4. DNA replication Pages: Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?

Save this PDF as:

Size: px
Start display at page:

Download "4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?"


1 Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis. B) DNA synthesis in E. coli proceeds by a conservative mechanism. C) DNA synthesis in E. coli proceeds by a semiconservative mechanism. D) DNA synthesis requires datp, dctp, dgtp, and dttp. E) newly synthesized DNA in E. coli has a different base composition than the preexisting DNA. 2. DNA replication Page: 978 Difficulty: 2 Ans: D When a DNA molecule is described as replicating bidirectionally, that means that it has two: A) chains. B) independently replicating segment. C) origins. D) replication forks. E) termination points. 3. DNA replication Page: 979 Difficulty: 2 Ans: D An Okazaki fragment is a: A) fragment of DNA resulting from endonuclease action. B) fragment of RNA that is a subunit of the 30S ribosome. C) piece of DNA that is synthesized in the 3' 5' direction. D) segment of DNA that is an intermediate in the synthesis of the lagging strand. E) segment of mrna synthesized by RNA polymerase. 4. DNA replication Pages: Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true? A) E. coli DNA polymerase I is unusual in that it possesses only a 5' 3' exonucleolytic activity. B) Endonucleases degrade circular but not linear DNA molecules. C) Exonucleases degrade DNA at a free end. D) Many DNA polymerases have a proofreading 5' 3' exonuclease.

2 E) Primases synthesize a short stretch of DNA to prime further synthesis. 5. DNA replication Page: 982 Difficulty: 2 Ans: C E. coli DNA polymerase III: A) can initiate replication without a primer. B) is efficient at nick translation. C) is the principal DNA polymerase in chromosomal DNA replication. D) represents over 90% of the DNA polymerase activity in E. coli cells. E) requires a free 5'-hydroxyl group as a primer. 6. DNA replication Page: 982 Difficulty: 2 Ans: D The 5' 3' exonuclease activity of E. coli DNA polymerase I is involved in: Α) formation of a nick at the DNA replication origin. Β) formation of Okazaki fragments. Χ) proofreading of the replication process. ) removal of RNA primers by nick translation. Ε) sealing of nicks by ligase action. 7. DNA replication Pages: Difficulty: 2 Ans: C Prokaryotic DNA polymerase III: A) contains a 5' 3' proofreading activity to improve the fidelity of replication. B) does not require a primer molecule to initiate replication. C) has a subunit that acts as a circular clamp to improve the processivity of DNA synthesis. D) synthesizes DNA in the 3' 5' direction. E) synthesizes only the leading strand; DNA polymerase I synthesizes the lagging strand.

3 8. DNA replication Page: 988 Difficulty: 2 Ans: E At replication forks in E. coli: A) DNA helicases make endonucleolytic cuts in DNA. B) DNA primers are degraded by exonucleases. C) DNA topoisomerases make endonucleolytic cuts in DNA. D) RNA primers are removed by primase. E) RNA primers are synthesized by primase. 9. DNA recombination Page: 1012 Difficulty: 3 Ans: C The bacteriophage can lysogenize after infecting a bacterium, i.e. integrate into the host bacterial chromosome by site-specific recombination, and may reside there for many generations before an excision event regenerates the viral genome in an infective form. Which one of the following is not a component of these events? A) Excision requires two host proteins and two virally-encoded proteins. B) Integration requires a viral-specific protein, called integrase. C) RecA protein is required to catalyze the insertional recombination event. D) The excision event relies on different sequences than the integration event. E) The virus and the host DNAs share a 15 bp core region of perfect homology. Short Answer Questions 10. DNA replication Pages: Difficulty: 2 Describe briefly how equilibrium density gradient centrifugation was used to demonstrate that DNA replication in E. coli is semiconservative. Ans: Equilibrium density gradient centrifugation separates DNA molecules of slightly different buoyant density. For example, molecules containing 15 N-labeled ( heavy ) DNA are separable from identical molecules containing 14 N ( light ) DNA. Meselson and Stahl grew E. coli for many generations in a medium containing 15 N, producing cells in which all DNA was heavy. These cells were transferred to a medium containing 14 N, and the buoyant density of their DNA was determined (by equilibrium density gradient centrifugation) after 1, 2, 3, etc., generations. After one generation, all DNA was of a density intermediate between fully heavy and fully light, indicating that each double-stranded DNA molecule had one heavy (parental) and one light (newly synthesized) strand; replication was semiconservative. (See Fig. 25-2, p. 977.) 11. DNA replication Page: 979 Difficulty: 2 The DNA below is replicated from left to right. Label the templates for leading strand and lagging strand synthesis.

