Next Generation Sequencing

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Next Generation Sequencing"

Transcription

1 Next Generation Sequencing 38. Informationsgespräch der Blutspendezentralefür Wien, Niederösterreich und Burgenland Österreichisches Rotes Kreuz 22. November 2014, Parkhotel Schönbrunn

2 Die Zukunft hat begonnen.

3 Generationen 1 Sanger 2 Roche454/Illumina/IonTorrent 3 Pacific Biosystems 4 Oxford Nanopore

4

5

6

7

8 Emulsion PCR

9 DirectsequencingofUnseparated Alleles CCRCCCCGAMCGATCTACTCACTACTCACTWC

10 CloningandSequencing CCRCCCCGAMCGATCTACTCACTACTCACTWC CCACCCCGACCGATCTACTCACTACTCACTAC CCGCCCCGAACGATCTACTCACTACTCACTTC

11 NGS CCRCCCCGAMCGATCTACTCACTACTCACTWC CCACCCC ACCCCGACCGA CCGAACGAT AACGATCTACT CTCACTACTCACTAC TACTCACTTC

12 Sequencing Errors InsertionsandDeletionsmainlyon homopolymer stretches: Ref: CCCCG #1: CCCCCG #2: CCCG #3: CTCCG

13 2 nd Generation, Library Prep PCR Emulsion PCR Polony Amplification Semiconductor Sequencing Pyro Sequencing Reversible Terminator Sequencing

14 Sanger vsngs (2 nd Generation) Workflow PCR (Exons2, 3) Sequenzierreaktion Capillarelektophorese Amplifikation einzelner Moleküle Run, Erfassung der Rxn in ACCGGGAGACACAGATCTGCAAGGCCAAGGCGACAGACTG ACCGAGAGAACCTGCGGATCGCGCTCCGCTACTACAACCAG AGCGAGGCCGGTGAGTGACCCCGGCCCGGGGCGCAGGTC ACGACCGCCCATCCACGTACGCGGCGCCCGATC ,,00&,&-0&-00& '-25+6,,( ,2.4047*001+

15 Proof of Principle Bentley et al, Tissue Antigens 2009, 74:393 Gabriel et al, Hum Immunol2009, 70:960 Lindet al, Hum Immunol2010, 71:1033 Erlichet al, BMC Genomics2011, 12:42 Holcomb et al, Tissue Antigens 2011, 77:206 Wang et al, ProcNatlAcadSci2012,109:8676 Shiina et al, Tissue Antigens 2012, 80:305

16 B*57:01? HIV Patient from Niederösterreich

17 Deletionin Exon3 gdna B*44:138Q GGCCAG GGTC TCACA...TCCAG AGGATGTACG GCTGCGACGT GGGGCCGGAC GGGCGCCTCC TCCGCGGGTA TGACCAGGAC GCCTACGACG GCAAGGATTA B*44:02:01: TCA

18 Sanger-Primer Designation Sequence (5 ->3 ) Purpose B*44--18fwd GCA CCC ACC CGG ACT CAG AA Amplification & Sequencing B* rev GGG GTC ACG GTG GAC ACG G Amplification & Sequencing B* rev TCG TCC ACG TAG CCC ACG GT Sequencing B* fwd GGG TCT CAC ATC ATC CAG AGG Sequencing B* fwd GTC CTA GGG TGT CCC ATG AG Sequencing B* rev GAA GAG ATA TGA CCC CTC ATC Sequencing B* fwd CTG GAG CCC TTC AGC AGG Sequencing B* fwd TGT GAT GTG TAG GAG GAA GAG C Sequencing B* fwd TCC CAG TCC CCT CAC AGG G Sequencing B* rev CCC ACC CAC CCC CAG ACC T Sequencing

19 NGS-Primer Designation Sequence (5 ->3 ) Purpose B_F1 CCC GGT TGC AAT AGA CAG TAA CAA A NGS Amplification (Shiinaetal.) B_R1 GGG TCC AAT TTC ACA GAC AAA TGT NGS Amplification (Shiina et al.)

20 Gene Conversion& Mutations B*44:138Q III I B*44:02:01:01 B*46:01:01

21 Propositi Patient SN: Father SG: Sister SGr: Brother SA: HLA Typing A*02:01/09,*03:01 B*07:02,*44:138Q C*07:02,*07:04 A*23:01,*03:01 B*44:03,* 44:138Q C*04:01,*07:04 A*02:01/09,*23:01 B*07:02,*44:03 C*07:02,*04:01 A*02:01/09,*03:01 B*40:01,* 44:138Q C*03:04,*07:04

22 Super high resolution for single molecule-sequence-based typing of classical HLA loci at the 8-digit level using next generation sequencers, T. Shiina, et al. Tissue Antigens, 2012, 80,

23 HLA Typingon a 314 Chip

24 HLA TypeStreamT Analysis Software

25 Coverage

26 Advantages Whole gene sequencing possible Clonal sequences Automation Chip size Low to High throughput Costs

27 Flaws, Outlook HLA/IMGT database currently incomplete->? Urgent samples? Emulsion PCR? Length of reads GC rich regions Coverage Phase Amplification bias -> Third Generation Sequencing?

