACACTTGTGGTAGCACTTCCCAGGATGTGAACCATGCCGTTCTTGCTGTTGGATATGGAGTTGA A AATGGTGTCCCATATTGGCTCATAAAAAATTCATGGGGAGAAAGCTGGGGTGAAAATGGCTACTTCAAGATGGAATTG GG GAAGAACATGTGTGGTGTTGCAACTTGTGCATCTTATCCAATTGTGGCATAAATTGCATAACAATATGGTCCCTGGTGA C TACCACCTTGTCATGCTTCAGAGTTTAGAGCGTATTGCTGATGCCAGTATTGATGAATGATGATTAAAGATAAGTGTAA T TGTATGATGAAAATTGCTCCTAGTTGGGTTGGCATGATGTATAAAATAAGCTAGAAGTTGTTGTAAATCACATAAGTAT A TTATGGCCTTAATTGTGTGTATCACAGACATAATAACGATCATATATTGATAGTTCATAGTTACATATTGTATTGTATTG ATGCTCCCGCTTCAAATATCAGTTATAAGATAGCATTGTCTTTGCTACTTTGCACTATGCAACATTATT
11 Sequence Alignments Why do DNA sequence alignments? If your sequence is not full length, then add other expressed sequence tags (ESTs) to build full-length clone Can identify mismatches for single nucleotide polymorphism (SNP) discovery Provide a measure of relatedness between nucleotide sequences Usually protein alignments with other proteins are used to determining relatedness that allows the drawing of biological inferences regarding Structural relationships Functional relationships Evolutionary relationships
12 Similarity A quantitative measure Based on an observable Usually expressed as percent identity Quantifies changes that occur as two sequences diverge Substitutions Insertions Deletions Identifies residues crucial for maintaining a protein s structure or function Similarity High degrees of similarity might imply A common evolutionary history A possible commonality in biological function
13 Homology Implies an evolutionary relationship Hay apply to the relationship Between genes separated by the event of speciation (orthology), ie. orthologous genes Between genes separated by the event of genetic duplication (paralogy), ie. paralogous genes Orthologs Sequences are direct descendants of a sequence in a common ancestor Most likely have similar domain structure, three dimensional structure, and biological function Paralogs Related through a gene duplication event Provides insight into evolution, ie. adapting a preexisting gene product for a new function
14 Global Sequence Alignments Sequence comparison along the entire length of two sequences being aligned Best for highly similar sequences of similar length As the degree of sequence similarity declines, global alignment methods tend to miss relationships Local Sequence Alignments Sequence comparison intended to find the most similar regions in two sequences being aligned Regions outside the area of local alignment are excluded More than one local alignment could be generated Best for sequences that share some similarity or for sequences of different lengths
15 Scoring Matrices Empirical weighting scheme to represent biology DNA only has A,T,G,C Protein has amino acids; relatedness among amino acids; function; charges; side groups
16 Sequence alignment Building a contiguous sequence contig Building a contig ESTs must be from the same gene, not a paralog (gene duplication event) ESTs must be of high quality sequence After a contig is constructed, the sequence should be confirmed by cloning and sequencing
17 EST 1: gagcctatgccgtccgagattacgggcttacaggattcagatt EST 2: ggacccaagtttcacgtccaatattgtgttgaccatagaaaaaaaaa EST 3: acgggcttacaggattcagattcatggacccaagtttcacgtc EST alignment to make contig EST 1: gagcctatgccgtccgagattacgggcttacaggattcagatt EST 3: acgggcttacaggattcagattcatggacccaagtttcacgtc EST2: ggacccaagtttcacgtccaatattgtgttgacc atagaaaaaaaaa Consensus sequence: gagcctatgcgtccgagattacgggcttacaggattcagattcatggaccaagttcacgtccaatattgtgttgaccata gaaaaaaaaa In this example EST 3 forms a bridge to connect EST 1 and EST 2
18 DNA STAR EXAMPLE Making a contig from EST sequences This is your sequence from a clone 1 aactattagg ccttcgtccc tccgtcaagc gttacatgat gtaccaacaa ggctgctttg 61 ccggtggcac ggtgcttcgt ttggccaaag acctcgctga aaacaacaag ggtgctcgcg 121 tgcttgtcgt ttgttctgag atcaccgcag tcacattccg cggcccaact gacacccatc 181 ttgatagcct tgtgggtcaa gccttgtttg gagatggtgc agccgctgtc attgttggat 241 cagacccctt accagttgaa aagcctttgt ttcagcttat ctggactgcc caaacaatcc 301 ttccagacag tgaaggggct attgatggcc accttcgcga agttggactc actttccatc 361 tcctcaagga tgttcctgga ctcatctcta agaatattga gaaggccttg gttgaagcct 421 tccaaccctt gggaatctcc gattacaatt ctatcttctg gattgcacac cct