4 (5')ACTTCGGATCGTTAAGGCCGCTTTCTGT(3') (3')TGAAGCCTAGCAATTCCGGCGAAAGACA(5') Ans: The polarity of the strands indicates that the top strand is the template for lagging strand synthesis, and the bottom strand is the template for leading strand synthesis. (See Fig. 25-4, p. 979.) 12. DNA replication Page: 979 Difficulty: 2 All known DNA polymerases catalyze synthesis only in the 5' 3' direction. Nevertheless, during semiconservative DNA replication in the cell, they are able to catalyze the synthesis of both daughter chains, which would appear to require synthesis in the 3' 5' direction. Explain the process that occurs in the cell that allows for synthesis of both daughter chains by DNA polymerase. Ans: During DNA replication, one strand is synthesized continuously and the other is synthesized by a discontinuous mechanism. The daughter chain, which appears to be growing in the 3' 5' direction (the lagging strand ), is actually being synthesized by continual initiation of new chains and their elongation in the 5' 3' direction. 13. DNA replication Pages: 979, 987 Difficulty: 2 What is an Okazaki fragment? What enzyme(s) is (are) required for its formation in E. coli? Ans: An Okazaki fragment is an intermediate in DNA replication in E. coli. It is a short fragment of newly synthesized DNA, attached to the 3' end of a short RNA primer. Such fragments are produced by the combined action of primase (part of the primosome) and DNA polymerase III during replication of the lagging strand. (See Fig , p. 987.) 14. DNA replication Pages: Difficulty: 2 A suitable substrate for DNA polymerase is shown below. Label the primer and template, and indicate which end of each strand must be 3' or 5'. To observe DNA synthesis on this substrate in vitro, what additional reaction components must be added? Ans: The top strand (the primer) has its 5' end to the left; the bottom (template) strand has the opposite polarity. For DNA synthesis with this substrate in vitro, one would have to add DNA polymerase, the four deoxynucleoside triphosphates, Mg 2+, and a suitable buffer.

5 15. DNA replication Pages: 981, 984 Difficulty: 2 All known DNA polymerases can only elongate a preexisting DNA chain (i.e., require a primer), but cannot initiate a new DNA chain. Nevertheless, during semiconservative DNA replication in the cell, entirely new daughter DNA chains are synthesized. Explain the process that occurs in the cell that allows for the synthesis of daughter chains by DNA polymerase. Ans: In the cell, initiation of DNA chains occurs via the synthesis of an RNA primer by an RNA polymerase type of enzyme (primase). This primer is elongated by DNA polymerase to produce the daughter DNA chain. The RNA is removed by 5' exonucleolytic hydrolysis before replication is completed. 16. DNA replication Pages: Difficulty: 2 DNA replication in E. coli begins at a site in the DNA called the (a). At the replication fork the (b) strand is synthesized continuously while the (c) strand is synthesized discontinuously. On the strand synthesized discontinuously, the short pieces are called (d) fragments. An RNA primer for each of the fragments is synthesized by an enzyme called (e), and this RNA primer is removed after the fragment is synthesized by the enzyme (f), using its (g) activity. The nicks left behind in this process are sealed by the enzyme (h). Ans: (a) origin; (b) leading; (c) lagging; (d) Okazaki; (e) primase; (f) DNA pol I; (g) 5' 3' exonuclease; (h) DNA ligase 17. DNA repair Page: Difficulty: 2 The high fidelity of DNA replication is due primarily to immediate error correction by the 3' > 5' exonuclease (proofreading) activity of the DNA polymerase. Some incorrectly paired bases escape this proofreading, and further errors can arise from challenges to the chemical integrity of the DNA. List the four classes of repair mechanisms that the cell can use to help correct such errors. Ans: The four classes are listed in Table 25-5 (p. 994), and consist of (1) mismatch repair, (2) base-excision repair, (3) nucleotide-excision repair, and (4) direct repair. 18. DNA Recombination Pages: Difficulty: 2 Outline the four key features of the current model for homologous recombination during meiosis in a eukaryotic cell.

