BCOR101 Midterm II Wednesday, October 26, 2005

Size: px
Start display at page:

Download "BCOR101 Midterm II Wednesday, October 26, 2005"

Transcription

1 BCOR101 Midterm II Wednesday, October 26, 2005 Name Key Please show all of your work. 1. A donor strain is trp+, pro+, met+ and a recipient strain is trp-, pro-, met-. The donor strain is infected with phage an the lysate is used to inoculate the recipient (-) strain. After a few minutes, the inoculated recipients are plated on plates without. 100 colonies were chosen at random and those colonies were tested for their ability to also grow on plates without proline or on plates without methionine or both. Here are the results: Type of plate Number of colonies that can grow All nutrients except 100 All except proline and 40 All except methionine and 10 All except proline 0 methioinine and a) What is the order of the three genes trp, pro, and met? Trp is in the middle. b) Which gene (pro or met) is closer to trp? Pro is closer because the cotransduction frequency is higher 2. White Leghorn chickens are homozygous for a dominant allele C that produces colored feathers, but also homozygous for the dominant inhibitor allele at another locus (I) that inhibits color formation and prevents expression of C. Another breed (White Wyandottes) are homozygous for both recessive alleles (ccii). They make neither the pigment nor the inhibitor. a) If White leghorns and White Wyandottes are crossed, how many of the F1 chickens will have white feathers? CCII x ccii -> CcIi All of the chickens will be white because they have one copy of the dominant inhibitor, I. b) If those F1s are randomly crossed among themselves, what proportions of offspring are expected to be white in the F2? 13/16 CcIi x CcIc -> 9 C-I- white 3 C-ii dark 3 ccii white 1 ccii white

2 3. The substrates A, B, C, D, and E are all involved in the same biosynthetic pathway for an essential nutrient (X). Four mutants (1-4) were identified which were unable to grow without an external source of nutrient X. They were then tested for their ability to grow on each of the intermediate substrates. + means the cells grew; 0 means they could not grow. A B C D E a) What is the order of substrates in that pathway? B - C- A- E- D b) For mutant #1, which substrate is likely to build up to high concentrations in the cell? B. Mutation 1 blocks the B->C step, so the precursor (B) will build up in the cell. 4. The petals of the plant blue-eyed Mary are usually blue, but occasionally you find pink or white flowered plants. Pure true-breeding lines of blue, pink, and white flowered plants were crossed, to produce an F1. Then the F1 plants were selfed to make an F2. Here are the results: True-breeding line cross F1 F2 phenotypes Blue x Blue Blue 90 blue Genotypes: PPBB x PPBB PPBB PPBB Blue x Pink Blue 301 blue; 102 pink Genotypes: PPBB x PPbb PPBb PPB-; PPbb Blue x White Blue 99 blue; 33 white Genotypes: PPBB x ppbb PpBB P-BB; ppbb White x Pink Blue 91 blue; 40 white; 32 pink Genotypes: ppbb x PPbb PpBb P-B-; pp--; P-bb a) Provide a genetic explanation for these results. Define some allele symbols of your choice. List the genotypes for each color class in the table above. Must be two loci, because white x pink gives blue F1 and 9:4:3 ratio. Assume the first locus P makes a pink pigment with P dominant to p (white). The second locus (B) converts pink to blue, with P dominant to p. b) A certain white plant and a certain pink plant (from the F2 in the last line of the table) were crossed and gave 50 pink and 50 blue. What must have been the genotypes of those two plants? Must be ppbb (white) x PPbb (pink) Offspring would then be PpBb (pink) and (PpBb (blue)

3 5. For the replication bubble illustrated here a) indicate the leading strand and the lagging strand at each replication fork b) identify the ends of each of the fragments below as 3 or 5. Fragment (Label 5 and 3 ends) 3 -a b-5 Does this fragment represent a leading or lagging strand? leading strand 3 - c d-5 lagging strand 5 -e f-3 5 -g h-3 lagging strand leading strand 6. You have isolated a strain of E. coli with a mutation in DNA ligase. The enzyme functions when cells are grown at 22 C but is inactive when cells are grown at 37 C. Cells were grown at 22 C in media containing 15 N until all of their DNA contained 15 N. The cells were then shifted to 37 C and grown in media containing 14 N for one generation. Using solid lines for 15 N DNA and dashed lines for 14N DNA, show what the products of replication would look like and compare these to what they would look like if the cells were grown at 22 C. At 22 C, both the leading and lagging strand would be synthesized normally. At 37 C, the lagging strand would contain Okazaki fragments that would not be joined together due to the mutation in DNA ligase. Therefore, there will be gaps between the Okazaki fragments bound to the template strand. 22 C: 37 C: Lagging strand Leading strand

