Frequently Asked Questions Next Generation Sequencing

Size: px
Start display at page:

Download "Frequently Asked Questions Next Generation Sequencing"

Transcription

1 Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided into several categories for ease of use. If you do not find the answer you are looking for contact our Technical Support Team by phone at (between 9am 5pm U.S. Central Time), or by at any time. We strive to answer all support requests within 24 business hours. Select a category from the list below: Import ChIP-Seq RNA-Seq Question: What aligners does Partek support? Answer: Partek can import any files in.bam or.sam format, irrespective of the aligner. Question: I have my aligned reads in.eland format. Can I import those files in Partek? Answer: Please first convert.eland files to.bam files. The converter can be found in Partek, under Tools menu (Tools > Convert Eland to BAM). Question: Can I import and analyze my raw sequencing data in Partek? Answer: No, Partek imports already aligned sequencing reads. On the other hand, alignment can be performed in Partek Flow. Question: Do I need to set any filter to the aligned reads if I only want to analyze uniquely mapped reads? Answer: No filtering is necessary because Partek imports all the sequencing reads that have been aligned, counting each read once even if it has multiple alignments. As reads can be aligned to more than one location, the number of alignments may be greater than the number of reads. Since unaligned reads may be present in the BAM file, the number of alignments may be less than the number of reads. For a discussion on exonic, intronic, and intergenic reads please refer to the white paper Understanding Reads (Help > On-line Tutorials, tab White Papers). Question: How should I analyze technical replicates in Partek? Answer: There are two possibilities to analyze technical replicates in Partek. The first is to import the.bam/.sam files of the replicates separately, and treat the technical replicates as biological replicates. In the other words, to use a categorical Frequently Asked Questions Next Generation Sequencing 1

2 attribute to label them and then summarize the replicates during the statistical analysis (i.e. by ANOVA). Alternatively, technical replicates can be merged during the import stage. In the BAM Sample Manager please use the Mange samples option to assign the technical replicates to the same Sample ID. ChIP-Seq Question: How does Partek detect peaks in the CHIP-seq workflow? Answer: Partek traverses the reads in order and locates coverage that is above the use-defined threshold (defined as fraction of false positive peaks allowed, in the Peak Detection dialog). It then finds the endpoints of the regions by taking the median of the forward reads (left endpoint) and the median of the reverse strands (right endpoint). Question: In the CHIP-seq workflow, I set up the threshold of peak detection as 10. Why do I sometimes see numbers smaller than 10 in column 8, number of reads that begin in the region for each sample? Answer: This is because you set directionally extend tags in your peak detection dialogue. The peaks come from the extended reads and the read counts come from the original reads. Question: Will the peak cut-off FDR setting affect the result? How should I set up a proper threshold? Answer: You can always set the threshold conservative (low) and filter later based on p-value. An often used threshold is Question: In the detecting motifs dialog, should the number of motifs always be set to one? Answer: Because any given DNA binding protein has only one core binding motif, one is probably a good choice. If you are looking for two half-sites, then you would choose two. Question: In the detect motifs dialog, the changes of minimum motif length and maximum motif length have great impact on the motif prediction. Any recommendations to these two settings? Answer: Most binding sites are between 6 and 16 bases long; therefore, the Partek default setting is 6 to 16. We don t recommend a setting less than 6, but more than 16 should be fine. Question: Where do I specify the.2bit file if I am using a known database? Answer: If you use a standard organism, such as human or mouse, Partek should automatically download the.2bit file. However, if it is not working, you can also manually download the hg19.2bit file from In Partek, go to Tools > File Manager. Select hg19 (assuming you are running an experiment on human Frequently Asked Questions Next Generation Sequencing 2