19 Step 1:Go to BLAST search Step 2: Paste sequence
20 Step 3: Set constraints and options
21 Step 4: BLAST!
22
23
24 Collect sequences into a series of files so they can be aligned File 1. 1 aactattagg ccttcgtccc tccgtcaagc gttacatgat gtaccaacaa ggctgctttg 61 ccggtggcac ggtgcttcgt ttggccaaag acctcgctga aaacaacaag ggtgctcgcg 121 tgcttgtcgt ttgttctgag atcaccgcag tcacattccg cggcccaact gacacccatc 181 ttgatagcct tgtgggtcaa gccttgtttg gagatggtgc agccgctgtc attgttggat 241 cagacccctt accagttgaa aagcctttgt ttcagcttat ctggactgcc caaacaatcc 301 ttccagacag tgaaggggct attgatggcc accttcgcga agttggactc actttccatc 361 tcctcaagga tgttcctgga ctcatctcta agaatattga gaaggccttg gttgaagcct 421 tccaaccctt gggaatctcc gattacaatt ctatcttctg gattgcacac cct File 2 1 ggcaatcaag gaatggggtc aacccaagtc caagattacc catctcatct tttgcaccac 61 tagtggtgtc gacatgcctg gtgctgatta tcagctcact aaactattag gccttcgtcc 121 ctccgtcaag cgttacatga tgtaccaaca aggctgcttt gccggtggca cggtgcttcg 181 tttggccaaa gacctcgctg aaaacaacaa gggtgctcgc gtgcttgtcg tttgttctga 241 gatcaccgca gtcacattcc gcggcccaat tgacacccat cttgatagcc ttgtgggtca 301 agccttgttt ggagatggtg cagccgctgt cattgttgga tcagacccct taccagttga 361 aaagcctttg tttcagctta tctggactgc ccaaacaatc cttccagaca gtgaaggggc 421 tattgatggc caccttcgcg aagttggact cactttccat ctcctcaagg atgttcctgg 481 actcatctct aagaatattg agaaggcttt ggttgaagcc ttccaaccct tgggaatctc 541 cgattacaat tctatcttct ggattgcaca ccctggtgga cccgcaattt tggaccaagt 601 tgaggctaag ttaggcttga agcctgaaaa aatggaagct actagacatg tgctcagcga 661 gtatggtaac atgt File 3 1 tgtggaggta ccaaagttgg gaaaagaggc tgcaactaag gcaatcaagg aatggggtca 61 acccaagtcc aagattaccc atctcatctt ttgcaccact agtggtgtcg acatgcctgg 121 tgctgattat cagctcacta aactattagg ccttcgtccc tccgtcaagc gttacatgat 181 gtaccaacaa ggctgctttg ccggtggcac ggtgcttcgt ttggccaaag acctcgctga 241 aaacaacaag ggtgctcgcg tgcttgtcgt ttgttctgag atcaccgcag tcacattccg 301 cggcccaact gacacccatc ttgatagcct tgtgggtcaa gccttgtttg gagatggtgc 361 agccgctgtc attgttggat cagacccctt accagttgaa aagcctttgt ttcagcttat 421 ctggactgcc caaacaatcc ttccagacag tgaaggggct attgatggcc accttcgcga 481 agttggactc actttccatc tcctcaagga tgttcctgga ctcatctcta agaatattga 541 gaaggccttg gttgaagcct tcccaccctt gggaatctcc gattacaatt ctatcttctg 601 g
25 Edit sequence DNA STAR Allows you to import and edit DNA and protein sequences Megalign Allows you to align DNA and protein sequences Edit Sequence
26
27 Megalign
28 CAP EST Assembler Contig Assembly Program Can use up to 30,000 EST sequences Fragment maximum is 30,000 bp Sequences must be in FASTA format Huang, X Genomics 14: Huang, X Genomics 33: 21-31
29 Edit file Some DNA and protein alignment software requires a specific format FASTA format Header HAS TO start with > A description should follow For DNA only five letters A,C,T,G,N allowed No numbers >soybean1 ATTCCTTAGGATC >soybean 2 TCCGTCAGGTGTT >soybean3 GGCTATGGCCTAAT
30
31 What we learned today DNA editing Phred Phrap Consed DNA Sequencing software DNA sequence assembly Similarity searching with a DNA sequence BLAST
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Geospiza s Finch-Server: A Complete Data Management System for DNA Sequencing
KOO10 5/31/04 12:17 PM Page 131 10 Geospiza s Finch-Server: A Complete Data Management System for DNA Sequencing Sandra Porter, Joe Slagel, and Todd Smith Geospiza, Inc., Seattle, WA Introduction The increased
A Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
4.2.1. What is a contig? 4.2.2. What are the contig assembly programs?
Table of Contents 4.1. DNA Sequencing 4.1.1. Trace Viewer in GCG SeqLab Table. Box. Select the editor mode in the SeqLab main window. Import sequencer trace files from the File menu. Select the trace files
Pairwise Sequence Alignment
Pairwise Sequence Alignment [email protected] SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What
Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison
Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]
Gene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
GenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
Version 5.0 Release Notes
Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com
AS4.1 190509 Replaces 260806 Page 1 of 50 ATF. Software for. DNA Sequencing. Operators Manual. Assign-ATF is intended for Research Use Only (RUO):
Replaces 260806 Page 1 of 50 ATF Software for DNA Sequencing Operators Manual Replaces 260806 Page 2 of 50 1 About ATF...5 1.1 Compatibility...5 1.1.1 Computer Operator Systems...5 1.1.2 DNA Sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
Genomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
Final Project Report
CPSC545 by Introduction to Data Mining Prof. Martin Schultz & Prof. Mark Gerstein Student Name: Yu Kor Hugo Lam Student ID : 904907866 Due Date : May 7, 2007 Introduction Final Project Report Pseudogenes
SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications
Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core
DNA Sequencing Services Pre-Mixed o Provide template and primer, mixed into the same tube* Pre-Defined o Provide template and primer in separate tubes* Custom o Full-service for samples with unknown concentration
Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
Becker Muscular Dystrophy
Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency
Vector NTI Advance 11 Quick Start Guide
Vector NTI Advance 11 Quick Start Guide Catalog no. 12605050, 12605099, 12605103 Version 11.0 December 15, 2008 12605022 Published by: Invitrogen Corporation 5791 Van Allen Way Carlsbad, CA 92008 U.S.A.
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
A data management framework for the Fungal Tree of Life
Web Accessible Sequence Analysis for Biological Inference A data management framework for the Fungal Tree of Life Kauff F, Cox CJ, Lutzoni F. 2007. WASABI: An automated sequence processing system for multi-gene
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:
BUDAPEST: Bioinformatics Utility for Data Analysis of Proteomics using ESTs
BUDAPEST: Bioinformatics Utility for Data Analysis of Proteomics using ESTs Richard J. Edwards 2008. Contents 1. Introduction... 2 1.1. Version...2 1.2. Using this Manual...2 1.3. Why use BUDAPEST?...2
Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment
Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249
Biotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
Introduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
How Sequencing Experiments Fail
How Sequencing Experiments Fail v1.0 Simon Andrews [email protected] Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine
Next generation sequencing (NGS)
Next generation sequencing (NGS) Vijayachitra Modhukur BIIT [email protected] 1 Bioinformatics course 11/13/12 Sequencing 2 Bioinformatics course 11/13/12 Microarrays vs NGS Sequences do not need to be known
Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003
Similarity Searches on Sequence Databases: BLAST, FASTA Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Outline Importance of Similarity Heuristic Sequence Alignment:
Module 1. Sequence Formats and Retrieval. Charles Steward
The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.
European Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
DNA sequencing is the process of determining the precise order of the nucleotide bases in a particular DNA molecule. In 1974, two methods of DNA
BIO440 Genetics Laboratory DNA sequencing DNA sequencing is the process of determining the precise order of the nucleotide bases in a particular DNA molecule. In 1974, two methods of DNA sequencing were
Module 10: Bioinformatics
Module 10: Bioinformatics 1.) Goal: To understand the general approaches for basic in silico (computer) analysis of DNA- and protein sequences. We are going to discuss sequence formatting required prior
Human Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
Innovations in Molecular Epidemiology
Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether
An example of bioinformatics application on plant breeding projects in Rijk Zwaan
An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on
Guide for Bioinformatics Project Module 3
Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first
Recombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
Next Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University [email protected] http://tandem.bu.edu/ The Human Genome Project took
Clone Manager. Getting Started
Clone Manager for Windows Professional Edition Volume 2 Alignment, Primer Operations Version 9.5 Getting Started Copyright 1994-2015 Scientific & Educational Software. All rights reserved. The software
DNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
July 7th 2009 DNA sequencing
July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer
Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at
Woods Hole Zebrafish Genetics and Development Bioinformatics/Genomics Lab Ian Woods Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at http://faculty.ithaca.edu/iwoods/docs/wh/
SGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD
White Paper SGI High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems Haruna Cofer*, PhD January, 2012 Abstract The SGI High Throughput Computing (HTC) Wrapper
Software review. Analysis for free: Comparing programs for sequence analysis
Analysis for free: Comparing programs for sequence analysis Keywords: sequence comparison tools, alignment, annotation, freeware, sequence analysis Abstract Programs to import, manage and align sequences
Algorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
Concluding lesson. Student manual. What kind of protein are you? (Basic)
Concluding lesson Student manual What kind of protein are you? (Basic) Part 1 The hereditary material of an organism is stored in a coded way on the DNA. This code consists of four different nucleotides:
RESTRICTION DIGESTS Based on a handout originally available at
RESTRICTION DIGESTS Based on a handout originally available at http://genome.wustl.edu/overview/rst_digest_handout_20050127/restrictiondigest_jan2005.html What is a restriction digests? Cloned DNA is cut
Next Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
An Overview of DNA Sequencing
An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure
Description: Molecular Biology Services and DNA Sequencing
Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:
The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics
The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long
Difficult DNA Templates Sequencing. Primer Walking Service
Difficult DNA Templates Sequencing Primer Walking Service Result 16/18s (ITS 5.8s) rrna Sequencing Phylogenetic tree 16s rrna Region ITS rrna Region ITS and 26s rrna Region Order and Result Cloning Service
DNA Sequencing Troubleshooting Guide
DNA Sequencing Troubleshooting Guide Successful DNA Sequencing Read Peaks are well formed and separated with good quality scores. There is a small area at the beginning of the run before the chemistry
CD-HIT User s Guide. Last updated: April 5, 2010. http://cd-hit.org http://bioinformatics.org/cd-hit/
CD-HIT User s Guide Last updated: April 5, 2010 http://cd-hit.org http://bioinformatics.org/cd-hit/ Program developed by Weizhong Li s lab at UCSD http://weizhong-lab.ucsd.edu [email protected] 1. Introduction
Biological Sequence Data Formats
Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA
Bio-Informatics Lectures. A Short Introduction
Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
MORPHEUS. http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix.
MORPHEUS http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix. Reference: MORPHEUS, a Webtool for Transcripton Factor Binding Analysis Using
Current Motif Discovery Tools and their Limitations
Current Motif Discovery Tools and their Limitations Philipp Bucher SIB / CIG Workshop 3 October 2006 Trendy Concepts and Hypotheses Transcription regulatory elements act in a context-dependent manner.
Sequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment
Sequence Analysis 15: lecture 5 Substitution matrices Multiple sequence alignment A teacher's dilemma To understand... Multiple sequence alignment Substitution matrices Phylogenetic trees You first need
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
Exercises for the UCSC Genome Browser Introduction
Exercises for the UCSC Genome Browser Introduction 1) Find out if the mouse Brca1 gene has non-synonymous SNPs, color them blue, and get external data about a codon-changing SNP. Skills: basic text search;
BIOINFORMATICS TUTORIAL
Bio 242 BIOINFORMATICS TUTORIAL Bio 242 α Amylase Lab Sequence Sequence Searches: BLAST Sequence Alignment: Clustal Omega 3d Structure & 3d Alignments DO NOT REMOVE FROM LAB. DO NOT WRITE IN THIS DOCUMENT.