6 Ans: (1) Homologous chromosomes are aligned. (2) A double-strand break is enlarged by an exonuclease, leaving a single-strand extension with a free 3' hydroxyl end. (3) The exposed 3' ends invade the homologous intact duplex DNA, followed by branch migration to create a Holliday junction. (4) Cleavage of the two crossover products creates the two recombinant products. (See Fig , p ) 19. DNA recombination Pages: Difficulty: 2 What distinguishes the simple from the complex class of bacterial transposon? Ans: The simple class called insertion sequences contains only the information needed for transposition and the genes for proteins (transposases) that carry out the process. Those in the class of complex transposons carry additional genes, such as those for antibiotic resistance, a property they confer upon any host bacterium that harbors them. 20. DNA recombination Pages: Difficulty: 2 Briefly describe the role of recombination in the generation of antibody (immunoglobin) diversity. Ans: The genes for immunoglobin polypeptide chains are divided into segments, with multiple versions of each segment (which code for slightly different amino acid sequences). Recombination results in the joining of individual versions of each segment to generate a complete gene. Antibody diversity results from the very large number of different combinations that are possible. (See Fig , p )

Lectures 19 and 20. Chapter 12: DNA Replication and Recombination. Problem set 3A: due at beginning of lecture on Monday, Oct.

Lectures 19 and 20. Chapter 12: DNA Replication and Recombination. Problem set 3A: due at beginning of lecture on Monday, Oct. Lectures 19 and 20 Chapter 12: DNA Replication and Recombination DNA Replication is semiconservative Meselson-Stahl experiment: 15 N-labeling and CsCl density gradient centrifugation. Problem set 3A: due

More information

DNA synthesis_pic Basic requirements for DNA synthesis Substrates. The four deoxynucleoside triphosphates (dntps) deoxyadenosine triphosphate (datp),

DNA synthesis_pic Basic requirements for DNA synthesis Substrates. The four deoxynucleoside triphosphates (dntps) deoxyadenosine triphosphate (datp), Basic requirements for DNA synthesis Substrates. The four deoxynucleoside triphosphates (dntps) deoxyadenosine triphosphate (datp), deoxyguanosine triphosphate (dgtp), deoxycytidine triphos-phate (dctp),

More information

Chapter 6: DNA: Hereditary Molecules of Life pg : DNA Replication and Repair pg

Chapter 6: DNA: Hereditary Molecules of Life pg : DNA Replication and Repair pg UNIT 3: Molecular Genetics Chapter 6: DNA: Hereditary Molecules of Life pg. 268-6.4: DNA Replication and Repair pg. 282-290 The DNA molecule is capable of replicating on its own. This is important for

More information

Chapter 6 DNA Replication

Chapter 6 DNA Replication Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore

More information

1. True or False? At the DNA level, recombination is initiated by a single stranded break in a DNA molecule. False

1. True or False? At the DNA level, recombination is initiated by a single stranded break in a DNA molecule. False 1. True or False? At the DNA level, recombination is initiated by a single stranded break in a DNA molecule. False 2. True or False? Dideoxy sequencing is a chain initiation method of DNA sequencing. False

More information

DNA Replication. (CHAPTER 11- Brooker Text) Sept 16 & 18, 2008 BIO 184 Dr. Tom Peavy. Sequence Complexity in the Genome

DNA Replication. (CHAPTER 11- Brooker Text) Sept 16 & 18, 2008 BIO 184 Dr. Tom Peavy. Sequence Complexity in the Genome DNA Replication (CHAPTER 11- Brooker Text) Sept 16 & 18, 2008 BIO 184 Dr. Tom Peavy Sequence Complexity in the Genome 60-70% of human DNA fragments are unique DNA sequences 1 What are the structural features

More information

DNA REPLICATION. Genetica per Scienze Naturali a.a prof S. Presciuttini

DNA REPLICATION. Genetica per Scienze Naturali a.a prof S. Presciuttini DNA REPLICATION This document is licensed under the Attribution-NonCommercial-ShareAlike 2.5 Italy license, available at http://creativecommons.org/licenses/by-nc-sa/2.5/it/ 1. DNA Replication In both

More information

DNA replication. DNA RNA Protein

DNA replication. DNA RNA Protein DNA replication The central dogma of molecular biology transcription translation DNA RNA Protein replication Revers transcriptase The information stored by DNA: - protein structure - the regulation of

More information

CHAPTER 3 Molecular Genetics DNA Replication

CHAPTER 3 Molecular Genetics DNA Replication CHAPTER 3 Molecular Genetics DNA Replication Watson and Crick DNA model implies a mechanism for replication: a. Unwind the DNA molecule. b. Separate the two strands. c. Make a complementary copy for each

More information

Chapter 4.2 (textbook: Molecular Cell Biology 6 ed, Lodish section: ) DNA Replication, Repair, and Recombination

Chapter 4.2 (textbook: Molecular Cell Biology 6 ed, Lodish section: ) DNA Replication, Repair, and Recombination Chapter 4.2 (textbook: Molecular Cell Biology 6 ed, Lodish section: 4.5-4.6) DNA Replication, Repair, and Recombination Cell division - mitosis S-phase is tightly regulated by kinases Mitosis can be divided

More information

2. The work of Messelson & Stahl showed semi-conservative replication. 4. Cairn's experiments showed chromosomes are semi-conservatively replicated.

2. The work of Messelson & Stahl showed semi-conservative replication. 4. Cairn's experiments showed chromosomes are semi-conservatively replicated. BIOLOGY 207 - Dr.McDermid Lecture#2/3 DNA Structure & Replication Readings: Griffiths et al, 7 th Edition: Ch. 8 pp 243-259 (corrected) Problems: Griffiths et al, 7 th Edition: Ch. 8 Tier 1: # 2,3,5,9,13

More information

BCMB Chapters 34 & 35 DNA Replication and Repair

BCMB Chapters 34 & 35 DNA Replication and Repair BCMB 3100 - Chapters 34 & 35 DNA Replication and Repair Semi-conservative DNA replication DNA polymerase DNA replication Replication fork; Okazaki fragments Sanger method for DNA sequencing DNA repair

More information

BCMB Chapters 34 & 35 DNA Replication and Repair

BCMB Chapters 34 & 35 DNA Replication and Repair BCMB 3100 - Chapters 34 & 35 DNA Replication and Repair Semi-conservative DNA replication DNA polymerase DNA replication Replication fork; Okazaki fragments Sanger method for DNA sequencing DNA repair

More information

Part III. Genetic information replication and flow

Part III. Genetic information replication and flow Part III Genetic information replication and flow Chapter 16 DNA Biosynthesis and Recombination The biological function of DNA Store genetic information Replicate genetic information Express genetic information

More information

Introduction. Chapter 11 DNA replication, repair and recombination. Overview. DNA replication is essential for life. Short on DNA structure

Introduction. Chapter 11 DNA replication, repair and recombination. Overview. DNA replication is essential for life. Short on DNA structure Chapter 11 DNA replication, repair and recombination Overview Brief introduction DNA replication DNA repair DNA recombination DNA replication is essential for life Introduction Cells divide and make copies

More information

3/23/2012. DNA Replication. DNA Replication. DNA Replication. Steps in DNA Replication. SBI4U1 Molecular Genetics

3/23/2012. DNA Replication. DNA Replication. DNA Replication. Steps in DNA Replication. SBI4U1 Molecular Genetics SBI4U1 Molecular Genetics Recall: mitosis requires that each daughter cell has an exact copy of parent DNA. Ms. Ponvia The Watson-Crick model suggests how this occurs: Parent DNA molecule unzips, creating

More information

DNA replication (Lecture 28,29)

DNA replication (Lecture 28,29) DNA replication (Lecture 28,29) 1. DNA replication and the cell cycle 2. DNA is Reproduced by Semiconservative Replication 2.1 Conservation of the Original Helix 2.2 The Meselson-Stahl Experiment 2.3 Semiconservative

More information

DNA Replication in Prokaryotes

DNA Replication in Prokaryotes OpenStax-CNX module: m44488 1 DNA Replication in Prokaryotes OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,

More information

DNA. Form and Function

DNA. Form and Function DNA Form and Function DNA: Structure and replication Understanding DNA replication and the resulting transmission of genetic information from cell to cell, and generation to generation lays the groundwork

More information

Chapter 25 Homework Assignment

Chapter 25 Homework Assignment Chapter 25 Homework Assignment The following problems will be due once we finish the chapter: 4, 5, 8, 9, 11 Minimal Coverage of Section 25.3 Chapter 25 1 Chapter 25 DNA Metabolism DNA Polymerase III 1

More information


TTGGHTGUTGG CCAAACACCAA AACCCACAACC HHUUTHUGHUU Conceptual Questions C1. Answer: It is a double-stranded structure that follows the AT/GC rule. C2. Answer: Bidirectional replication refers to DNA replication in both directions starting from one origin.

More information


A TOTAL OF SIX PAGES MCB 110 Spring 2012 Exam 1 ANSWER KEY (answers in italics) A TOTAL OF SIX PAGES Question Maximum Points Your Points I 28 II 41 III 27 IV 28 V 26 150 Please write your name and student ID number (if you

More information

1.5 page 3 DNA Replication S. Preston 1

1.5 page 3 DNA Replication S. Preston 1 AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 3 l. DNA Replication 1. Go through PowerPoint 2. Read notes p2 and then watch the animation

More information

DNA Replication Activity Guide

DNA Replication Activity Guide DNA Replication Activity Guide Teacher Key Deoxyribonucleic Acid (DNA) Exploring DNA 1. List at least three reasons why a cell must undergo division. Answers may vary but may include: growth, repair, reproduction,

More information

DNA Replication. Introduction... 1 The Mechanism of Replication... 2 DNA Replication Rates... 4 References... 5

DNA Replication. Introduction... 1 The Mechanism of Replication... 2 DNA Replication Rates... 4 References... 5 DNA Replication Contents Introduction... 1 The Mechanism of Replication... 2 DNA Replication Rates... 4 References... 5 Introduction In their report announcing the structure of the DNA molecule, Watson

More information

Semiconservative DNA replication. Meselson and Stahl

Semiconservative DNA replication. Meselson and Stahl DNA replication Semiconservative DNA replication Meselson and Stahl Hartl Replication of DNA New nucleotides are added to DNA only during replication in the 5-3 direction How double helix unwind DNA synthesis

More information


I) DNA STRUCTURE AND REPLICATION B) DNA REPLICATION I) DN SRUURE ND REPLIION B) DN REPLIION I) DN Structure and Replication DN Replication for mitosis and meiosis to occur the DN must make an exact copy itself first (S Phase) this is called DN replication

More information


DNA AND IT S ROLE IN HEREDITY DNA AND IT S ROLE IN HEREDITY Lesson overview and objectives - DNA/RNA structural properties What are DNA and RNA made of What are the structural differences between DNA and RNA What is the structure of

More information

Bio 102 Practice Problems Chromosomes and DNA Replication

Bio 102 Practice Problems Chromosomes and DNA Replication Bio 102 Practice Problems Chromosomes and DNA Replication Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which one of the following enzymes is NT a key player in the process

More information

Some comments on biochemistry

Some comments on biochemistry BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 13: DNA replication and repair http://compbio.uchsc.edu/hunter/bio5099 Larry.Hunter@uchsc.edu Some comments on biochemistry The last

More information

2. Why did biologists used to think that proteins are the genetic material?

2. Why did biologists used to think that proteins are the genetic material? Chapter 16: DNA: The Genetic Material 1. What must genetic material do? 2. Why did biologists used to think that proteins are the genetic material? 3. Describe Griffith s experiments with genetic transformation

More information

The Watson-Crick Proposal. DNA Replication. Semiconservative DNA replication

The Watson-Crick Proposal. DNA Replication. Semiconservative DNA replication Cell and Molecular Biology The Watson-Crick Proposal DNA Replication DNA strands are complementary Nucleotides are lined up on templates according to base pair rules Kanokporn Boonsirichai ksatima@live.com

More information

Chapter 16: DNA Structure & Replication

Chapter 16: DNA Structure & Replication hapter 16: DN Structure & Replication 1. DN Structure 2. DN Replication 1. DN Structure hapter Reading pp. 313-318 enetic Material: Protein or DN? Until the early 1950 s no one knew for sure, but it was

More information

Genetics. Chapter 9. Chromosome. Genes Three categories. Flow of Genetics/Information The Central Dogma. DNA RNA Protein

Genetics. Chapter 9. Chromosome. Genes Three categories. Flow of Genetics/Information The Central Dogma. DNA RNA Protein Chapter 9 Topics - Genetics - Flow of Genetics/Information - Regulation - Mutation - Recombination gene transfer Genetics Genome - the sum total of genetic information in a organism Genotype - the A's,

More information

DNA: Structure and Replication

DNA: Structure and Replication 7 DNA: Structure and Replication WORKING WITH THE FIGURES 1. In Table 7-1, why are there no entries for the first four tissue sources? For the last three entries, what is the most likely explanation for

More information

Chromosome Mapping by Recombination

Chromosome Mapping by Recombination Chromosome Mapping by Recombination Genes on the same chromosome are said to be linked. Crossing over: the physical exchange of homologous chromosome segments A given crossover generates two reciprocal

More information

Complementary Base Pairs: A and T. DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T).

Complementary Base Pairs: A and T. DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T). Complementary Base Pairs: A and T DNA contains complementary base pairs in which adenine is always linked by two hydrogen bonds to thymine (A T). Complementary Base Pairs: G and C DNA contains complementary

More information

Chapter 12 - DNA Technology

Chapter 12 - DNA Technology Bio 100 DNA Technology 1 Chapter 12 - DNA Technology Among bacteria, there are 3 mechanisms for transferring genes from one cell to another cell: transformation, transduction, and conjugation 1. Transformation

More information

DNA. Discovery of the DNA double helix

DNA. Discovery of the DNA double helix DNA Replication DNA Discovery of the DNA double helix A. 1950 s B. Rosalind Franklin - X-ray photo of DNA. C. Watson and Crick - described the DNA molecule from Franklin s X-ray. What is DNA? Question:

More information

Ch 16 and Introduction of Ch 17. This PowerPoint is posted. Replication Transcription Translation Protein!

Ch 16 and Introduction of Ch 17. This PowerPoint is posted. Replication Transcription Translation Protein! Ch 16 and Introduction of Ch 17 This PowerPoint is posted. Replication Transcription Translation Protein! In the start of things lin the 1950 s scientists knew that chromosomes carry hereditary material

More information


INTRODUCTION TO DNA Replication INTRODUCTION TO DNA Replication - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - Chapter 13 covers a descriptive explanation of Deoxyribose nucleic Acid

More information

Sample Questions for Exam 3

Sample Questions for Exam 3 Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.