28 Sanger vsngs (3 rd Generation) Workflow PCR (Exons2, 3) Sequenzierreaktion Capillarelektophorese Amplifikation einzelner Moleküle Run, Erfassung der Rxn in ACCGGGAGACACAGATCTGCAAGGCCAAGGCGACAGACTG ACCGAGAGAACCTGCGGATCGCGCTCCGCTACTACAACCAG AGCGAGGCCGGTGAGTGACCCCGGCCCGGGGCGCAGGTC ACGACCGCCCATCCACGTACGCGGCGCCCGATC ,,00&,&-0&-00& '-25+6,,( ,2.4047*001+

29

30

31

32 Generation 4 -NanoporeSequencing Single molecule sequencing incorporating nanopore technology Protein pore->solid state channel(dna-transistor) USB size portable DNA sequencer Wholegenomescan15 min Very low cost

33 Schematic of the nanopore device. Schreiber J et al. PNAS 2013;110: by National Academy of Sciences

34 Strategy for reading epigenetic modifications on a target CG dinucleotide. Schreiber J et al. PNAS 2013;110: by National Academy of Sciences

35 Die Zukunft hat begonnen... und ist noch jung

HP22.1 Roth Random Primer Kit A für die RAPD-PCR

HP22.1 Roth Random Primer Kit A für die RAPD-PCR HP22.1 Roth Random Kit A für die RAPD-PCR Kit besteht aus 20 Einzelprimern, jeweils aufgeteilt auf 2 Reaktionsgefäße zu je 1,0 OD Achtung: Angaben beziehen sich jeweils auf ein Reaktionsgefäß! Sequenz

More information

(http://genomes.urv.es/caical) TUTORIAL. (July 2006)

(http://genomes.urv.es/caical) TUTORIAL. (July 2006) (http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA

More information

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core DNA Sequencing Services Pre-Mixed o Provide template and primer, mixed into the same tube* Pre-Defined o Provide template and primer in separate tubes* Custom o Full-service for samples with unknown concentration

More information

Grundlagen der Bioinformatik, SS 08, D. Huson, April 21,

Grundlagen der Bioinformatik, SS 08, D. Huson, April 21, Grundlagen der Bioinformatik, SS 08, D. Huson, April 21, 2008 7 2 Introduction to Molecular Biology We will start with a very short repetition of the basics of molecular biology, including a summary of

More information

DNA and Protein Synthesis Grade 10

DNA and Protein Synthesis Grade 10 Ohio Standards Connection: Life Sciences Benchmark C Explain the genetic mechanisms and molecular basis of inheritance. Indicator 5 Illustrate the relationship of the structure and function of DNA to protein

More information

Table S1. Related to Figure 4

Table S1. Related to Figure 4 Table S1. Related to Figure 4 Final Diagnosis Age PMD Control Control 61 15 Control 67 6 Control 68 10 Control 49 15 AR-PD PD 62 15 PD 65 4 PD 52 18 PD 68 10 AR-PD cingulate cortex used for immunoblot

More information

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors.

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. Legends of supplemental figures and tables Figure 1: Overview of study design and results. (A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. After raw data gene expression

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:

More information

DNA Sample preparation and Submission Guidelines

DNA Sample preparation and Submission Guidelines DNA Sample preparation and Submission Guidelines Requirements: Please submit samples in 1.5ml microcentrifuge tubes. Fill all the required information in the Eurofins DNA sequencing order form and send

More information

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C)

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C) TECHNICAL DATA SHEET BIOLUMINESCENCE RESONANCE ENERGY TRANSFER RENILLA LUCIFERASE FUSION PROTEIN EXPRESSION VECTOR Product: prluc-c Vectors Catalog number: Description: Amount: The prluc-c vectors contain

More information

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation BDGP Resources Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation For recovery of sequences flanking PZ, PlacW and PEP elements E. Jay Rehm Berkeley Drosophila Genome Project I.

More information

Molecular analyses of EGFR: mutation and amplification detection

Molecular analyses of EGFR: mutation and amplification detection Molecular analyses of EGFR: mutation and amplification detection Petra Nederlof, Moleculaire Pathologie NKI Amsterdam Henrique Ruijter, Ivon Tielen, Lucie Boerrigter, Aafke Ariaens Outline presentation

More information

To measure the expression and regulation of the srfa and myc operons, lacz-reporter gene

To measure the expression and regulation of the srfa and myc operons, lacz-reporter gene SUPPLEMENTAL MATERIAL 1 1 1 1 1 0 1 Construction of reporter gene fusions To measure the expression and regulation of the srfa and myc operons, lacz-reporter gene fusions were made. For this the plasmid

More information

The p53 MUTATION HANDBOOK

The p53 MUTATION HANDBOOK The p MUTATION HANDBOOK Version 1. /7 Thierry Soussi Christophe Béroud, Dalil Hamroun Jean Michel Rubio Nevado http://p/free.fr The p Mutation HandBook By T Soussi, J.M. Rubio-Nevado, D. Hamroun and C.

More information

Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation. Beginning Perl, Chap 4 6. Example 1

Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation. Beginning Perl, Chap 4 6. Example 1 Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation Beginning Perl, Chap 4 6 Example 1 #!/usr/bin/perl -w use strict; # version 1: my @nt = ('A', 'C', 'G', 'T'); for

More information

Mutations and Genetic Variability. 1. What is occurring in the diagram below?

Mutations and Genetic Variability. 1. What is occurring in the diagram below? Mutations and Genetic Variability 1. What is occurring in the diagram below? A. Sister chromatids are separating. B. Alleles are independently assorting. C. Genes are replicating. D. Segments of DNA are

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:.

More information

TA PCR Cloning Kit. Product Name:

TA PCR Cloning Kit. Product Name: Product Name: Kit Component DynaExpress TA PCR Cloning Kit (ptac-2) Cat. # Product Size DS126 DynaExpress TA PCR Cloning Kit (ptac-2) 20 reactions Box 1 (-20 ) ptac-2 Vector, linearized 20 µl (50 ng/µl)

More information

Laboratory diagnostic of Avian Influenza in the Caribbean

Laboratory diagnostic of Avian Influenza in the Caribbean Laboratory diagnostic of Avian Influenza in the Caribbean CIRAD, Guadeloupe CIRAD International Research Centre in Agricultural for Development Research, development, training Veterinary medicine and public

More information

Supplementary Online Material for Morris et al. sirna-induced transcriptional gene

Supplementary Online Material for Morris et al. sirna-induced transcriptional gene Supplementary Online Material for Morris et al. sirna-induced transcriptional gene silencing in human cells. Materials and Methods Lentiviral vector and sirnas. FIV vector pve-gfpwp was prepared as described

More information

Beloit College BIOL Emerging Infectious Diseases

Beloit College BIOL Emerging Infectious Diseases Virus classification and life cycle activity For reference Transcription: Krasner p 131 Translation: Krasner p 132-135 Genetic code: Krasner p 135 A virus is an obligate intracellular parasite, meaning

More information

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University Egypt Interpretation of sequence results An overview on

More information

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES SERVICES CATALOGUE WITH SUBMISSION GUIDELINES 3921 Montgomery Road Cincinnati, Ohio 45212 513-841-2428 www.agctsequencing.com CONTENTS Welcome Dye Terminator Sequencing DNA Sequencing Services - Full Service

More information

The effect of trna levels on decoding times of mrna codons Supplementary File

The effect of trna levels on decoding times of mrna codons Supplementary File The effect of trna levels on decoding times of mrna codons Supplementary File Authors: Alexandra Dana 1 and Tamir Tuller 1 *. 1 The Department of Biomedical Engineering, Tel-Aviv University, Tel-Aviv 69978,

More information

Supplementary Information. Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human

Supplementary Information. Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human Supplementary Information Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human vascular endothelial growth factor 165 revealed by biosensor based assays Yoichi Takakusagi

More information

MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE 6 AND ATPASE 8 GENES IN DIFFERENT MAMMALIAN SPECIES

MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE 6 AND ATPASE 8 GENES IN DIFFERENT MAMMALIAN SPECIES , pp.-068-075. Available online at http://www.bioinfopublication.org/jouarchive.php?opt=&jouid=bpj0000220 MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE

More information

Hands on Simulation of Mutation

Hands on Simulation of Mutation Hands on Simulation of Mutation Charlotte K. Omoto P.O. Box 644236 Washington State University Pullman, WA 99164-4236 omoto@wsu.edu ABSTRACT This exercise is a hands-on simulation of mutations and their

More information

Gene Synthesis 191. Mutagenesis 194. Gene Cloning 196. AccuGeneBlock Service 198. Gene Synthesis FAQs 201. User Protocol 204

Gene Synthesis 191. Mutagenesis 194. Gene Cloning 196. AccuGeneBlock Service 198. Gene Synthesis FAQs 201. User Protocol 204 Gene Synthesis 191 Mutagenesis 194 Gene Cloning 196 AccuGeneBlock Service 198 Gene Synthesis FAQs 201 User Protocol 204 Gene Synthesis Overview Gene synthesis is the most cost-effective way to enhance

More information

Codon usage bias is correlated with gene expression levels in the fission yeast Schizosaccharomyces pombe

Codon usage bias is correlated with gene expression levels in the fission yeast Schizosaccharomyces pombe Codon usage bias is correlated with gene expression levels Blackwell Y Hiraoka usage Publishing et al. bias in fission Inc yeast in the fission yeast Schizosaccharomyces pombe Yasushi Hiraoka 1,2,3, *,

More information

Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project

Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project Protocol for recovery of sequences flanking insertions in the Drosophila Gene Disruption

More information

Gene Finding CMSC 423

Gene Finding CMSC 423 Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher

More information

pcas-guide System Validation in Genome Editing

pcas-guide System Validation in Genome Editing pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible

More information

Supplementary Figure 1: Postive and negative control cell lines wers used as positive and negative controls for HPV16 (A,B) and HPV18 (C,D) PCR.

Supplementary Figure 1: Postive and negative control cell lines wers used as positive and negative controls for HPV16 (A,B) and HPV18 (C,D) PCR. Supplementary Figure 1: Postive and negative control cell lines wers used as positive and negative controls for HPV16 (A,B) and HPV18 (C,D) PCR. (A) (C) (B) (D) Supplementary Figure 2: Representative image

More information

FDC-Specific Functions of p55tnfr and IKK2

FDC-Specific Functions of p55tnfr and IKK2 Supplemental Data FDC-Specific Functions of p55tnfr and IKK2 in the Development of FDC Networks and of Antibody Responses Panayiotis Victoratos, Jacques Lagnel, Sotiria Tzima, Marat B. Alimzhanov, Klaus

More information

Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians

Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians Vol. 44 No. 3 SCIENCE IN CHINA (Series C) June 2001 Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians KE Yuehai ( `º) 1, SU Bing (3 Á) 1 3, XIAO Junhua

More information

Introduction to next-generation sequencing data

Introduction to next-generation sequencing data Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS

More information

Provisional inspection method of genetically modified flax (FP967)

Provisional inspection method of genetically modified flax (FP967) Provisional inspection method of genetically modified flax (FP967) The inspection target of this inspection method is flax grains. Extraction and purification of DNA is performed using an anion exchange

More information

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain?

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain? Networked Systems, COMPGZ01, 2012 Answer TWO questions from Part ONE on the answer booklet containing lined writing paper, and answer ALL questions in Part TWO on the multiple-choice question answer sheet.

More information

Analysis of BRCA1 and BRCA2 mutations in Brazilian breast cancer patients with positive family history

Analysis of BRCA1 and BRCA2 mutations in Brazilian breast cancer patients with positive family history ORIGINAL ARTICLE Rozany Mucha Dufloth Sílvia Carvalho Juliana Karina Heinrich Júlia Yoriko Shinzato César Cabello dos Santos Luiz Carlos Zeferino Fernando Schmitt Analysis of BRCA1 and BRCA2 mutations

More information

for Detection of Multiple Pathogens and William C. Reeves 1

for Detection of Multiple Pathogens and William C. Reeves 1 Bioelectronic DNA Detection of Human Papillomaviruses Using esensor : A Model System for Detection of Multiple Pathogens Suzanne D. Vernon 1 (svernon@cdc.gov), Daniel H. Farkas 2* (dfarkas@bcm.tmc.edu),

More information

NimbleGen SeqCap EZ Library SR User s Guide Version 3.0

NimbleGen SeqCap EZ Library SR User s Guide Version 3.0 NimbleGen SeqCap EZ Library SR User s Guide Version 3.0 For life science research only. Not for use in diagnostic procedures. Copyright 2011 Roche NimbleGen, Inc. All Rights Reserved. Editions Version

More information

ANALYSIS OF A CIRCULAR CODE MODEL

ANALYSIS OF A CIRCULAR CODE MODEL ANALYSIS OF A CIRCULAR CODE MODEL Jérôme Lacan and Chrstan J. Mchel * Laboratore d Informatque de Franche-Comté UNIVERSITE DE FRANCHE-COMTE IUT de Belfort-Montbélard 4 Place Tharradn - BP 747 5 Montbélard

More information

Supplemental Data. Short Article. PPARγ Activation Primes Human Monocytes. into Alternative M2 Macrophages. with Anti-inflammatory Properties

Supplemental Data. Short Article. PPARγ Activation Primes Human Monocytes. into Alternative M2 Macrophages. with Anti-inflammatory Properties Cell Metabolism, Volume 6 Supplemental Data Short Article PPARγ Activation Primes Human Monocytes into Alternative M2 Macrophages with Anti-inflammatory Properties M. Amine Bouhlel, Bruno Derudas, Elena

More information

Genetic Polymorphism in the Second Exon of HLA-DRB1 in Cervical Cancer

Genetic Polymorphism in the Second Exon of HLA-DRB1 in Cervical Cancer Clin Oncol Cancer Res (2010) 7: 27-32 DOI 10.1007/s11805-010-0027-9 27 Genetic Polymorphism in the Second Exon of HLA-DRB1 in Cervical Cancer Yan-yun LI Gui-fang YANG Yan-ju JIA Jun XING Yan-ni LI Wei-ming

More information

ANALYSIS OF GROWTH HORMONE IN TENCH (TINCA TINCA) ANALÝZA RŮSTOVÉHO HORMONU LÍNA OBECNÉHO (TINCA TINCA)

ANALYSIS OF GROWTH HORMONE IN TENCH (TINCA TINCA) ANALÝZA RŮSTOVÉHO HORMONU LÍNA OBECNÉHO (TINCA TINCA) ANALYSIS OF GROWTH HORMONE IN TENCH (TINCA TINCA) ANALÝZA RŮSTOVÉHO HORMONU LÍNA OBECNÉHO (TINCA TINCA) Zrůstová J., Bílek K., Baránek V., Knoll A. Ústav morfologie, fyziologie a genetiky zvířat, Agronomická

More information

Significance of sarcomere gene mutation in patients with dilated cardiomyopathy

Significance of sarcomere gene mutation in patients with dilated cardiomyopathy Significance of sarcomere gene mutation in patients with dilated cardiomyopathy Y.D. Li 1 *, Y.T. Ji 1 *, X.H. Zhou 1, H.L. Li 2, H.T. Zhang 3, Y. Zhang 1, J.X. Li 1, Q. Xing 1, J.H. Zhang 1, Y.F. Hong

More information

Module 6: Digital DNA

Module 6: Digital DNA Module 6: Digital DNA Representation and processing of digital information in the form of DNA is essential to life in all organisms, no matter how large or tiny. Computing tools and computational thinking

More information

Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae

Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae Journal of Cell and Molecular Research (2011) 3 (1), 1-11 Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae Fatemeh Moosavi 1, Hassan Mohabatkar

More information

Chapter 9. Applications of probability. 9.1 The genetic code

Chapter 9. Applications of probability. 9.1 The genetic code Chapter 9 Applications of probability In this chapter we use the tools of elementary probability to investigate problems of several kinds. First, we study the language of life by focusing on the universal

More information

Next Gen Sequencing Summary of the short course Next Gen Sequencing at Avans hogeschool, Breda. 24/04/2013 Next gen Sequencing technologies

Next Gen Sequencing Summary of the short course Next Gen Sequencing at Avans hogeschool, Breda. 24/04/2013 Next gen Sequencing technologies Next Gen Sequencing Summary of the short course Next Gen Sequencing at Avans hogeschool, Breda 24/04/2013 Next gen Sequencing technologies 1 2nd Gen Sequencing Summary of the short course Next Gen Sequencing

More information

Blue Heron, Your Gene Synthesis Partner

Blue Heron, Your Gene Synthesis Partner Blue Heron, Your Gene Synthesis Partner You Design it We Build it Simple to Complex Sequences Codon Optimization Any species Variants Single or pooled clone libraries Antibody Affinity Optimization Whole

More information

I Lq A Simplified Procedure for Developing Multiplex PCRs

I Lq A Simplified Procedure for Developing Multiplex PCRs I Lq A Simplified Procedure for Developing Multiplex PCRs Anthony P. Shuber, 1 Valerie J. Grondin, and Katherine W. Klinger Department of Technology Development, Integrated Genetics, Inc., Framingham Massachusetts

More information

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations http://members.cox.net/amgough/mutation_chromosome_translocation.gif Introduction: In biology, mutations are changes to the base

More information

Cloning, sequencing, and expression of H.a. YNRI and H.a. YNII, encoding nitrate and nitrite reductases in the yeast Hansenula anomala

Cloning, sequencing, and expression of H.a. YNRI and H.a. YNII, encoding nitrate and nitrite reductases in the yeast Hansenula anomala Cloning, sequencing, and expression of H.a. YNRI and H.a. YNII, encoding nitrate and nitrite reductases in the yeast Hansenula anomala -'Pablo García-Lugo 1t, Celedonio González l, Germán Perdomo l, Nélida

More information

Keywords: human papillomavirus, multiplex real-time PCR, genotyping, hybrid capture, cervical cytology

Keywords: human papillomavirus, multiplex real-time PCR, genotyping, hybrid capture, cervical cytology Establishment of an efficient multiplex real-time PCR assay for human papillomavirus genotyping in cervical cytology specimens: comparison with hybrid capture II J.-H. Lee*, N.-W. Lee, S.-W. Hong, Y.-S.

More information

Gene Finding. Slides by Carl Kingsford

Gene Finding. Slides by Carl Kingsford Gene Finding Slides by Carl Kingsford Genome of the Cow a sequence of 2.86 billion letters enough letters to fill a million pages of a typical book. TATGGAGCCAGGTGCCTGGGGCAACAAGACTGTGGTCACTGAATTCATCCTTCTTGGTCTAACAGAGAACATAG

More information

pcmv6-neo Vector Application Guide Contents

pcmv6-neo Vector Application Guide Contents pcmv6-neo Vector Application Guide Contents Package Contents and Storage Conditions... 2 Product Description... 2 Introduction... 2 Production and Quality Assurance... 2 Methods... 3 Other required reagents...

More information

The Adaptation of Temperate Bacteriophages to their Host Genomes

The Adaptation of Temperate Bacteriophages to their Host Genomes Supplementary material for the manuscript by The Adaptation of Temperate Bacteriophages to their Host Genomes Louis-Marie Bobay, Eduardo PC Rocha, Marie Touchon Table of contents: Table S1 - General features

More information

Clayton B. Green, Xiaomin Zhao, Kathleen M. Yeater and Lois L. Hoyer INTRODUCTION

Clayton B. Green, Xiaomin Zhao, Kathleen M. Yeater and Lois L. Hoyer INTRODUCTION Microbiology (2005), 151, 1051 1060 DOI 10.1099/mic.0.27696-0 Construction and real-time RT-PCR validation of Candida albicans PALS-GFP reporter strains and their use in flow cytometry analysis of ALS

More information

Association of IGF1 and IGFBP3 polymorphisms with colorectal polyps and colorectal cancer risk

Association of IGF1 and IGFBP3 polymorphisms with colorectal polyps and colorectal cancer risk DOI 10.1007/s10552-009-9438-4 ORIGINAL PAPER Association of IGF1 and IGFBP3 polymorphisms with colorectal polyps and colorectal cancer risk Elisabeth Feik Æ Andreas Baierl Æ Barbara Hieger Æ Gerhard Führlinger

More information

14/12/2012. HLA typing - problem #1. Applications for NGS. HLA typing - problem #1 HLA typing - problem #2

14/12/2012. HLA typing - problem #1. Applications for NGS. HLA typing - problem #1 HLA typing - problem #2 www.medical-genetics.de Routine HLA typing by Next Generation Sequencing Kaimo Hirv Center for Human Genetics and Laboratory Medicine Dr. Klein & Dr. Rost Lochhamer Str. 9 D-8 Martinsried Tel: 0800-GENETIK

More information

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct

More information

DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108

DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108 DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108 DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108 THE INTERLEUKIN-10 FAMILY CYTOKINES GENE POLYMORPHISMS IN PLAQUE PSORIASIS KÜLLI KINGO TARTU

More information

In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA.

In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA. In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA. For each student: Science notebook Reproducible Master 6, Cooking Up a Protein

More information

TITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR

TITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR Page 1 of 5 Materials DNase digestion buffer [13 mm Tris-Cl, ph7,5 / 5 mm MgCl2 / 0,12 mm CaCl2] RSS plasmid ptr-uf11 SV40pA Forward primer (10µM) AGC AAT AGC ATC ACA AAT TTC ACA A SV40pA Reverse Primer

More information

The making of The Genoma Music

The making of The Genoma Music 242 Summary Key words Resumen Palabras clave The making of The Genoma Music Aurora Sánchez Sousa 1, Fernando Baquero 1 and Cesar Nombela 2 1 Department of Microbiology, Ramón y Cajal Hospital, and 2 Department

More information

Marine Biology DEC 2004; 146(1) : 53-64 http://dx.doi.org/10.1007/s00227-004-1423-6 Copyright 2004 Springer

Marine Biology DEC 2004; 146(1) : 53-64 http://dx.doi.org/10.1007/s00227-004-1423-6 Copyright 2004 Springer Marine Biology DEC 2004; 146(1) : 53-64 http://dx.doi.org/10.1007/s00227-004-1423-6 Copyright 2004 Springer Archimer http://www.ifremer.fr/docelec/ Archive Institutionnelle de l Ifremer The original publication

More information

Analysis of Synonymous Codon Usage Bias in Chlamydia

Analysis of Synonymous Codon Usage Bias in Chlamydia ISSN 1672-9145 Acta Biochimica et Biophysica Sinica 2005, 37(1): 1 10 CN 31-1940/Q Analysis of Synonymous Codon Usage Bias in Chlamydia Hui LÜ, Wei-Ming ZHAO*, Yan ZHENG, Hong WANG, Mei QI, and Xiu-Ping

More information

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects Mutation Mutation provides raw material to evolution Different kinds of mutations have different effects Mutational Processes Point mutation single nucleotide changes coding changes (missense mutations)

More information

Section 1 Workbook (unit 2) ANSWERS

Section 1 Workbook (unit 2) ANSWERS Section 1 Workbook (unit 2) ANSWERS Complete the following table: nucleotide DNA RN Name: B5. Describe DNA replication 1) Label each base given in the diagram below and describe the 4 primary characteristics

More information

Title : Parallel DNA Synthesis : Two PCR product from one DNA template

Title : Parallel DNA Synthesis : Two PCR product from one DNA template Title : Parallel DNA Synthesis : Two PCR product from one DNA template Bhardwaj Vikash 1 and Sharma Kulbhushan 2 1 Email: vikashbhardwaj@ gmail.com 1 Current address: Government College Sector 14 Gurgaon,

More information

Insulin Receptor Gene Mutations in Iranian Patients with Type II Diabetes Mellitus

Insulin Receptor Gene Mutations in Iranian Patients with Type II Diabetes Mellitus Iranian Biomedical Journal 13 (3): 161-168 (July 2009) Insulin Receptor Gene Mutations in Iranian Patients with Type II Diabetes Mellitus Bahram Kazemi 1*, Negar Seyed 1, Elham Moslemi 2, Mojgan Bandehpour