3 samples, using the hg19 build of the human genome) for the Please Specify Files For entry. In the Genome Sequence.2bit box, use Browse specify the location of your 2bit file. RNA-Seq Question: Does Partek assign reads to different isoforms of a gene? Answer: We used an expectation maximization (EM) algorithm to probabilistically assign reads to known isoforms of a gene. Similar methods have been used for identifying isoforms in the Xing Y, et al. paper An expectation-maximization algorithm for probabilistic reconstructions of full-length isoforms from splice graphs, Nucleic Acids Research 2006;34(10): ( EM algorithm: Input: 1. Set of isoforms 2. Counts of the number of reads on each exon 3. Length of isoforms Output: Proportion of each isoform where the sum of the proportions is 1. Algorithm: The E/M algorithm is a way of solving the chicken and egg problem: If you know relative proportions of isoforms, you could assign the reads to each isoform accordingly. If you knew the assignment of reads to isoforms, you could get an estimate of the isoform proportions. The algorithm works by first guessing the isoform proportions (say 1/n where n is the number of isoforms). Then, reads are assigned to each isoform based on the proportions. The reads mapped to the isoforms are then used to estimate the isoform proportions. Question: What is the RPKM value? Answer: The RPKM value is reads per 1k bases of exon model per million mapped reads. It is defined in the paper Mapping and quantifying mammalian transcriptomes by RNA-Seq Mortazavi A., et al., Nature Methods 2008;5(7): ( Question: How does Partek calculate differentially expressed transcripts? Answer: Partek uses a log-likelihood ratio test to identify genes with different relative abundances of isoforms across samples (in-house method), similar to the one discussed in the paper RNA-seq: An assessment of technical reproducibility and comparison with gene expression arrays, Marioni JC, et al., Genome Research, 2008;18(9): ( Frequently Asked Questions Next Generation Sequencing 3

4 Question: How does Partek calculate fold change of two transcripts between two contrast groups? Answer: The fold change is calculated as the ratio of RPKM values between two contrast groups. Question: Does Partek support paired-end reads? If so, where do I tell the software that these samples used paired end reads? Answer: Partek supports paired-end reads. The software will automatically recognize the read type in the.bam/.sam files and import them. Question: What source does Partek use for transcript annotation? Answer: Full flexibility with the selection of the source for transcript annotation is provided. User can choose between RefSeq, AceView, and Ensembl, which are downloaded automatically, or can decided to use custom annotation. For custom annotation (e.g. to be used with non-standard organisms), please go to Tools > Annotation Manager and select Create Annotation on the My Annotations tab. Partek annotation (.pannot format) can be created by importing an annotation file in one of the following formats:.gtf,.gff,.bed,.bam, USCS db SNP file, USCS RefFlat file (suggested), or.txt/.csv. Question: Can I use Partek to analyze non-standard organisms? Answer: Partek automatically downloads annotation files and reference genomes for standard organisms, e.g. human or mouse. For a non-standard organism, one needs to manually provide a transcript annotation file (for details, please see the respective question in this document) and a reference genome in.2bit format. The.2bit file can be either downloaded (USCS and Ensembl provide the reference genomes for many species) or created in Partek, by using the fasta file containing the reference genome of the organism. The functionality is available at Tools > 2 Bit Creator. Question: During the finding differentially expressed transcript step in the RNA-seq dialog, I can choose if any assay recognizes a sense strand or an antisense strand. What are the outcomes I can expect if I choose yes or no in this dialog? Answer: It is depends on the sample preparation. Some preparations will preserve strand information of the original transcript, like Illumina s directional RNA-seq, or the SOLiD Whole Transcriptome Analysis Kit. When cdna was prepared from the RNA sample, only the 1 st strand cdna was synthesized. On the other hand, some preparation will reverse transcribe the mrna into double stranded cdna. In this case, the sequence was read from both the sense and the antisense strand, and was not discriminated between them. The biologists who prepared the sample should know that information from the kit they used. If you select yes on the genome browser, you can see if all the reads from a single transcript are either on Frequently Asked Questions Next Generation Sequencing 4