AP BIOLOGY 2009 SCORING GUIDELINES
AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following
DNA Sequence Analysis
DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium
Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium I. Introduction: Sequence based assays of transcriptomes (RNA-seq) are in wide use because of their favorable
Searching Nucleotide Databases
Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames
Arabidopsis. A Practical Approach. Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham
Arabidopsis A Practical Approach Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham OXPORD UNIVERSITY PRESS List of Contributors Abbreviations xv xvu
Genomics Services @ GENterprise
Genomics Services @ GENterprise since 1998 Mainz University spin-off privately financed 6-10 employees since 2006 Genomics Services @ GENterprise Sequencing Service (Sanger/3730, 454) Genome Projects (Bacteria,
PrimeSTAR HS DNA Polymerase
Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction
A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques
Proceedings of the 2007 WSEAS International Conference on Computer Engineering and Applications, Gold Coast, Australia, January 17-19, 2007 402 A Multiple DNA Sequence Translation Tool Incorporating Web
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur
Evolutionary Bioinformatics. EvoPipes.net: Bioinformatic Tools for Ecological and Evolutionary Genomics
Evolutionary Bioinformatics Short Report Open Access Full open access to this and thousands of other papers at http://www.la-press.com. EvoPipes.net: Bioinformatic Tools for Ecological and Evolutionary
From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
The Human Genome Project
The Human Genome Project Brief History of the Human Genome Project Physical Chromosome Maps Genetic (or Linkage) Maps DNA Markers Sequencing and Annotating Genomic DNA What Have We learned from the HGP?
Amino Acids and Their Properties
Amino Acids and Their Properties Recap: ss-rrna and mutations Ribosomal RNA (rrna) evolves very slowly Much slower than proteins ss-rrna is typically used So by aligning ss-rrna of one organism with that
Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6
Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6 In the last lab, you learned how to perform basic multiple sequence alignments. While useful in themselves for determining conserved residues
Phylogenetic Trees Made Easy
Phylogenetic Trees Made Easy A How-To Manual Fourth Edition Barry G. Hall University of Rochester, Emeritus and Bellingham Research Institute Sinauer Associates, Inc. Publishers Sunderland, Massachusetts
Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne
Sanger Sequencing and Quality Assurance Zbigniew Rudzki Department of Pathology University of Melbourne Sanger DNA sequencing The era of DNA sequencing essentially started with the publication of the enzymatic
LabGenius. Technical design notes. The world s most advanced synthetic DNA libraries. [email protected] V1.5 NOV 15
LabGenius The world s most advanced synthetic DNA libraries Technical design notes [email protected] V1.5 NOV 15 Introduction OUR APPROACH LabGenius is a gene synthesis company focussed on the design and manufacture
Genetics Test Biology I
Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.
escience and Post-Genome Biomedical Research
escience and Post-Genome Biomedical Research Thomas L. Casavant, Adam P. DeLuca Departments of Biomedical Engineering, Electrical Engineering and Ophthalmology Coordinated Laboratory for Computational
Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook)
Name Date Per Look at the diagrams, then answer the questions. Gene Mutations affect a single gene by changing its base sequence, resulting in an incorrect, or nonfunctional, protein being made. (a) A
1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
Protein Sequence Analysis - Overview -
Protein Sequence Analysis - Overview - UDEL Workshop Raja Mazumder Research Associate Professor, Department of Biochemistry and Molecular Biology Georgetown University Medical Center Topics Why do protein
Biological Databases and Protein Sequence Analysis
Biological Databases and Protein Sequence Analysis Introduction M. Madan Babu, Center for Biotechnology, Anna University, Chennai 25, India Bioinformatics is the application of Information technology to
2006 7.012 Problem Set 3 KEY
2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE
AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,
Basic Concepts of DNA, Proteins, Genes and Genomes
Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate
