Genome Viewing. Module 2. Using Genome Browsers to View Annotation of the Human Genome

Size: px
Start display at page:

Download "Genome Viewing. Module 2. Using Genome Browsers to View Annotation of the Human Genome"

Transcription

1 Module 2 Genome Viewing Using Genome Browsers to View Annotation of the Human Genome Bert Overduin, Ph.D. PANDA Coordination & Outreach EMBL - European Bioinformatics Institute Wellcome Trust Genome Campus Hinxton, Cambridge, CB10 1SD, UK

2 Why Genome Browsers? Browse genes in their genomic context Display features in and around a particular gene Explore larger chromosomal regions Search and retrieve information on a genomewide scale Compare genomes

3 Genome Browsers Ensembl Genome Browser NCBI Map Viewer UCSC Genome Browser

4

5

6

7 What Distinguishes Ensembl? Automatic annotation for those species for which no manually annotated gene sets exist Data mining tool BioMart Direct database access and programmatic access via the Perl API Not only the data, but also the software code is open source

8 Ensembl - Organisation Joint project between the European Bioinformatics Institute (EBI) and the Wellcome Trust Sanger Institute (WTSI) Started in 1999 for the Human Genome Project Funded primarily by the Wellcome Trust, with additional funding by EMBL, NIH-NHGRI, NIH- NIAID, BBSRC, MRC and EU Team of ca. 50 people, led by Ewan Birney (EBI) and Tim Hubbard (WTSI)

9 Ensembl - Species 48 chordates, ranging from human to two Ciona species 3 key eukaryote model organisms: Drosophila melanogaster Caenorhabditis elegans Saccharomyces cerevisiae

10 Aedes aegypti, Anopheles gambiae, Culex quinquefasciatus, 12 Drosophila species, 5 Caenorhabditis species, Ixodes scapularis Plasmodium falciparum, Plasmodium knowlesi, Plasmodium vivax Bacillus, Escherichia/Shigella, Mycobacterium, Neisseria, Pyrococcus, Staphylococcus, Streptococcus Arabidopsis lyrata, Arabidopsis thaliana, Brachypodium distachyon, Oryza sativa, Oryza sativa indica group, Populus trichocarpa, Sorghum bicolor, Vitis vinifera 7 Aspergillus species, Neosartorya fischeri, Saccharomyces cerevisiae, Schizosaccharomyces pombe

11 Ensembl - Data Genomic sequence Gene / transcript / protein models External references Mapped cdnas, proteins, microarray probes, BAC clones, cytogenetic bands, repeats, markers etc. etc. Comparative data: orthologs and paralogs, protein families, whole genome alignments, syntenic regions Variation data: SNPs Regulatory data: best guess set of regulatory elements Externally stored data (Distributed Annotation System)

12 Ensembl Gene Models Automatically annotated genes for the whole genome of all species ( Ensembl genes ) Manually annotated genes for part of the human and mouse genome ( Vega/Havana genes)

13 Biological Evidence All Ensembl gene models are based on evidence from: UniProtKB/Swiss-Prot Proteins, manually curated NCBI RefSeq Proteins and mrnas, partially manually curated UniProtKB/TrEMBL Translations of EMBL-Bank CDSs, automatically annotated EMBL-Bank / GenBank / DDBJ Primary nucleotide sequence repositories

14 Ensembl Genebuild Genome assembly + Experimental evidence + Computer programs

15 Access to Data Release web site Pre-release web site Archive web site BioMart FTP site ftp://ftp.ensembl.org Amazon Web Services MySQL Perl API

16 Ensembl Stable Identifiers Human: ENSG########### Ensembl Gene ID ENST########### Ensembl Transcript ID ENSP########### Ensembl Protein ID ENSE########### Ensembl Exon ID ENSR########### Ensembl Regulatory Feature ID ENSSNP########### Ensembl SNP ID ENSFM########### Ensembl Protein Family ID Other species have a suffix: ENSMUSG########### A mouse (Mus musculus) gene

17 Summary Genome browsers render the plain sequence more accessible Ensembl provides automatic genome annotation, yet is strongly based on experimental evidence from protein and cdna sequences in public databases Ensembl heavily links to data sets from other species, as well as to external resources

18 Data Mining Ensembl with BioMart

19 BioMart Joint project between the European Bioinformatics Institute (EBI) and the Ontario Institute for Cancer Research (OICR) Originally developed for Ensembl (EnsMart) Website :