5 the sense or on the antisense strand (as indicated by two different colors). Selecting no will show mixed reads from both strand on the same transcript. Question: I ve noticed that Partek can display positive strand reads on one track and negative strand reads on another track. How do I enable this in my analysis? Answer: The display of positive and negative strand reads on separate tracks is enabled by the answer to the Can assay discriminate between sense and antisense strand? question in the RNA-seq dialog. Partek has the ability to automatically detect the reads that come from the positive strand or the negative strand, and display and analyze the strand-specific sequencing result. Question: What are unexplained regions? Answer: Unexplained regions contain reads that map to the genome but not to the transcriptome, i.e. to the known transcripts. Please note that mapping depends on the chosen database. For instace, as RefSeq is more conservative than AceView, reads that do not map to one of the RefSeq transcripts (and are, hence, labaled unexplained ) might map to an AceView transcript. There are at least two ways to check for that. First, mapping can be performed again, but with the selection of a different data base. Second, unexplained regions can be overlayed with transcript annotation different than the one used for mapping. To do the latter, please select the spreadsheet with unexplained regions, go to Tools > Find Overlapping Genes and in the Output Overlapping Features dialog select an appropriate annotation source. Question: Can Partek detect fusion genes? Answer: Currently the system is designed to count reads into a predefined transcript space, so Partek does not have an obvious mechanism to count the enormous possible combination of fusion genes that are possible. Last revision: October 2011 Frequently Asked Questions Next Generation Sequencing 5

New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.

New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc. New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System

More information

Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data

Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data The Illumina TopHat Alignment and Cufflinks Assembly and Differential Expression apps make RNA data analysis accessible to any user, regardless

More information

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,

More information

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert September 24, 2013 Abstract FlipFlop implements a fast method for de novo transcript

More information

Expression Quantification (I)

Expression Quantification (I) Expression Quantification (I) Mario Fasold, LIFE, IZBI Sequencing Technology One Illumina HiSeq 2000 run produces 2 times (paired-end) ca. 1,2 Billion reads ca. 120 GB FASTQ file RNA-seq protocol Task

More information

Partek Methylation User Guide

Partek Methylation User Guide Partek Methylation User Guide Introduction This user guide will explain the different types of workflow that can be used to analyze methylation datasets. Under the Partek Methylation workflow there are

More information

Analysis of ChIP-seq data in Galaxy

Analysis of ChIP-seq data in Galaxy Analysis of ChIP-seq data in Galaxy November, 2012 Local copy: https://galaxy.wi.mit.edu/ Joint project between BaRC and IT Main site: http://main.g2.bx.psu.edu/ 1 Font Conventions Bold and blue refers

More information

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing

More information

Analyzing microrna Data and Integrating mirna with Gene Expression Data in Partek Genomics Suite 6.6

Analyzing microrna Data and Integrating mirna with Gene Expression Data in Partek Genomics Suite 6.6 Analyzing microrna Data and Integrating mirna with Gene Expression Data in Partek Genomics Suite 6.6 Overview This tutorial outlines how microrna data can be analyzed within Partek Genomics Suite. Additionally,

More information

Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium

Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium I. Introduction: Sequence based assays of transcriptomes (RNA-seq) are in wide use because of their favorable

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name sorbin and SH3 domain containing 2 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SORBS2 Human Arg and c-abl represent the mammalian

More information

Tutorial for proteome data analysis using the Perseus software platform

Tutorial for proteome data analysis using the Perseus software platform Tutorial for proteome data analysis using the Perseus software platform Laboratory of Mass Spectrometry, LNBio, CNPEM Tutorial version 1.0, January 2014. Note: This tutorial was written based on the information

More information

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

GenBank, Entrez, & FASTA

GenBank, Entrez, & FASTA GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

Gene Models & Bed format: What they represent.

Gene Models & Bed format: What they represent. GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,

More information

RNA Express. Introduction 3 Run RNA Express 4 RNA Express App Output 6 RNA Express Workflow 12 Technical Assistance

RNA Express. Introduction 3 Run RNA Express 4 RNA Express App Output 6 RNA Express Workflow 12 Technical Assistance RNA Express Introduction 3 Run RNA Express 4 RNA Express App Output 6 RNA Express Workflow 12 Technical Assistance ILLUMINA PROPRIETARY 15052918 Rev. A February 2014 This document and its contents are

More information

8/7/2012. Experimental Design & Intro to NGS Data Analysis. Examples. Agenda. Shoe Example. Breast Cancer Example. Rat Example (Experimental Design)

8/7/2012. Experimental Design & Intro to NGS Data Analysis. Examples. Agenda. Shoe Example. Breast Cancer Example. Rat Example (Experimental Design) Experimental Design & Intro to NGS Data Analysis Ryan Peters Field Application Specialist Partek, Incorporated Agenda Experimental Design Examples ANOVA What assays are possible? NGS Analytical Process

More information

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249

More information

Analyzing the Effect of Treatment and Time on Gene Expression in Partek Genomics Suite (PGS) 6.6: A Breast Cancer Study

Analyzing the Effect of Treatment and Time on Gene Expression in Partek Genomics Suite (PGS) 6.6: A Breast Cancer Study Analyzing the Effect of Treatment and Time on Gene Expression in Partek Genomics Suite (PGS) 6.6: A Breast Cancer Study The data for this study is taken from experiment GSE848 from the Gene Expression

More information

LifeScope Genomic Analysis Software 2.5

LifeScope Genomic Analysis Software 2.5 USER GUIDE LifeScope Genomic Analysis Software 2.5 Graphical User Interface DATA ANALYSIS METHODS AND INTERPRETATION Publication Part Number 4471877 Rev. A Revision Date November 2011 For Research Use

More information

PREDA S4-classes. Francesco Ferrari October 13, 2015

PREDA S4-classes. Francesco Ferrari October 13, 2015 PREDA S4-classes Francesco Ferrari October 13, 2015 Abstract This document provides a description of custom S4 classes used to manage data structures for PREDA: an R package for Position RElated Data Analysis.

More information

Computational Genomics. Next generation sequencing (NGS)

Computational Genomics. Next generation sequencing (NGS) Computational Genomics Next generation sequencing (NGS) Sequencing technology defies Moore s law Nature Methods 2011 Log 10 (price) Sequencing the Human Genome 2001: Human Genome Project 2.7G$, 11 years

More information

Next Generation Sequencing: Adjusting to Big Data. Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013

Next Generation Sequencing: Adjusting to Big Data. Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013 Next Generation Sequencing: Adjusting to Big Data Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013 Outline Human Genome Project Next-Generation Sequencing Personalized Medicine

More information

G E N OM I C S S E RV I C ES

G E N OM I C S S E RV I C ES GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E

More information

17 July 2014 WEB-SERVER MANUAL. Contact: Michael Hackenberg (hackenberg@ugr.es)

17 July 2014 WEB-SERVER MANUAL. Contact: Michael Hackenberg (hackenberg@ugr.es) WEB-SERVER MANUAL Contact: Michael Hackenberg (hackenberg@ugr.es) 1 1 Introduction srnabench is a free web-server tool and standalone application for processing small- RNA data obtained from next generation

More information

Comparing Methods for Identifying Transcription Factor Target Genes

Comparing Methods for Identifying Transcription Factor Target Genes Comparing Methods for Identifying Transcription Factor Target Genes Alena van Bömmel (R 3.3.73) Matthew Huska (R 3.3.18) Max Planck Institute for Molecular Genetics Folie 1 Transcriptional Regulation TF

More information

Core Facility Genomics

Core Facility Genomics Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene

More information

Genomes and SNPs in Malaria and Sickle Cell Anemia

Genomes and SNPs in Malaria and Sickle Cell Anemia Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing

More information

mygenomatix - secure cloud for NGS analysis

mygenomatix - secure cloud for NGS analysis mygenomatix Speed. Quality. Results. mygenomatix - secure cloud for NGS analysis background information & contents 2011 Genomatix Software GmbH Bayerstr. 85a 80335 Munich Germany info@genomatix.de www.genomatix.de

More information

Nebula A web-server for advanced ChIP-seq data analysis. Tutorial. by Valentina BOEVA

Nebula A web-server for advanced ChIP-seq data analysis. Tutorial. by Valentina BOEVA Nebula A web-server for advanced ChIP-seq data analysis Tutorial by Valentina BOEVA Content Upload data to the history pp. 5-6 Check read number and sequencing quality pp. 7-9 Visualize.BAM files in UCSC

More information

User Manual. Transcriptome Analysis Console (TAC) Software. For Research Use Only. Not for use in diagnostic procedures. P/N 703150 Rev.

User Manual. Transcriptome Analysis Console (TAC) Software. For Research Use Only. Not for use in diagnostic procedures. P/N 703150 Rev. User Manual Transcriptome Analysis Console (TAC) Software For Research Use Only. Not for use in diagnostic procedures. P/N 703150 Rev. 1 Trademarks Affymetrix, Axiom, Command Console, DMET, GeneAtlas,

More information

Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe

Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. To published results faster With proven scalability To the forefront of discovery To limitless applications

More information

Basic processing of next-generation sequencing (NGS) data

Basic processing of next-generation sequencing (NGS) data Basic processing of next-generation sequencing (NGS) data Getting from raw sequence data to expression analysis! 1 Reminder: we are measuring expression of protein coding genes by transcript abundance

More information

Step-by-Step Guide to Basic Expression Analysis and Normalization

Step-by-Step Guide to Basic Expression Analysis and Normalization Step-by-Step Guide to Basic Expression Analysis and Normalization Page 1 Introduction This document shows you how to perform a basic analysis and normalization of your data. A full review of this document

More information

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS

More information

Challenges associated with analysis and storage of NGS data

Challenges associated with analysis and storage of NGS data Challenges associated with analysis and storage of NGS data Gabriella Rustici Research and training coordinator Functional Genomics Group gabry@ebi.ac.uk Next-generation sequencing Next-generation sequencing

More information

From Reads to Differentially Expressed Genes. The statistics of differential gene expression analysis using RNA-seq data

From Reads to Differentially Expressed Genes. The statistics of differential gene expression analysis using RNA-seq data From Reads to Differentially Expressed Genes The statistics of differential gene expression analysis using RNA-seq data experimental design data collection modeling statistical testing biological heterogeneity

More information

Gene Expression Macro Version 1.1

Gene Expression Macro Version 1.1 Gene Expression Macro Version 1.1 Instructions Rev B 1 Bio-Rad Gene Expression Macro Users Guide 2004 Bio-Rad Laboratories Table of Contents: Introduction..................................... 3 Opening

More information

Gene Expression Analysis

Gene Expression Analysis Gene Expression Analysis Jie Peng Department of Statistics University of California, Davis May 2012 RNA expression technologies High-throughput technologies to measure the expression levels of thousands

More information

Biological Sequence Data Formats

Biological Sequence Data Formats Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA

More information

PreciseTM Whitepaper

PreciseTM Whitepaper Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis

More information

RNAseq / ChipSeq / Methylseq and personalized genomics

RNAseq / ChipSeq / Methylseq and personalized genomics RNAseq / ChipSeq / Methylseq and personalized genomics 7711 Lecture Subhajyo) De, PhD Division of Biomedical Informa)cs and Personalized Biomedicine, Department of Medicine University of Colorado School

More information

NGS Data Analysis: An Intro to RNA-Seq

NGS Data Analysis: An Intro to RNA-Seq NGS Data Analysis: An Intro to RNA-Seq March 25th, 2014 GST Colloquim: March 25th, 2014 1 / 1 Workshop Design Basics of NGS Sample Prep RNA-Seq Analysis GST Colloquim: March 25th, 2014 2 / 1 Experimental

More information

Hierarchical Clustering Analysis

Hierarchical Clustering Analysis Hierarchical Clustering Analysis What is Hierarchical Clustering? Hierarchical clustering is used to group similar objects into clusters. In the beginning, each row and/or column is considered a cluster.