More information

The DNA-"Wave Biocomputer"

The DNA-Wave Biocomputer The DNA-"Wave Biocomputer" Peter P. Gariaev (Pjotr Garjajev)*, Boris I. Birshtein*, Alexander M. Iarochenko*, Peter J. Marcer**, George G. Tertishny*, Katherine A. Leonova*, Uwe Kaempf ***. * Institute

More information

Supporting information

Supporting information This journal is The Royal Society of Chemistry 213 New Platform for Convenient Genotyping System Keum-Soo Song, b Satish Balasaheb Nimse, a Junghoon Kim, b Danishmalik Rafiq Sayyed, a Taisun Kim* a a Institute

More information

Solution Key Problem Set 3

Solution Key Problem Set 3 Solution Key- 7.016 Problem Set 3 Question 1 The following human pedigree shows the inheritance pattern of a specific disease within a family. Assume that the individuals marrying into the family for all

More information

DNA pol RNA pol ARS trna Ribosome DNA mrna Protein Transcription Translation Replication A B Acceptor stem D-loop T C loop Anticodon loop Variable loop Relative trna gene copy number 0.0 0.2 0.4

More information

0302 Screening and identification of sirna to suppress macrophage migration inhibitory factor (MIF) gene expression

0302 Screening and identification of sirna to suppress macrophage migration inhibitory factor (MIF) gene expression 0302 Screening and identification of to suppress macrophage migration inhibitory factor (MIF) gene expression SHAN Zhi-Xin (MIF), LIN Qiu-Xiong,YU Xi-Yong, LIN Shu-Guang, FU Yong-Heng, DENG Chun-Yu Division

More information

APOT - Assay. Protocol for HPV16 and 18. Amplification of Papilloma Virus Oncogene Transcripts HPV. E6 E7 E1 Zelluläre DNA poly(a)

APOT - Assay. Protocol for HPV16 and 18. Amplification of Papilloma Virus Oncogene Transcripts HPV. E6 E7 E1 Zelluläre DNA poly(a) E5 E2 E1 APOT - Assay Amplification of Papilloma Virus Oncogene Transcripts URR E6 E7 L1 HPV L2 E4 E6 E7 E1 Zelluläre DNA poly(a) Protocol for HPV16 and 18 Brief summary of the APOT assay Fig.1A shows

More information

Molecular chaperones involved in preprotein. targeting to plant organelles

Molecular chaperones involved in preprotein. targeting to plant organelles Molecular chaperones involved in preprotein targeting to plant organelles Dissertation der Fakultät für Biologie der Ludwig-Maximilians-Universität München vorgelegt von Christine Fellerer München 29.

More information

Drosophila NK-homeobox genes

Drosophila NK-homeobox genes Proc. Natl. Acad. Sci. USA Vol. 86, pp. 7716-7720, October 1989 Biochemistry Drosophila NK-homeobox genes (NK-1, NK-2,, and DNA clones/chromosome locations of genes) YONGSOK KIM AND MARSHALL NIRENBERG

More information

Transmembrane Signaling in Chimeras of the E. coli Chemotaxis Receptors and Bacterial Class III Adenylyl Cyclases

Transmembrane Signaling in Chimeras of the E. coli Chemotaxis Receptors and Bacterial Class III Adenylyl Cyclases Transmembrane Signaling in Chimeras of the E. coli Chemotaxis Receptors and Bacterial Class III Adenylyl Cyclases Dissertation der Mathematisch-Naturwissenschaftlichen Fakultät der Eberhard Karls Universität

More information

July 7th 2009 DNA sequencing

July 7th 2009 DNA sequencing July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer

More information

Five-minute cloning of Taq polymerase-amplified PCR products

Five-minute cloning of Taq polymerase-amplified PCR products TOPO TA Cloning Version R 8 April 2004 25-0184 TOPO TA Cloning Five-minute cloning of Taq polymerase-amplified PCR products Catalog nos. K4500-01, K4500-40, K4510-20, K4520-01, K4520-40, K4550-01, K4550-40,

More information

Aipotu Part III: Molecular Biology

Aipotu Part III: Molecular Biology Aipotu Part III: Molecular Biology Introduction: The Biological Phenomenon Under Study In this lab, you will continue to explore the biological mechanisms behind the expression of flower color in a hypothetical

More information

Event-specific Method for the Quantification of Maize MIR162 Using Real-time PCR. Protocol

Event-specific Method for the Quantification of Maize MIR162 Using Real-time PCR. Protocol Event-specific Method for the Quantification of Maize MIR162 Using Real-time PCR Protocol 31 January 2011 Joint Research Centre Institute for Health and Consumer Protection Molecular Biology and Genomics

More information

2006 7.012 Problem Set 3 KEY

2006 7.012 Problem Set 3 KEY 2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each

More information

were demonstrated to be, respectively, the catalytic and regulatory subunits of protein phosphatase 2A (PP2A) (29).