4 7. For the RNA sequence 5 CAUCAUGACAGACCCUUGCUAACGC-3 a) Show the sequence of both strands of the DNA from which this RNA was transcribed. 5 CATCATGACAGACCCTTGCTAACGC GTAGTACTGTCTGGGAACGATTGCG 5 b) indicate the 5 and 3 ends of each DNA strand and label the template strand. See above c) what is the sequence of the peptide encoded by this RNA? Met Thr Asp Pro Cys 8. The anticodon of a trna molecule is 5 -AUG-3. What amino acid is attached to the 3 end of this trna? Explain your answer. The codon that interacts with 5 -CAU- which codes for histidine. 9. A friend brings you three samples of nucleic acid and asks you to determine each sample s chemical identity (whether DNA or RNA) and whether the molecules are double-stranded or single-stranded. You use powerful nucleases to degrade each sample to its constituent nucleoside monophosphates and then determine the approximate relative proportions of the nucleosides. The results of your assay are shown below. What can you tell your friend about the nature of these samples? Sample 1: dgmp: 13% dcmp: 14% damp: 36% dtmp: 37% - double stranded DNA Sample 2: dgmp: 12% dcmp: 36% damp: 47% dtmp: 5% - single stranded DNA Sample 3: GMP: 22% CMP: 47% AMP 17% UMP: 14% - single stranded RNA

5 10. Two E. coli genes, A and B, are known from mapping experiments to be very close to each other. A deletion mutation is isolated that eliminates the activity of both A and B. Neither the A nor the B protein can be found in the mutant, but a novel protein is isolated in which the amino-terminal 30 amino acids are identical to those of the B gene product and the carboxyl-terminal 30 amino acids are identical to those of the A gene product. With regard the 5 3 orientation of the nontranscribed DNA strand, is the order of the genes AB or BA? Explain your answer. The order of the genes is BA. If you are looking at the nontranscribed DNA strand, the orientation of the A and B genes is the same as found in the mrna. The novel protein found in the mutant has the same amino terminus as the B protein and the same carboxyterminus as the A protein. Thus, the mutation must have resulted in a deletion between A and B, and fused the 5 end of the B gene with the 3 end of the A gene. 11. Please complete the table below, indicating all of the nucleotides in the DNA, mrna and trnas and the amino acid sequence of the encoded peptide. DNA DNA mrna trna protein DNA: ATGTATGAAAAATGG DNA: TACATACTTTTTACC RNA: AUGUAUGAAAAAUGG trna: UACAUACUUUUUACC protein: met-tyr-glu-lys-trp

Lecture 2. A B C D histidine Protein

Lecture 2. A B C D histidine Protein Lecture 2 In this lecture we are going to consider experiments on yeast, a very useful organism for genetic study. Yeast is more properly known as Saccharomyces cerevisiae, which is the single-celled microbe

More information

Translation. The process of converting the mrna base sequence into amino acid chains or proteins; occurs in the cytoplasm of the cell on ribosomes

Translation. The process of converting the mrna base sequence into amino acid chains or proteins; occurs in the cytoplasm of the cell on ribosomes The process of converting the mrna base sequence into amino acid chains or proteins; occurs in the cytoplasm of the cell on ribosomes The process of converting the mrna base sequence into amino acid chains

More information

From Gene to Protein Transcription and Translation i

From Gene to Protein Transcription and Translation i From Gene to Protein Transcription and Translation i How do the genes in our DNA influence our characteristics? For example, how can a gene determine whether a person is an albino with very pale skin and

More information

Opening Activity: Where in the cell does transcription take place? Latin Root Word: Review of Old Information: Transcription Video New Information:

Opening Activity: Where in the cell does transcription take place? Latin Root Word: Review of Old Information: Transcription Video New Information: Section 1.4 Name: Opening Activity: Where in the cell does transcription take place? Latin Root Word: Review of Old Information: Transcription Video New Information: Protein Synthesis: pages 193-196 As

More information

BINF6201/8201. Basics of Molecular Biology

BINF6201/8201. Basics of Molecular Biology BINF6201/8201 Basics of Molecular Biology 08-26-2016 Linear structure of nucleic acids Ø Nucleic acids are polymers of nucleotides Ø Nucleic acids Deoxyribonucleic acids (DNA) Ribonucleic acids (RNA) Phosphate

More information

Genetics Lecture Notes 7.03 2005. Lectures 1 2

Genetics Lecture Notes 7.03 2005. Lectures 1 2 Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several

More information

Study Guide Chapter 12

Study Guide Chapter 12 Study Guide Chapter 12 1. Know ALL of your vocabulary words! 2. Name the following scientists with their contributions to Discovering DNA: a. Strains can be transformed (or changed) into other forms while

More information

Genetics. Chapter 9. Chromosome. Genes Three categories. Flow of Genetics/Information The Central Dogma. DNA RNA Protein

Genetics. Chapter 9. Chromosome. Genes Three categories. Flow of Genetics/Information The Central Dogma. DNA RNA Protein Chapter 9 Topics - Genetics - Flow of Genetics/Information - Regulation - Mutation - Recombination gene transfer Genetics Genome - the sum total of genetic information in a organism Genotype - the A's,

More information

Complementary Base Pairs: A and T. DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T).

Complementary Base Pairs: A and T. DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T). Complementary Base Pairs: A and T DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T). Complementary Base Pairs: G and C DNA contains complementary

More information

Chapter 10: Protein Synthesis. Biology

Chapter 10: Protein Synthesis. Biology Chapter 10: Protein Synthesis Biology Let s Review What are proteins? Chains of amino acids Some are enzymes Some are structural components of cells and tissues More Review What are ribosomes? Cell structures

More information

Bio 102 Practice Problems Genetic Code and Mutation

Bio 102 Practice Problems Genetic Code and Mutation Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category?

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? DNA and Genetics 1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? A. genome chromosome gene DNA molecule B. genome chromosome DNA

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

ECO-1.1: I can describe the processes that move carbon and nitrogen through ecosystems.

ECO-1.1: I can describe the processes that move carbon and nitrogen through ecosystems. Cycles of Matter ECO-1.1: I can describe the processes that move carbon and nitrogen through ecosystems. ECO-1.2: I can explain how carbon and nitrogen are stored in ecosystems. ECO-1.3: I can describe

More information

Biology Final Exam Study Guide: Semester 2

Biology Final Exam Study Guide: Semester 2 Biology Final Exam Study Guide: Semester 2 Questions 1. Scientific method: What does each of these entail? Investigation and Experimentation Problem Hypothesis Methods Results/Data Discussion/Conclusion

More information

Ingenious Genes Curriculum Links for AQA AS (7401) and A-Level Biology (7402)

Ingenious Genes Curriculum Links for AQA AS (7401) and A-Level Biology (7402) Ingenious Genes Curriculum Links for AQA AS (7401) and A-Level Biology (7402) 3.1.1 Monomers and Polymers 3.1.4 Proteins 3.1.5 Nucleic acids are important information-carrying molecules 3.2.1 Cell structure

More information

2006 7.012 Problem Set 3 KEY

2006 7.012 Problem Set 3 KEY 2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

DNA to Protein BIOLOGY INSTRUCTIONAL TASKS

DNA to Protein BIOLOGY INSTRUCTIONAL TASKS BIOLOGY INSTRUCTIONAL TASKS DNA to Protein Grade-Level Expectations The exercises in these instructional tasks address content related to the following science grade-level expectations: Contents LS-H-B1

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

A and B are not absolutely linked. They could be far enough apart on the chromosome that they assort independently.

A and B are not absolutely linked. They could be far enough apart on the chromosome that they assort independently. Name Section 7.014 Problem Set 5 Please print out this problem set and record your answers on the printed copy. Answers to this problem set are to be turned in to the box outside 68-120 by 5:00pm on Friday

More information

PRACTICE TEST QUESTIONS

PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

4. In a molecule of DNA, if there is 21% adenine (A), how much thymine (T) is present? How much cytosine (C) is present?

4. In a molecule of DNA, if there is 21% adenine (A), how much thymine (T) is present? How much cytosine (C) is present? Name Biology I Test Review DNA, Protein Synthesis and Genetics This review should only be used as a supplement to your notes, activities, and previous quizzes. For additional review and questions it may

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination

More information

Sickle cell anemia: Altered beta chain Single AA change (#6 Glu to Val) Consequence: Protein polymerizes Change in RBC shape ---> phenotypes

Sickle cell anemia: Altered beta chain Single AA change (#6 Glu to Val) Consequence: Protein polymerizes Change in RBC shape ---> phenotypes Protein Structure Polypeptide: Protein: Therefore: Example: Single chain of amino acids 1 or more polypeptide chains All polypeptides are proteins Some proteins contain >1 polypeptide Hemoglobin (O 2 binding

More information

EXTENSIONS OF MENDELIAN INHERITANCE.

EXTENSIONS OF MENDELIAN INHERITANCE. CHAPTER 4: EXTENSIONS OF MENDELIAN INHERITANCE. Many crosses do not yield simple Mendelian ratios. Instead, the ratios are modified. These modifications reflect complexities in gene expression not complexities

More information

13.2 Ribosomes & Protein Synthesis

13.2 Ribosomes & Protein Synthesis 13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).

More information

DNA Lecture II Protein Synthesis Notes. Using the Code of Life DNA & RNA. Page #1 (Stratton 2010) Name: 2. : production of proteins

DNA Lecture II Protein Synthesis Notes. Using the Code of Life DNA & RNA. Page #1 (Stratton 2010) Name: 2. : production of proteins Page #1 Using the Code of Life DNA & RNA Slide #2 Two process involve DNA : making an copy of DNA a. purpose: b. occurs: c. uses: DNA : production of proteins a. purpose: & b. occurs: between nucleus &

More information

DNA replication. DNA RNA Protein

DNA replication. DNA RNA Protein DNA replication The central dogma of molecular biology transcription translation DNA RNA Protein replication Revers transcriptase The information stored by DNA: - protein structure - the regulation of

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

RNA & Protein Synthesis

RNA & Protein Synthesis RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis

More information

Transcription Animations

Transcription Animations Transcription Animations Name: Lew Ports Biology Place http://www.lewport.wnyric.org/jwanamaker/animations/protein%20synthesis%20-%20long.html Protein is the making of proteins from the information found

More information

Central Dogma of Genetics

Central Dogma of Genetics Central Dogma of Genetics Within each cell the genetic information flows from DNA to RNA to protein. This flow of information is unidirectional and irreversible. The information carried within the DNA

More information

Microbial Genetics. Chapter 8. Structure and Function of the Genetic Material. Genotype and Phenotype. DNA and Chromosomes.

Microbial Genetics. Chapter 8. Structure and Function of the Genetic Material. Genotype and Phenotype. DNA and Chromosomes. Chapter 8 Microbial Genetics Structure and Function of the Genetic Material Chromosomes are cellular structures made up of genes that carry hereditary information. Genetics is the study of how genes carry

More information

30. Genetics and recombination in bacteria Lecture Outline 11/16/05. The Bacterial Genome and Its Replication The bacterial chromosome

30. Genetics and recombination in bacteria Lecture Outline 11/16/05. The Bacterial Genome and Its Replication The bacterial chromosome 30. Genetics and recombination in bacteria Lecture Outline 11/16/05 Replication in bacteria Types of recombination in bacteria Transduction by phage Conjugation ( mating ) F+ plasmids Hfr s Transformation

More information

Solutions to Problem Set 5

Solutions to Problem Set 5 Question 1 Solutions to 7.014 Problem Set 5 a) Which of the following molecules functions directly to transfer information from the nucleus to the cytoplasm? ircle all that apply. DN mrn trn transporter

More information

From DNA to Protein. Chapter 14

From DNA to Protein. Chapter 14 From DNA to Protein Chapter 14 Impacts, Issues: Ricin and your Ribosomes Ricin is toxic because it inactivates ribosomes, the organelles which assemble amino acids into proteins, critical to life processes

More information

Transcription Study Guide

Transcription Study Guide Transcription Study Guide This study guide is a written version of the material you have seen presented in the transcription unit. The cell s DNA contains the instructions for carrying out the work of

More information

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page

More information

Ch 16 and Introduction of Ch 17. This PowerPoint is posted. Replication Transcription Translation Protein!

Ch 16 and Introduction of Ch 17. This PowerPoint is posted. Replication Transcription Translation Protein! Ch 16 and Introduction of Ch 17 This PowerPoint is posted. Replication Transcription Translation Protein! In the start of things lin the 1950 s scientists knew that chromosomes carry hereditary material

More information

From DNA to Protein

From DNA to Protein Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins

More information

GENETICS OF BACTERIA AND VIRUSES

GENETICS OF BACTERIA AND VIRUSES GENETICS OF BACTERIA AND VIRUSES 1 Genes of bacteria are found in bacterial chromosomes Usually a single type of chromosome May have more than one copy of that chromosome Number of copies depends on the

More information

2. The work of Messelson & Stahl showed semi-conservative replication. 4. Cairn's experiments showed chromosomes are semi-conservatively replicated.

2. The work of Messelson & Stahl showed semi-conservative replication. 4. Cairn's experiments showed chromosomes are semi-conservatively replicated. BIOLOGY 207 - Dr.McDermid Lecture#2/3 DNA Structure & Replication Readings: Griffiths et al, 7 th Edition: Ch. 8 pp 243-259 (corrected) Problems: Griffiths et al, 7 th Edition: Ch. 8 Tier 1: # 2,3,5,9,13

More information

INTRODUCTION TO DNA. DNA, CHROMOSOMES AND GENES How do these terms relate to one another?

INTRODUCTION TO DNA. DNA, CHROMOSOMES AND GENES How do these terms relate to one another? INTRODUCTION TO DNA You've probably heard the term a million times. You know that DNA is something inside cells; you probably know that DNA has something to do with who we are and how we get to look the

More information

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication Ch. 12: DNA and RNA 12.1 DNA A. To understand genetics, biologists had to learn the chemical makeup of the gene Genes are made of DNA DNA stores and transmits the genetic information from one generation

More information

Seed color gene with two alleles: R = purple (or red) allele (dominant allele) r = yellow (or white) allele (recessive allele)

Seed color gene with two alleles: R = purple (or red) allele (dominant allele) r = yellow (or white) allele (recessive allele) Patterns of Inheritance in Maize written by J. D. Hendrix Learning Objectives Upon completing the exercise, each student should be able to define the following terms gene, allele, genotype, phenotype,

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document.

NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document. Chapter 8 Study Guide What is the study of genetics, and what topics does it focus on? What is a genome? NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document. Describe

More information

rbs/atg Transcription Translation

rbs/atg Transcription Translation (6) 1. Compare and contrast operon vs gene fusions: (a) Draw a simple diagram showing each type of fusion with transcription and translation start and stop sites the mrna transcript expected the expected

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

Unit 6 Study Guide Protein Name pg I can tell the difference between mrna, trna, and rrna.

Unit 6 Study Guide Protein Name pg I can tell the difference between mrna, trna, and rrna. Unit 6 Study Guide Protein Name pg. 1 1. I can tell the difference between mrna, trna, and rrna. Messenger RNA (mrna) acts as a copy of the instructions for making a protein. mrna carries these instructions

More information

SAM Teacher s Guide DNA to Proteins

SAM Teacher s Guide DNA to Proteins SAM Teacher s Guide DNA to Proteins Note: Answers to activity and homework questions are only included in the Teacher Guides available after registering for the SAM activities, and not in this sample version.

More information

BioBoot Camp Genetics

BioBoot Camp Genetics BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before

More information

Exercise 7: DNA and Protein Synthesis

Exercise 7: DNA and Protein Synthesis Exercise 7: DNA and Protein Synthesis Introduction DNA is the code of life, and it is the blueprint for all living things. DNA is contained in all cells, and it is replicated every time a cell divides.

More information

Transcription & Translation. Part of Protein Synthesis

Transcription & Translation. Part of Protein Synthesis Transcription & Translation Part of Protein Synthesis Three processes Initiation Transcription Elongation Termination Initiation The RNA polymerase binds to the DNA molecule upstream of the gene at the

More information

Academic Nucleic Acids and Protein Synthesis Test

Academic Nucleic Acids and Protein Synthesis Test Academic Nucleic Acids and Protein Synthesis Test Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. Each organism has a unique combination

More information

Transcription recap What is translation? Short Video Activity. Initiation Elongation Termination. Short Quiz on Thursday! 6.1 and 6.

Transcription recap What is translation? Short Video Activity. Initiation Elongation Termination. Short Quiz on Thursday! 6.1 and 6. Protein Synthesis Transcription recap What is translation? Initiation Elongation Termination Short Video Activity Short Quiz on Thursday! 6.1 and 6.2 1. RNA polymerase attaches to promoter region 2. Unwinds/unzips

More information

OUTCOMES. PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation OVERVIEW ANIMATION CONTEXT RIBONUCLEIC ACID (RNA)

OUTCOMES. PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation OVERVIEW ANIMATION CONTEXT RIBONUCLEIC ACID (RNA) OUTCOMES PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation 3.5.1 Compare the structure of RNA and DNA. 3.5.2 Outline DNA transcription in terms of the formation of an RNA strand

More information

Structure. Structural Components of Nucleotides Base. Introduction Nucleotide to Cells & Microscopy and Nucleic Acid. Sugar. Phosphate Glycosidic bond

Structure. Structural Components of Nucleotides Base. Introduction Nucleotide to Cells & Microscopy and Nucleic Acid. Sugar. Phosphate Glycosidic bond 11 Introduction Nucleotide to Cells & Microscopy and Nucleic Acid Structure Structural Components of Nucleotides Base Sugar Phosphate Glycosidic bond H NUCLEOTIDE H 1 RNA DNA Table 3-1 Nucleic acid polymer

More information

Written by: Prof. Brian White

Written by: Prof. Brian White Molecular Biology II: DNA Transcription Written by: Prof. Brian White Learning Goals: To work with a physical model of DNA and RNA in order to help you to understand: o rules for both DNA & RNA structure

More information

From DNA to Protein! (Transcription & Translation)! I. An Overview

From DNA to Protein! (Transcription & Translation)! I. An Overview Protein Synthesis! From DNA to Protein! (Transcription & Translation)! I. An Overview A. Certain sequences of nucleotides in DNA [called genes], can be expressed/used as a code to determine the sequence

More information

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes.

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology has had-and will havemany important

More information

Tuesday 11/13. Agenda 1.Warm Up (Stamp HW) 2.Protein Synthesis Notes 3.HW Time (Transcription/ Translation Worksheet)

Tuesday 11/13. Agenda 1.Warm Up (Stamp HW) 2.Protein Synthesis Notes 3.HW Time (Transcription/ Translation Worksheet) Tuesday 11/13 Warm Up 1.What are the three parts of a nucleotide? How do two nucleotides link together 2.What binds the two strands of DNA together? Be Specific 3.What are the three main enzymes of DNA

More information

DNA & Protein Synthesis Exam

DNA & Protein Synthesis Exam DNA & Protein Synthesis Exam DO NOT WRITE ON EXAM EXAM # VER. B Multiple choice Directions: Answer the following questions based on the following diagram. (1pt. each) 5. The above nucleotide is purine

More information

Transcription, Translation & Protein Synthesis

Transcription, Translation & Protein Synthesis Transcription, Translation & Protein Synthesis Do you remember what proteins are made of? Hundreds of Amino Acids link together to make one Protein There are 20 types of amino acids, some we can make,

More information

Molecular Biology Basic Concepts

Molecular Biology Basic Concepts Molecular Biology Basic Concepts Prof. Dr. Antônio Augusto Fröhlich Charles Ivan Wust LISHA - UFSC {guto charles}@lisha.ufsc.br http://www.lisha.ufsc.br/~{guto charles} September 2003 September 2003 http://www.lisha.ufsc.br/~guto

More information

STUDENT ID NUMBER, LAST NAME,

STUDENT ID NUMBER, LAST NAME, EBIO 1210: General Biology 1 Name Exam 3 June 25, 2013 To receive credit for this exam, you MUST bubble in your STUDENT ID NUMBER, LAST NAME, and FIRST NAME No. 2 pencils only You may keep this exam to

More information

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed

More information

TTGGHTGUTGG CCAAACACCAA AACCCACAACC HHUUTHUGHUU

TTGGHTGUTGG CCAAACACCAA AACCCACAACC HHUUTHUGHUU Conceptual Questions C1. Answer: It is a double-stranded structure that follows the AT/GC rule. C2. Answer: Bidirectional replication refers to DNA replication in both directions starting from one origin.

More information

Translation Activity Guide

Translation Activity Guide Translation Activity Guide Teacher Key β-globin Translation Translation occurs in the cytoplasm of the cell and is defined as the synthesis of a protein (polypeptide) using information encoded in an mrna

More information

Chapter 10 Manipulating Genes

Chapter 10 Manipulating Genes How DNA Molecules Are Analyzed Chapter 10 Manipulating Genes Until the development of recombinant DNA techniques, crucial clues for understanding how cell works remained lock in the genome. Important advances

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

Genetics. Instructor: Dr. Jihad Abdallah Topic 5: Translation of RNA (Protein synthesis)

Genetics. Instructor: Dr. Jihad Abdallah Topic 5: Translation of RNA (Protein synthesis) Genetics Instructor: Dr. Jihad Abdallah Topic 5: Translation of RNA (Protein synthesis) 1 Central dogma of genetics DNA In the nucleus Transcription mrna Translation In the cytoplasm Protein 2 3 The primary

More information

Cells and Their Housekeeping Functions Nucleus and Other Organelles

Cells and Their Housekeeping Functions Nucleus and Other Organelles Cells and Their Housekeeping Functions Nucleus and Other Organelles Shu-Ping Lin, Ph.D. Institute of Biomedical Engineering E-mail: splin@dragon.nchu.edu.tw Website: http://web.nchu.edu.tw/pweb/users/splin/

More information

16 Protein Synthesis: Transcription and Translation

16 Protein Synthesis: Transcription and Translation 16 Protein Synthesis: Transcription and Translation Ge n e s c a r r y t h e information that, along with environmental factors, determines an organism s traits. How does this work? Although the complete

More information

Today s Objectives. Probability rules apply to inheritance at more than one locus

Today s Objectives. Probability rules apply to inheritance at more than one locus Figure 14.8 Segregation of alleles and fertilization as chance events Today s Objectives Use rules of probability to solve genetics problems Define dominance, incomplete dominance, and co-dominance Extend

More information

Biology 3 Mendelian Inheritance (CH 7)

Biology 3 Mendelian Inheritance (CH 7) Biology 3 Mendelian Inheritance (CH 7) Dr. Terence Lee Genetics Genetics 1 2.20 DNA holds the genetic information to build an organism. 2.21 RNA is a universal translator, reading DNA and directing protein

More information

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes HEREDITY = passing on of characteristics from parents to offspring How?...DNA! I. DNA, Chromosomes, Chromatin, and Genes DNA = blueprint of life (has the instructions for making an organism) Chromatin=

More information

Genetics. PART I: Mitosis & Meiosis prerequisites for inheritance. A. Mitosis. Review: A closer look inside of the nucleus: DNA: chromatin:

Genetics. PART I: Mitosis & Meiosis prerequisites for inheritance. A. Mitosis. Review: A closer look inside of the nucleus: DNA: chromatin: Genetics PART I: Mitosis & Meiosis prerequisites for inheritance A. Mitosis Review: A closer look inside of the nucleus: DNA: chromatin: chromosome: parts: chromatid: centromere: telomere: 1 Mitosis &

More information

4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?

4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true? Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.

More information

Genetics 301 Sample Final Examination Spring 2003

Genetics 301 Sample Final Examination Spring 2003 Genetics 301 Sample Final Examination Spring 2003 50 Multiple Choice Questions-(Choose the best answer) 1. A cross between two true breeding lines one with dark blue flowers and one with bright white flowers

More information

Bio EOC Questions for DNA and Protein Synthesis

Bio EOC Questions for DNA and Protein Synthesis Bio EOC Review Topics for DNA and Protein Synthesis o DNA: structure - What are the parts of a nucleotide? sugar, acid, N-bases (and be able to identify these parts on a diagram) A-T / T-A / C-G / G-C

More information

Chapter 11 Genetics. STATE FRAMEWORKS 3. Genetics

Chapter 11 Genetics. STATE FRAMEWORKS 3. Genetics STATE FRAMEWORKS 3. Genetics Chapter 11 Genetics Central Concepts: Genes allow for the storage and transmission of genetic information. They are a set of instructions encoded in the nucleotide sequence

More information

Heredity - Patterns of Inheritance

Heredity - Patterns of Inheritance Heredity - Patterns of Inheritance Genes and Alleles A. Genes 1. A sequence of nucleotides that codes for a special functional product a. Transfer RNA b. Enzyme c. Structural protein d. Pigments 2. Genes

More information

Chapter 6: DNA: Hereditary Molecules of Life pg : DNA Replication and Repair pg

Chapter 6: DNA: Hereditary Molecules of Life pg : DNA Replication and Repair pg UNIT 3: Molecular Genetics Chapter 6: DNA: Hereditary Molecules of Life pg. 268-6.4: DNA Replication and Repair pg. 282-290 The DNA molecule is capable of replicating on its own. This is important for

More information

DNA: Molecule of Life

DNA: Molecule of Life DNA: Molecule of Life History DNA Structure Protein Synthesis Gene Regulation History of DNA H I S T O By the 1940 s, scientists knew that chromosomes consisted of both DNA and protein but did not know

More information

Honors Biology Practice Questions #1. Name. 6. Seastars have a diploid number of 24 chromosomes. The haploid number would be

Honors Biology Practice Questions #1. Name. 6. Seastars have a diploid number of 24 chromosomes. The haploid number would be Honors Biology Practice Questions #1 1. Donkeys have 68 chromosomes in each body cell. If a donkey cell undergoes meiosis, how many chromosomes should be in each gamete? A. 18 B. 34 C. 68 D. 132 2. A sperm

More information

RNA and Protein Synthesis

RNA and Protein Synthesis RNA and Protein Synthesis Answer Key Vocabulary: amino acid, anticodon, codon, gene, messenger RNA, nucleotide, ribosome, RNA, RNA polymerase, transcription, transfer RNA, translation Prior Knowledge Questions

More information

7.03 Fall 2004 PSets w/keys 1 of 112

7.03 Fall 2004 PSets w/keys 1 of 112 7.03 Fall 2004 PSets w/keys 1 of 112 7.03 Problem Set 1 Due before 5 PM on Thursday, September 23, 2004 Hand in answers to the appropriate slot in the box outside of 68-120. Late problem Sets will NOT

More information

BIOLOGICAL BACKGROUND THE CENTRAL DOGMA OF MOLECULAR BIOLOGY

BIOLOGICAL BACKGROUND THE CENTRAL DOGMA OF MOLECULAR BIOLOGY BIOLOGICAL BACKGROUND Central Dogma DNA and RNA Structure Replication, Transcription and Translation Techniques of Molecular Genetics Using restriction enzymes Using PCR THE CENTRAL DOGMA OF MOLECULAR

More information

These practice questions are from prior LS4 finals and are courtesy of Drs. Laski, Chen and Sagasti.

These practice questions are from prior LS4 finals and are courtesy of Drs. Laski, Chen and Sagasti. These practice questions are from prior LS4 finals and are courtesy of Drs. Laski, Chen and Sagasti. A few short questions no short answer questions on the exam but good practice 1. If a grandfather has

More information

Chromosome Mapping by Recombination

Chromosome Mapping by Recombination Chromosome Mapping by Recombination Genes on the same chromosome are said to be linked. Crossing over: the physical exchange of homologous chromosome segments A given crossover generates two reciprocal

More information

DNA TM Review And EXAM Review. Ms. Martinez

DNA TM Review And EXAM Review. Ms. Martinez DNA TM Review And EXAM Review Ms. Martinez 1. Write out the full name for DNA molecule. Deoxyribonucleic acid 2. What are chromosomes? threadlike strands made of DNA and PROTEIN 3. What does DNA control

More information

Transcription Activity Guide

Transcription Activity Guide Transcription Activity Guide Teacher Key Ribonucleic Acid (RNA) Introduction Central Dogma: DNA to RNA to Protein Almost all dynamic functions in a living organism depend on proteins. Proteins are molecular

More information