20 Publicly Available Marts Ensembl Ensembl Bacteria Ensembl Metazoa Ensembl Protists Dictybase Wormbase Gramene Europhenome UniProt InterPro HGNC Rat Genome Database DroSpeGe ArrayExpress DW Eurexpress HapMap GermOnLine PRIDE PepSeeker VectorBase HTGT Pancreatic Expression Database Reactome EU Rat Mart Paramecium DB International Potato Center (CIP) Central portal:

21 BioMart - Principle Step 1 Dataset Choose your dataset and species Step 2 Filters Limit your dataset Step 3 Attributes Specify what information you want to output Step 4 Results Preview and output your results

22 Summary BioMart is a highly flexible tool for data mining Queries are defined in just 4 steps: Dataset, Filters, Attributes and Results Genomic regions, Gene identifiers, Gene Ontology terms and many other sources of information can serve as filters BioMart heavily links to data sets within Ensembl and provides links to external resources

23 Help Helpdesk Mailing lists: Blog: YouTube channel:

24

25

Module 3. Genome Browsing. Using Web Browsers to View Genome Annota4on. Kers4n Howe Wellcome Trust Sanger Ins4tute zfish- help@sanger.ac.

Module 3. Genome Browsing. Using Web Browsers to View Genome Annota4on. Kers4n Howe Wellcome Trust Sanger Ins4tute zfish- help@sanger.ac. Module 3 Genome Browsing Using Web Browsers to View Genome Annota4on Kers4n Howe Wellcome Trust Sanger Ins4tute zfish- help@sanger.ac.uk Introduc.on Genome browsing The Ensembl gene set Guided examples

More information

The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28.

The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28. Tutorial Module 5 BioMart You will learn about BioMart, a joint project developed and maintained at EBI and OiCR www.biomart.org How to use BioMart to quickly obtain lists of gene information from Ensembl

More information

How To Use The Assembly Database In A Microarray (Perl) With A Microarcode) (Perperl 2) (For Macrogenome) (Genome 2)

How To Use The Assembly Database In A Microarray (Perl) With A Microarcode) (Perperl 2) (For Macrogenome) (Genome 2) The Ensembl Core databases and API Useful links Installation instructions: http://www.ensembl.org/info/docs/api/api_installation.html Schema description: http://www.ensembl.org/info/docs/api/core/core_schema.html

More information

Module 1. Sequence Formats and Retrieval. Charles Steward

Module 1. Sequence Formats and Retrieval. Charles Steward The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Genomes and SNPs in Malaria and Sickle Cell Anemia

Genomes and SNPs in Malaria and Sickle Cell Anemia Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing

More information

Using Ensembl tools for browsing ENCODE data

Using Ensembl tools for browsing ENCODE data Using Ensembl tools for browsing ENCODE data Bert Overduin, Ph.D. Vertebrate Genomics Team EMBL - European Bioinformatics Institute Wellcome Trust Genome Campus Hinxton, Cambridge CB10 1SD United Kingdom

More information

Gramene: Exploring Function through Comparative Genomics and Network Analysis Doreen H. Ware, Ph.D. United States Department of Agriculture ARS Cold

Gramene: Exploring Function through Comparative Genomics and Network Analysis Doreen H. Ware, Ph.D. United States Department of Agriculture ARS Cold Gramene: Exploring Function through Comparative Genomics and Network Analysis Doreen H. Ware, Ph.D. United States Department of Agriculture ARS Cold Spring Harbor Laboratory Gramene II Pankaj Jaiswal,

More information

Three data delivery cases for EMBL- EBI s Embassy. Guy Cochrane www.ebi.ac.uk

Three data delivery cases for EMBL- EBI s Embassy. Guy Cochrane www.ebi.ac.uk Three data delivery cases for EMBL- EBI s Embassy Guy Cochrane www.ebi.ac.uk EMBL European Bioinformatics Institute Genes, genomes & variation European Nucleotide Archive 1000 Genomes Ensembl Ensembl Genomes

More information

Protein Protein Interactions (PPI) APID (Agile Protein Interaction DataAnalyzer)

Protein Protein Interactions (PPI) APID (Agile Protein Interaction DataAnalyzer) APID (Agile Protein Interaction DataAnalyzer) 23 APID (Agile Protein Interaction DataAnalyzer) Integrates and unifies 7 DBs: BIND, DIP, HPRD, IntAct, MINT, BioGRID. Includes 51,873 proteins 241,204 interactions

More information

Yale Pseudogene Analysis as part of GENCODE Project

Yale Pseudogene Analysis as part of GENCODE Project Sanger Center 2009.01.20, 11:20-11:40 Mark B Gerstein Yale Illustra(on from Gerstein & Zheng (2006). Sci Am. (c) Mark Gerstein, 2002, (c) Yale, 1 1Lectures.GersteinLab.org 2007bioinfo.mbb.yale.edu Yale

More information

Introduction to Genome Annotation

Introduction to Genome Annotation Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

Title: Surveying Genome to Identify Origins of DNA Replication In Silico

Title: Surveying Genome to Identify Origins of DNA Replication In Silico Title: Surveying Genome to Identify Origins of DNA Replication In Silico Abstract: DNA replication origins are the bases to realize the process of chromosome replication and analyze the progress of cell

More information

Lecture 11 Data storage and LIMS solutions. Stéphane LE CROM lecrom@biologie.ens.fr

Lecture 11 Data storage and LIMS solutions. Stéphane LE CROM lecrom@biologie.ens.fr Lecture 11 Data storage and LIMS solutions Stéphane LE CROM lecrom@biologie.ens.fr Various steps of a DNA microarray experiment Experimental steps Data analysis Experimental design set up Chips on catalog

More information

NCBI resources III: GEO and ftp site. Yanbin Yin Spring 2013

NCBI resources III: GEO and ftp site. Yanbin Yin Spring 2013 NCBI resources III: GEO and ftp site Yanbin Yin Spring 2013 1 Homework assignment 2 Search colon cancer at GEO and find a data Series and perform a GEO2R analysis Write a report (in word or ppt) to include

More information

Genome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009

Genome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Genome and DNA Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Admin Reading: Chapters 1 & 2 Notes available in PDF format on-line (see class calendar page): http://www.soe.ucsc.edu/classes/bme110/spring09/bme110-calendar.html

More information

GenBank, Entrez, & FASTA

GenBank, Entrez, & FASTA GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,

More information

org.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers.

org.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers. org.rn.eg.db December 16, 2015 org.rn.egaccnum Map Entrez Gene identifiers to GenBank Accession Numbers org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank

More information

Data search and visualization tools at the Comparative Evolutionary Genomics of Cotton Web resource

Data search and visualization tools at the Comparative Evolutionary Genomics of Cotton Web resource Data search and visualization tools at the Comparative Evolutionary Genomics of Cotton Web resource Alan R. Gingle Andrew H. Paterson Joshua A. Udall Jonathan F. Wendel 1 CEGC project goals set the context

More information

Sharing Data from Large-scale Biological Research Projects: A System of Tripartite Responsibility

Sharing Data from Large-scale Biological Research Projects: A System of Tripartite Responsibility Sharing Data from Large-scale Biological Research Projects: A System of Tripartite Responsibility Report of a meeting organized by the Wellcome Trust and held on 14 15 January 2003 at Fort Lauderdale,

More information

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

Embargoed until 14:30 CEST European time, 13:30 BST UK, 8:30 Eastern US summer time Contacts:

Embargoed until 14:30 CEST European time, 13:30 BST UK, 8:30 Eastern US summer time Contacts: Embargoed until 14:30 CEST European time, 13:30 BST UK, 8:30 Eastern US summer time Contacts: Louisa Wood or Katrina Pavelin, EMBL EBI louisa@ebi.ac.uk katrina@ebi.ac.uk +44 (0)1223 494665 Sonia Furtado,

More information

Figure 1: Genome sizes of different organisms.

Figure 1: Genome sizes of different organisms. How big are genomes? Genomes are now being sequenced at such a rapid rate that it is fair to say that it is becoming routine. As a result, there is a growing interest in trying to understand the meaning

More information

IDENTIFICAZIONE DI GENI ESTROGENO RESPONSIVI CON METODI COMPUTAZIONALI. Francesca Cordero Fulvio Lazzarato Raffaele A. Calogero

IDENTIFICAZIONE DI GENI ESTROGENO RESPONSIVI CON METODI COMPUTAZIONALI. Francesca Cordero Fulvio Lazzarato Raffaele A. Calogero IDENTIFICAZIONE DI GENI ESTROGENO RESONSIVI CON METODI COMUTAZIONALI Francesca Cordero Fulvio Lazzarato Raffaele A Calogero romoters analysis Identification of common transcriptional elements, within co-regulated

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Technical document. Section 1 Using the website to investigate a specific B. rapa BAC.

Technical document. Section 1 Using the website to investigate a specific B. rapa BAC. Technical document The purpose of this document is to help navigate through the major features of this website and act as a basic training manual to enable you to interpret and use the resources and tools

More information

The silicon cell. Ab initio prediction and folding impossible but for the smallest structures. Threading

The silicon cell. Ab initio prediction and folding impossible but for the smallest structures. Threading C E N T R E F O R I N T E G B I O I N F O R R M A A T T I I V C E S V U Homology searching (BLAST) Threading Sequence Structure Function Ab initio prediction and folding impossible but for the smallest

More information

PROTEOMEXCHANGE AN INTERNATIONAL INFRASTRUCTURE FOR OPEN PROTEOMICS DATA

PROTEOMEXCHANGE AN INTERNATIONAL INFRASTRUCTURE FOR OPEN PROTEOMICS DATA PROTEOMEXCHANGE AN INTERNATIONAL INFRASTRUCTURE FOR OPEN PROTEOMICS DATA Henning Hermjakob Team Leader Proteomics Services European Bioinformatics Institute hhe@ebi.ac.uk Introduction to proteomics Introduction

More information

Computational localization of promoters and transcription start sites in mammalian genomes

Computational localization of promoters and transcription start sites in mammalian genomes Computational localization of promoters and transcription start sites in mammalian genomes Thomas Down This dissertation is submitted for the degree of Doctor of Philosophy Wellcome Trust Sanger Institute

More information

New solutions for Big Data Analysis and Visualization

New solutions for Big Data Analysis and Visualization New solutions for Big Data Analysis and Visualization From HPC to cloud-based solutions Barcelona, February 2013 Nacho Medina imedina@cipf.es http://bioinfo.cipf.es/imedina Head of the Computational Biology

More information

Databases and platforms for data analysis from NGS of MTB

Databases and platforms for data analysis from NGS of MTB Databases and platforms for data analysis from NGS of MTB Derrick Crook MMM Consortium MMM Consortium Linking Clinical record systems and NHS databases Translating next generation sequencing for patient

More information

Processing Genome Data using Scalable Database Technology. My Background

Processing Genome Data using Scalable Database Technology. My Background Johann Christoph Freytag, Ph.D. freytag@dbis.informatik.hu-berlin.de http://www.dbis.informatik.hu-berlin.de Stanford University, February 2004 PhD @ Harvard Univ. Visiting Scientist, Microsoft Res. (2002)

More information

Scientific databases. Biological data management

Scientific databases. Biological data management Scientific databases Biological data management The term paper within the framework of the course Principles of Modern Database Systems by Aleksejs Kontijevskis PhD student The Linnaeus Centre for Bioinformatics

More information

The Galaxy workflow. George Magklaras PhD RHCE

The Galaxy workflow. George Magklaras PhD RHCE The Galaxy workflow George Magklaras PhD RHCE Biotechnology Center of Oslo & The Norwegian Center of Molecular Medicine University of Oslo, Norway http://www.biotek.uio.no http://www.ncmm.uio.no http://www.no.embnet.org

More information

Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes

Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes 2.1 Introduction Large-scale insertional mutagenesis screening in

More information

Searching Nucleotide Databases

Searching Nucleotide Databases Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames

More information

Applying data integration into reconstruction of gene networks from micro

Applying data integration into reconstruction of gene networks from micro Applying data integration into reconstruction of gene networks from microarray data PhD Thesis Proposal Dipartimento di Informatica e Scienze dell Informazione Università degli Studi di Genova December

More information

Annual Scientific Report 2009. European Bioinformatics Institute

Annual Scientific Report 2009. European Bioinformatics Institute European Bioinformatics Institute Annual Scientific Report 2009 Annual Scientific Report 2009 European Bioinformatics Institute EMBL-European Bioinformatics Institute Wellcome Trust Genome Campus, Hinxton

More information

Efficient Parallel Execution of Sequence Similarity Analysis Via Dynamic Load Balancing

Efficient Parallel Execution of Sequence Similarity Analysis Via Dynamic Load Balancing Efficient Parallel Execution of Sequence Similarity Analysis Via Dynamic Load Balancing James D. Jackson Philip J. Hatcher Department of Computer Science Kingsbury Hall University of New Hampshire Durham,