were demonstrated to be, respectively, the catalytic and regulatory subunits of protein phosphatase 2A (PP2A) (29). JOURNAL OF VIROLOGY, Feb. 1992, p. 886-893 0022-538X/92/020886-08$02.00/0 Copyright C) 1992, American Society for Microbiology Vol. 66, No. 2 The Third Subunit of Protein Phosphatase 2A (PP2A), a 55- Kilodalton

More information

Early assessment of the efficacy of a human papillomavirus type 16 L1 virus-like particle vaccine

Early assessment of the efficacy of a human papillomavirus type 16 L1 virus-like particle vaccine Vaccine 22 (2004) 2936 2942 Early assessment of the efficacy of a human papillomavirus type 16 L1 virus-like particle vaccine Darron R. Brown a,, Kenneth H. Fife a, Cosette M. Wheeler b, Laura A. Koutsky

More information

[ ] : MMP22,MMP29 TIMP21, TIMP22

[ ] : MMP22,MMP29 TIMP21, TIMP22 212 BULL HUNAN MED UNIV 2003,28 (3) MMP22,MMP29,TIMP21 TIMP22,,, (, 410011) [ ] : MMP22,MMP29 TIMP21, TIMP22 mrna : 56 MMP22 mrna, TIMP22 mrna ; MMP22,MMP29, TIMP21, TIMP22 : MMP22 mrna, TIMP22 mrna,mmp22,mmp29,timp21

More information

der Strukturbiologie

der Strukturbiologie Einführung Aspekte der in Thermodynamik die Bioinformatik in der Strukturbiologie Wintersemester 2012/13 16:00-16:45 Hörsaal N100 B3 Peter Güntert Literatur Jean-Michel Claverie, Cedric Notredame: Bioinformatics

More information

All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI_ NotI

All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI_ NotI 2. Primer Design 2.1 Multiple Cloning Sites All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI NotI XXX XXX GGA TCC CCG AAT

More information

Six Homeoproteins and a Iinc-RNA at the Fast MYH Locus Lock Fast Myofiber Terminal Phenotype

Six Homeoproteins and a Iinc-RNA at the Fast MYH Locus Lock Fast Myofiber Terminal Phenotype Six Homeoproteins and a Iinc-RNA at the Fast MYH Locus Lock Fast Myofiber Terminal Phenotype Iori Sakakibara 1,2,3, Marc Santolini 4, Arnaud Ferry 2,5, Vincent Hakim 4, Pascal Maire 1,2,3 * 1 INSERM U1016,

More information

J. Biomedical Science and Engineering, 2010, 3, JBiSE

J. Biomedical Science and Engineering, 2010, 3, JBiSE J. Biomedical Science and Engineering, 2010, 3, 340-350 doi:10.4236/jbise.2010.34047 Published Online April 2010 (http://www.scirp.org/journal/jbise/). Characterization of the sequence spectrum of DNA

More information

Woods Biol Hmwk DNA & Genetic Engineering (key) Pg. 1

Woods Biol Hmwk DNA & Genetic Engineering (key) Pg. 1 Woods Biol Hmwk-6 10-1 DNA & Genetic Engineering (key) Pg. 1 NOTE: Unless otherwise indicated in the problem, DNA will be from the Template strand. Figure 1: Look carefully at Fig s 1 & 2 to determine

More information

Supporting Information. for. Formation of carbohydrate-functionalised. polystyrene and glass slides and their analysis by

Supporting Information. for. Formation of carbohydrate-functionalised. polystyrene and glass slides and their analysis by Supporting Information for Formation of carbohydrate-functionalised polystyrene and glass slides and their analysis by MALDI-TOF MS Martin J. Weissenborn 1, Johannes W. Wehner 2, Christopher J. Gray 1,

More information

Biopython Tutorial and Cookbook

Biopython Tutorial and Cookbook Biopython Tutorial and Cookbook Jeff Chang, Brad Chapman, Iddo Friedberg, Thomas Hamelryck, Michiel de Hoon, Peter Cock Last Update September 2008 Contents 1 Introduction 5 1.1 What is Biopython?.........................................

More information

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977

More information

GENOMIC IMPRINTING REFERS to a mechanism

GENOMIC IMPRINTING REFERS to a mechanism 0013-7227/03/$15.00/0 Endocrinology 144(12):5658 5670 Printed in U.S.A. Copyright 2003 by The Endocrine Society doi: 10.1210/en.2003-0798 The Histone Code Regulating Expression of the Imprinted Mouse Igf2r

More information

Impaired insulin and insulin-like growth factor expression and signaling mechanisms in Alzheimer s disease is this type 3 diabetes?

Impaired insulin and insulin-like growth factor expression and signaling mechanisms in Alzheimer s disease is this type 3 diabetes? Journal of Alzheimer s Disease 7 (2005) 63 80 63 IOS Press Impaired insulin and insulin-like growth factor expression and signaling mechanisms in Alzheimer s disease is this type 3 diabetes? Eric Steen,

More information