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Isoform prefiltering improves performance of count-based methods for analysis of differential transcript usage

Isoform prefiltering improves performance of count-based methods for analysis of differential transcript usage Soneson et al. Genome Biology (206) 7:2 DOI 86/s3059-05-0862-3 RESEARCH Isoform prefiltering improves performance of count-based methods for analysis of differential transcript usage Charlotte Soneson,2,

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

Understanding West Nile Virus Infection

Understanding West Nile Virus Infection Understanding West Nile Virus Infection The QIAGEN Bioinformatics Solution: Biomedical Genomics Workbench (BXWB) + Ingenuity Pathway Analysis (IPA) Functional Genomics & Predictive Medicine, May 21-22,

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information

Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling

Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling Lectures 1 and 8 15 February 7, 2013 This is a review of the material from lectures 1 and 8 14. Note that the material from lecture 15 is not relevant for the final exam. Today we will go over the material

More information

Final Project Report

Final Project Report CPSC545 by Introduction to Data Mining Prof. Martin Schultz & Prof. Mark Gerstein Student Name: Yu Kor Hugo Lam Student ID : 904907866 Due Date : May 7, 2007 Introduction Final Project Report Pseudogenes

More information

UGENE Quick Start Guide

UGENE Quick Start Guide Quick Start Guide This document contains a quick introduction to UGENE. For more detailed information, you can find the UGENE User Manual and other special manuals in project website: http://ugene.unipro.ru.

More information

Version 5.0 Release Notes

Version 5.0 Release Notes Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com

More information

Mail Merge Creating Mailing Labels 3/23/2011

Mail Merge Creating Mailing Labels 3/23/2011 Creating Mailing Labels in Microsoft Word Address data in a Microsoft Excel file can be turned into mailing labels in Microsoft Word through a mail merge process. First, obtain or create an Excel spreadsheet

More information

DeCyder Extended Data Analysis module Version 1.0

DeCyder Extended Data Analysis module Version 1.0 GE Healthcare DeCyder Extended Data Analysis module Version 1.0 Module for DeCyder 2D version 6.5 User Manual Contents 1 Introduction 1.1 Introduction... 7 1.2 The DeCyder EDA User Manual... 9 1.3 Getting

More information

Using Galaxy for NGS Analysis. Daniel Blankenberg Postdoctoral Research Associate The Galaxy Team http://usegalaxy.org

Using Galaxy for NGS Analysis. Daniel Blankenberg Postdoctoral Research Associate The Galaxy Team http://usegalaxy.org Using Galaxy for NGS Analysis Daniel Blankenberg Postdoctoral Research Associate The Galaxy Team http://usegalaxy.org Overview NGS Data Galaxy tools for NGS Data Galaxy for Sequencing Facilities Overview

More information

BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis

BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis By the end of this lab students should be able to: Describe the uses for each line of the DNA subway program (Red/Yellow/Blue/Green) Describe

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

GENE REGULATION. Teacher Packet

GENE REGULATION. Teacher Packet AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures

More information

NEXT GENERATION SEQUENCING

NEXT GENERATION SEQUENCING NEXT GENERATION SEQUENCING Dr. R. Piazza SANGER SEQUENCING + DNA NEXT GENERATION SEQUENCING Flowcell NEXT GENERATION SEQUENCING Library di DNA Genomic DNA NEXT GENERATION SEQUENCING NEXT GENERATION SEQUENCING

More information

Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat

Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat Bioinformatique et Séquençage Haut Débit, Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat 1 RNA Transcription to RNA and subsequent

More information

Hidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006

Hidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006 Hidden Markov Models in Bioinformatics By Máthé Zoltán Kőrösi Zoltán 2006 Outline Markov Chain HMM (Hidden Markov Model) Hidden Markov Models in Bioinformatics Gene Finding Gene Finding Model Viterbi algorithm

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

Exiqon Array Software Manual. Quick guide to data extraction from mircury LNA microrna Arrays

Exiqon Array Software Manual. Quick guide to data extraction from mircury LNA microrna Arrays Exiqon Array Software Manual Quick guide to data extraction from mircury LNA microrna Arrays March 2010 Table of contents Introduction Overview...................................................... 3 ImaGene

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

High Throughput Sequencing Data Analysis using Cloud Computing

High Throughput Sequencing Data Analysis using Cloud Computing High Throughput Sequencing Data Analysis using Cloud Computing Stéphane Le Crom (stephane.le_crom@upmc.fr) LBD - Université Pierre et Marie Curie (UPMC) Institut de Biologie de l École normale supérieure

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took

More information

RNA-Seq Tutorial 1. John Garbe Research Informatics Support Systems, MSI March 19, 2012

RNA-Seq Tutorial 1. John Garbe Research Informatics Support Systems, MSI March 19, 2012 RNA-Seq Tutorial 1 John Garbe Research Informatics Support Systems, MSI March 19, 2012 Tutorial 1 RNA-Seq Tutorials RNA-Seq experiment design and analysis Instruction on individual software will be provided

More information

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh

More information

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert May 3, 2016 Abstract FlipFlop implements a fast method for de novo transcript

More information

Introduction to Genome Annotation

Introduction to Genome Annotation Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT

More information

Yale Pseudogene Analysis as part of GENCODE Project

Yale Pseudogene Analysis as part of GENCODE Project Sanger Center 2009.01.20, 11:20-11:40 Mark B Gerstein Yale Illustra(on from Gerstein & Zheng (2006). Sci Am. (c) Mark Gerstein, 2002, (c) Yale, 1 1Lectures.GersteinLab.org 2007bioinfo.mbb.yale.edu Yale

More information

HENIPAVIRUS ANTIBODY ESCAPE SEQUENCING REPORT

HENIPAVIRUS ANTIBODY ESCAPE SEQUENCING REPORT HENIPAVIRUS ANTIBODY ESCAPE SEQUENCING REPORT Kimberly Bishop Lilly 1,2, Truong Luu 1,2, Regina Cer 1,2, and LT Vishwesh Mokashi 1 1 Naval Medical Research Center, NMRC Frederick, 8400 Research Plaza,

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

REAL TIME PCR USING SYBR GREEN

REAL TIME PCR USING SYBR GREEN REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM

More information

Services. Updated 05/31/2016

Services. Updated 05/31/2016 Updated 05/31/2016 Services 1. Whole exome sequencing... 2 2. Whole Genome Sequencing (WGS)... 3 3. 16S rrna sequencing... 4 4. Customized gene panels... 5 5. RNA-Seq... 6 6. qpcr... 7 7. HLA typing...

More information

Human Genome Organization: An Update. Genome Organization: An Update

Human Genome Organization: An Update. Genome Organization: An Update Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion

More information

Simplifying Data Interpretation with Nexus Copy Number

Simplifying Data Interpretation with Nexus Copy Number Simplifying Data Interpretation with Nexus Copy Number A WHITE PAPER FROM BIODISCOVERY, INC. Rapid technological advancements, such as high-density acgh and SNP arrays as well as next-generation sequencing

More information

13.4 Gene Regulation and Expression

13.4 Gene Regulation and Expression 13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.

More information

Basic Analysis of Microarray Data

Basic Analysis of Microarray Data Basic Analysis of Microarray Data A User Guide and Tutorial Scott A. Ness, Ph.D. Co-Director, Keck-UNM Genomics Resource and Dept. of Molecular Genetics and Microbiology University of New Mexico HSC Tel.