More information

BIO 3352: BIOINFORMATICS II HYBRID COURSE SYLLABUS

BIO 3352: BIOINFORMATICS II HYBRID COURSE SYLLABUS BIO 3352: BIOINFORMATICS II HYBRID COURSE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title: Bioinformatics

More information

Pengyu Hong BioX program, Department of Statistics, Stanford University, Stanford, CA 94305-4065. Email: pengyuhong@stanford.edu

Pengyu Hong BioX program, Department of Statistics, Stanford University, Stanford, CA 94305-4065. Email: pengyuhong@stanford.edu UBIC 2 Towards Ubiquitous Bio-Information Computing: Data Protocols, Middleware, and Web Services for Heterogeneous Biological Information Integration and Retrieval Pengyu Hong BioX program, Department

More information

Importance of Statistics in creating high dimensional data

Importance of Statistics in creating high dimensional data Importance of Statistics in creating high dimensional data Hemant K. Tiwari, PhD Section on Statistical Genetics Department of Biostatistics University of Alabama at Birmingham History of Genomic Data

More information

Argos, a replicable genome information system for FlyBase, eugenes and other databases.

Argos, a replicable genome information system for FlyBase, eugenes and other databases. Draft paper, February 2004 Argos, a replicable genome information system for FlyBase, eugenes and other databases. Don Gilbert *, Joshua Goodman, Paul Poole, Hardik Sheth, Nihar Sheth, Vasanth Singan,

More information

Work Package 13.5: Authors: Paul Flicek and Ilkka Lappalainen. 1. Introduction

Work Package 13.5: Authors: Paul Flicek and Ilkka Lappalainen. 1. Introduction Work Package 13.5: Report summarising the technical feasibility of the European Genotype Archive to collect, store, and use genotype data stored in European biobanks in a manner that complies with all

More information

Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at

Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at Woods Hole Zebrafish Genetics and Development Bioinformatics/Genomics Lab Ian Woods Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at http://faculty.ithaca.edu/iwoods/docs/wh/

More information

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want 1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very

More information

Global Alliance. Ewan Birney Associate Director EMBL-EBI

Global Alliance. Ewan Birney Associate Director EMBL-EBI Global Alliance Ewan Birney Associate Director EMBL-EBI Our world is changing Research to Medical Research English as language Lightweight legal Identical/similar systems Open data Publications Grant-funding

More information

GeneProf and the new GeneProf Web Services

GeneProf and the new GeneProf Web Services GeneProf and the new GeneProf Web Services Florian Halbritter florian.halbritter@ed.ac.uk Stem Cell Bioinformatics Group (Simon R. Tomlinson) simon.tomlinson@ed.ac.uk December 10, 2012 Florian Halbritter

More information

EMBL-EBI Web Services

EMBL-EBI Web Services EMBL-EBI Web Services Rodrigo Lopez Head of the External Services Team SME Workshop Piemonte 2011 EBI is an Outstation of the European Molecular Biology Laboratory. Summary Introduction The JDispatcher

More information

Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison

Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

Euro-BioImaging European Research Infrastructure for Imaging Technologies in Biological and Biomedical Sciences

Euro-BioImaging European Research Infrastructure for Imaging Technologies in Biological and Biomedical Sciences Euro-BioImaging European Research Infrastructure for Imaging Technologies in Biological and Biomedical Sciences WP11 Data Storage and Analysis Task 11.1 Coordination Deliverable 11.2 Community Needs of

More information

IsoBase: a database of functionally related proteins across PPI networks

IsoBase: a database of functionally related proteins across PPI networks D295 D300 doi:10.1093/nar/gkq1234 IsoBase: a database of functionally related proteins across PPI networks Daniel Park 1,2, Rohit Singh 1, Michael Baym 1,3,4, Chung-Shou Liao 5 and Bonnie Berger 1,4, *

More information

Integration of data management and analysis for genome research

Integration of data management and analysis for genome research Integration of data management and analysis for genome research Volker Brendel Deparment of Zoology & Genetics and Department of Statistics Iowa State University 2112 Molecular Biology Building Ames, Iowa

More information

Big Data in BioMedical Sciences. Steven Newhouse, Head of Technical Services, EMBL-EBI

Big Data in BioMedical Sciences. Steven Newhouse, Head of Technical Services, EMBL-EBI Big Data in BioMedical Sciences Steven Newhouse, Head of Technical Services, EMBL-EBI Big Data for BioMedical Sciences EMBL-EBI: What we do and why? Challenges & Opportunities Infrastructure Requirements

More information

Visualisation tools for next-generation sequencing

Visualisation tools for next-generation sequencing Visualisation tools for next-generation sequencing Simon Anders EBI is an Outstation of the European Molecular Biology Laboratory. Outline Exploring and checking alignment with alignment viewers Using

More information

RJE Database Accessory Programs

RJE Database Accessory Programs RJE Database Accessory Programs Richard J. Edwards (2006) 1: Introduction...2 1.1: Version...2 1.2: Using this Manual...2 1.3: Getting Help...2 1.4: Availability and Local Installation...2 2: RJE_DBASE...3

More information

Genomics Services @ GENterprise

Genomics Services @ GENterprise Genomics Services @ GENterprise since 1998 Mainz University spin-off privately financed 6-10 employees since 2006 Genomics Services @ GENterprise Sequencing Service (Sanger/3730, 454) Genome Projects (Bacteria,

More information

Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011

Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011 Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear

More information

Human Genome Organization: An Update. Genome Organization: An Update

Human Genome Organization: An Update. Genome Organization: An Update Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion

More information

The EMBL-European Bioinformatics Institute

The EMBL-European Bioinformatics Institute The EMBL-European Bioinformatics Institute The hub for bioinformatics in Europe Denise Carvalho-Silva denise@ebi.ac.uk www.ebi.ac.uk What is EMBL-EBI? Part of the European Molecular Biology Laboratory

More information

URGI and ELIXIR France for plants and food

URGI and ELIXIR France for plants and food URGI and ELIXIR France for plants and food Elixir - SME & Innovation event, Data Driven Innovation. 19 th march 2015 A L I M E N T A T I O N A G R I C U L T U R E E N V I R O N N E M E N T URGI: Unité

More information

Outline. MicroRNA Bioinformatics. microrna biogenesis. short non-coding RNAs not considered in this lecture. ! Introduction

Outline. MicroRNA Bioinformatics. microrna biogenesis. short non-coding RNAs not considered in this lecture. ! Introduction Outline MicroRNA Bioinformatics Rickard Sandberg Dept. of Cell and Molecular Biology (CMB) Karolinska Institutet! Introduction! microrna target site prediction! Useful resources 2 short non-coding RNAs

More information

Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics

Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics Christopher Benner, PhD Director, Integrative Genomics and Bioinformatics Core (IGC) idash Webinar,

More information

PANTHER User Manual. For PANTHER 9.0. Date: January 7, 2015. The PANTHER Team. Authors:

PANTHER User Manual. For PANTHER 9.0. Date: January 7, 2015. The PANTHER Team. Authors: PANTHER User Manual For PANTHER 9.0 Date: January 7, 2015 Authors: The PANTHER Team Contents 1 Welcome to PANTHER System 1 1.1 About this document........... 1 1.2 How to cite PANTHER.......... 1 1.3 PANTHER

More information

A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques

A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques Proceedings of the 2007 WSEAS International Conference on Computer Engineering and Applications, Gold Coast, Australia, January 17-19, 2007 402 A Multiple DNA Sequence Translation Tool Incorporating Web

More information

The EcoCyc Curation Process

The EcoCyc Curation Process The EcoCyc Curation Process Ingrid M. Keseler SRI International 1 HOW OFTEN IS THE GOLDEN GATE BRIDGE PAINTED? Many misconceptions exist about how often the Bridge is painted. Some say once every seven

More information

Cas-Database: Web-based genome-wide guide RNA library design for gene knockout screens using CRISPR-Cas9

Cas-Database: Web-based genome-wide guide RNA library design for gene knockout screens using CRISPR-Cas9 Bioinformatics Advance Access published February 24, 2016 Databases and ontologies Cas-Database: Web-based genome-wide guide RNA library design for gene knockout screens using CRISPR-Cas9 Jeongbin Park

More information

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:

More information

EMBL-European Bioinformatics Institute. Annual Scientific Report 2012

EMBL-European Bioinformatics Institute. Annual Scientific Report 2012 EMBL-European Bioinformatics Institute Annual Scientific Report 2012 EMBL-EBI Annual Scientific Report 2012 2013 EMBL-European Bioinformatics Institute This publication was produced by EMBL-EBI s External

More information

On-line supplement to manuscript Galaxy for collaborative analysis of ENCODE data: Making large-scale analyses biologist-friendly

On-line supplement to manuscript Galaxy for collaborative analysis of ENCODE data: Making large-scale analyses biologist-friendly On-line supplement to manuscript Galaxy for collaborative analysis of ENCODE data: Making large-scale analyses biologist-friendly DANIEL BLANKENBERG, JAMES TAYLOR, IAN SCHENCK, JIANBIN HE, YI ZHANG, MATTHEW

More information

PlantGDB, plant genome database and analysis tools

PlantGDB, plant genome database and analysis tools D354±D359 Nucleic Acids Research, 2004, Vol. 32, Database issue DOI: 10.1093/nar/gkh046 PlantGDB, plant genome database and analysis tools Qunfeng Dong 1, Shannon D. Schlueter 1 and Volker Brendel 1,2,

More information

Replacing TaqMan SNP Genotyping Assays that Fail Applied Biosystems Manufacturing Quality Control. Begin

Replacing TaqMan SNP Genotyping Assays that Fail Applied Biosystems Manufacturing Quality Control. Begin User Bulletin TaqMan SNP Genotyping Assays May 2008 SUBJECT: Replacing TaqMan SNP Genotyping Assays that Fail Applied Biosystems Manufacturing Quality Control In This Bulletin Overview This user bulletin

More information

Biological Databases and Protein Sequence Analysis

Biological Databases and Protein Sequence Analysis Biological Databases and Protein Sequence Analysis Introduction M. Madan Babu, Center for Biotechnology, Anna University, Chennai 25, India Bioinformatics is the application of Information technology to

More information

GWASrap User Manual v1.1

GWASrap User Manual v1.1 GWASrap User Manual v1.1 1 / 28 Table of contents Introduction... 3 System Requirements... 3 Welcome... 3 Features... 4 Create New Run... 5 GWAS Representation... 7 GWAS Annotation... 13 GWAS Prioritization...

More information

Fast. Integrated Genome Browser & DAS. Easy. Flexible. Free. bioviz.org/igb

Fast. Integrated Genome Browser & DAS. Easy. Flexible. Free. bioviz.org/igb bioviz.org/igb Integrated Genome Browser & DAS Free tools for visualizing, sharing, and publishing genomes and genome-scale data. Easy Flexible Fast Free Funding: National Science Foundation Arabidopsis

More information

Data Sharing Initiative: International Cancer Genome Consortium

Data Sharing Initiative: International Cancer Genome Consortium Data Sharing Initiative: International Cancer Genome Consortium Tom Hudson, MD President and Scientific Director Ontario Institute for Cancer Research 1 Sharing Data Sharing BIG Genome Initiative: DATA

More information

Information and Data Sharing Policy* Genomics:GTL Program

Information and Data Sharing Policy* Genomics:GTL Program Appendix 1 Information and Data Sharing Policy* Genomics:GTL Program Office of Biological and Environmental Research Office of Science Department of Energy Appendix 1 Final Date: April 4, 2008 Introduction

More information

BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16

BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16 Course Director: Dr. Barry Grant (DCM&B, bjgrant@med.umich.edu) Description: This is a three module course covering (1) Foundations of Bioinformatics, (2) Statistics in Bioinformatics, and (3) Systems

More information

EMBL Identity & Access Management

EMBL Identity & Access Management EMBL Identity & Access Management Rupert Lück EMBL Heidelberg e IRG Workshop Zürich Apr 24th 2008 Outline EMBL Overview Identity & Access Management for EMBL IT Requirements & Strategy Project Goal and

More information

Introduction. Overview of Bioconductor packages for short read analysis

Introduction. Overview of Bioconductor packages for short read analysis Overview of Bioconductor packages for short read analysis Introduction General introduction SRAdb Pseudo code (Shortread) Short overview of some packages Quality assessment Example sequencing data in Bioconductor

More information

Frequently Asked Questions Next Generation Sequencing

Frequently Asked Questions Next Generation Sequencing Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided

More information

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS

More information

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold

More information

What s New in Pathway Studio Web 11.1

What s New in Pathway Studio Web 11.1 1 1 What s New in Pathway Studio Web 11.1 Elseiver is pleased to announce the release of Pathway Studio Web 11.1 for all database subscriptions (Mammal, Mammal+ChemEffect+DiseaseFx, Plant). This release

More information

Basic processing of next-generation sequencing (NGS) data

Basic processing of next-generation sequencing (NGS) data Basic processing of next-generation sequencing (NGS) data Getting from raw sequence data to expression analysis! 1 Reminder: we are measuring expression of protein coding genes by transcript abundance

More information

ENABLING DATA TRANSFER MANAGEMENT AND SHARING IN THE ERA OF GENOMIC MEDICINE. October 2013

ENABLING DATA TRANSFER MANAGEMENT AND SHARING IN THE ERA OF GENOMIC MEDICINE. October 2013 ENABLING DATA TRANSFER MANAGEMENT AND SHARING IN THE ERA OF GENOMIC MEDICINE October 2013 Introduction As sequencing technologies continue to evolve and genomic data makes its way into clinical use and

More information

Data integration and modelling in health sciences Science as a conversation across borders

Data integration and modelling in health sciences Science as a conversation across borders Open data key to the future Helsinki 2011-11-01 Data integration and modelling in health sciences Science as a conversation across borders Juni Palmgren Karolinska Institutet and FIMM, Helsinki University

More information

Human-Mouse Synteny in Functional Genomics Experiment

Human-Mouse Synteny in Functional Genomics Experiment Human-Mouse Synteny in Functional Genomics Experiment Ksenia Krasheninnikova University of the Russian Academy of Sciences, JetBrains krasheninnikova@gmail.com September 18, 2012 Ksenia Krasheninnikova

More information

Comparing Methods for Identifying Transcription Factor Target Genes

Comparing Methods for Identifying Transcription Factor Target Genes Comparing Methods for Identifying Transcription Factor Target Genes Alena van Bömmel (R 3.3.73) Matthew Huska (R 3.3.18) Max Planck Institute for Molecular Genetics Folie 1 Transcriptional Regulation TF

More information

Lecture Outline. Introduction to Databases. Introduction. Data Formats Sample databases How to text search databases. Shifra Ben-Dor Irit Orr

Lecture Outline. Introduction to Databases. Introduction. Data Formats Sample databases How to text search databases. Shifra Ben-Dor Irit Orr Introduction to Databases Shifra Ben-Dor Irit Orr Lecture Outline Introduction Data and Database types Database components Data Formats Sample databases How to text search databases What units of information

More information

European Genome-phenome Archive database of human data consented for use in biomedical research at the European Bioinformatics Institute

European Genome-phenome Archive database of human data consented for use in biomedical research at the European Bioinformatics Institute European Genome-phenome Archive database of human data consented for use in biomedical research at the European Bioinformatics Institute Justin Paschall Team Leader Genetic Variation / EGA ! European Genome-phenome

More information

Simplifying Data Interpretation with Nexus Copy Number

Simplifying Data Interpretation with Nexus Copy Number Simplifying Data Interpretation with Nexus Copy Number A WHITE PAPER FROM BIODISCOVERY, INC. Rapid technological advancements, such as high-density acgh and SNP arrays as well as next-generation sequencing

More information

REVIEWS GENOME ANNOTATION: FROM SEQUENCE TO BIOLOGY. Lincoln Stein

REVIEWS GENOME ANNOTATION: FROM SEQUENCE TO BIOLOGY. Lincoln Stein GENOME ANNOTATION: FROM SEQUENCE TO BIOLOGY Lincoln Stein The genome sequence of an organism is an information resource unlike any that biologists have previously had access to. But the value of the genome

More information

Life as a scientific database curator

Life as a scientific database curator Life as a scientific database curator Sandra Orchard EBI is an Outstation of the European Molecular Biology Laboratory. What is a database curator Curator OED - a keeper of a museum or other collection

More information

SUBMITTING DNA SEQUENCES TO THE DATABASES

SUBMITTING DNA SEQUENCES TO THE DATABASES Bioinformatics: A Practical Guide to the Analysis of Genes and Proteins, Second Edition Andreas D. Baxevanis, B.F. Francis Ouellette Copyright 2001 John Wiley & Sons, Inc. ISBNs: 0-471-38390-2 (Hardback);

More information

Analytical Study of Hexapod mirnas using Phylogenetic Methods

Analytical Study of Hexapod mirnas using Phylogenetic Methods Analytical Study of Hexapod mirnas using Phylogenetic Methods A.K. Mishra and H.Chandrasekharan Unit of Simulation & Informatics, Indian Agricultural Research Institute, New Delhi, India akmishra@iari.res.in,

More information

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert September 24, 2013 Abstract FlipFlop implements a fast method for de novo transcript

More information