More information

mrna NGS Data Analysis Report

mrna NGS Data Analysis Report mrna NGS Data Analysis Report Project: Test Project (Ref code: 00001) Customer: Test customer Company/Institute: Exiqon Date: Monday, June 29, 2015 Performed by: XploreRNA Exiqon A/S Company Reg. No. (CVR)

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

Creating Web Pages with Microsoft FrontPage

Creating Web Pages with Microsoft FrontPage Creating Web Pages with Microsoft FrontPage 1. Page Properties 1.1 Basic page information Choose File Properties. Type the name of the Title of the page, for example Template. And then click OK. Short

More information

Processing Genome Data using Scalable Database Technology. My Background

Processing Genome Data using Scalable Database Technology. My Background Johann Christoph Freytag, Ph.D. freytag@dbis.informatik.hu-berlin.de http://www.dbis.informatik.hu-berlin.de Stanford University, February 2004 PhD @ Harvard Univ. Visiting Scientist, Microsoft Res. (2002)

More information

ProteinPilot Report for ProteinPilot Software

ProteinPilot Report for ProteinPilot Software ProteinPilot Report for ProteinPilot Software Detailed Analysis of Protein Identification / Quantitation Results Automatically Sean L Seymour, Christie Hunter SCIEX, USA Pow erful mass spectrometers like

More information

org.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers.

org.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers. org.rn.eg.db December 16, 2015 org.rn.egaccnum Map Entrez Gene identifiers to GenBank Accession Numbers org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank

More information

RNA-seq. Quantification and Differential Expression. Genomics: Lecture #12

RNA-seq. Quantification and Differential Expression. Genomics: Lecture #12 (2) Quantification and Differential Expression Institut für Medizinische Genetik und Humangenetik Charité Universitätsmedizin Berlin Genomics: Lecture #12 Today (2) Gene Expression per Sources of bias,

More information

MeDIP-chip service report

MeDIP-chip service report MeDIP-chip service report Wednesday, 20 August, 2008 Sample source: Cells from University of *** Customer: ****** Organization: University of *** Contents of this service report General information and

More information

Genome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009

Genome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Genome and DNA Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Admin Reading: Chapters 1 & 2 Notes available in PDF format on-line (see class calendar page): http://www.soe.ucsc.edu/classes/bme110/spring09/bme110-calendar.html

More information

MORPHEUS. http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix.

MORPHEUS. http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix. MORPHEUS http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix. Reference: MORPHEUS, a Webtool for Transcripton Factor Binding Analysis Using

More information

Searching Nucleotide Databases

Searching Nucleotide Databases Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames

More information

SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE

SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,

More information

Tutorial for Proteomics Data Submission. Katalin F. Medzihradszky Robert J. Chalkley UCSF

Tutorial for Proteomics Data Submission. Katalin F. Medzihradszky Robert J. Chalkley UCSF Tutorial for Proteomics Data Submission Katalin F. Medzihradszky Robert J. Chalkley UCSF Why Have Guidelines? Large-scale proteomics studies create huge amounts of data. It is impossible/impractical to

More information

Model Selection. Introduction. Model Selection

Model Selection. Introduction. Model Selection Model Selection Introduction This user guide provides information about the Partek Model Selection tool. Topics covered include using a Down syndrome data set to demonstrate the usage of the Partek Model

More information

Overview of Eukaryotic Gene Prediction

Overview of Eukaryotic Gene Prediction Overview of Eukaryotic Gene Prediction CBB 231 / COMPSCI 261 W.H. Majoros What is DNA? Nucleus Chromosome Telomere Centromere Cell Telomere base pairs histones DNA (double helix) DNA is a Double Helix

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Focusing on results not data comprehensive data analysis for targeted next generation sequencing Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes

More information