More information

Study Guide Chapter 12

Study Guide Chapter 12 Study Guide Chapter 12 1. Know ALL of your vocabulary words! 2. Name the following scientists with their contributions to Discovering DNA: a. Strains can be transformed (or changed) into other forms while

More information

Nucleic Acids and DNA Replication. I. Biological Background

Nucleic Acids and DNA Replication. I. Biological Background Lecture 14: Nucleic Acids and DNA Replication I. Biological Background A. Types of nucleic acids: 1. Deoxyribonucleic acid (DNA) a. Makes up genes that indirectly direct protein synthesis b. Contain information

More information

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional

More information

Bio Factsheet. How Science Works: Meselson and Stahl s Classic Experiment. Number 207.

Bio Factsheet. How Science Works: Meselson and Stahl s Classic Experiment. Number 207. Number 207 How Science Works: Meselson and Stahl s lassic Experiment n 1953 James Watson and Francis rick built their model of the structure of DNA, which is still accepted today: DNA is an anti-parallel

More information

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes.

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology has had-and will havemany important

More information

Appendix C DNA Replication & Mitosis

Appendix C DNA Replication & Mitosis K.Muma Bio 6 Appendix C DNA Replication & Mitosis Study Objectives: Appendix C: DNA replication and Mitosis 1. Describe the structure of DNA and where it is found. 2. Explain complimentary base pairing:

More information

Every time a cell divides the genome must be duplicated and passed on to the offspring. That is:

Every time a cell divides the genome must be duplicated and passed on to the offspring. That is: DNA Every time a cell divides the genome must be duplicated and passed on to the offspring. That is: Original molecule yields 2 molecules following DNA replication. Our topic in this section is how is

More information

BINF6201/8201. Basics of Molecular Biology

BINF6201/8201. Basics of Molecular Biology BINF6201/8201 Basics of Molecular Biology 08-26-2016 Linear structure of nucleic acids Ø Nucleic acids are polymers of nucleotides Ø Nucleic acids Deoxyribonucleic acids (DNA) Ribonucleic acids (RNA) Phosphate

More information

Viral Infection: Receptors

Viral Infection: Receptors Viral Infection: Receptors Receptors: Identification of receptors has come from expressing the gene for the receptor in a cell to which a virus does not normally bind -OR- By blocking virus attachment

More information


MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS Richard L. Hodinka, Ph.D. University of South Carolina School of Medicine Greenville Greenville Health System, Greenville, SC hodinka@greenvillemed.sc.edu

More information


GENETICS OF BACTERIA AND VIRUSES GENETICS OF BACTERIA AND VIRUSES 1 Genes of bacteria are found in bacterial chromosomes Usually a single type of chromosome May have more than one copy of that chromosome Number of copies depends on the

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

Chapter 10 Manipulating Genes

Chapter 10 Manipulating Genes How DNA Molecules Are Analyzed Chapter 10 Manipulating Genes Until the development of recombinant DNA techniques, crucial clues for understanding how cell works remained lock in the genome. Important advances

More information

Frederick Griffith Dna Is The Genetic Material 11/24/2015. Important Scientists in the Discovery of DNA

Frederick Griffith Dna Is The Genetic Material 11/24/2015. Important Scientists in the Discovery of DNA hapter 16 P. 305-324 16.1 Dna Is he enetic Material.H Morgan s group: showed that genes are located along chromosomes. wo chemical components of chromosomes are DN and protein. Little was known about nucleic

More information

The Central Dogma. Replication as a Process. DNA Replication is Semi-discontinuous!

The Central Dogma. Replication as a Process. DNA Replication is Semi-discontinuous! The Central Dogma DNA structure and DNA replication DNA replication (continued) RNA Synthesis rotein synthesis rof. David McConnell Smurfit Institute of Genetics DNA an emblem of the 20 th century. 1.!

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

C A. How many high-energy phosphate bonds would be consumed during the replication of a 10-nucleotide DNA sequence (synthesis of a single-strand)?

C A. How many high-energy phosphate bonds would be consumed during the replication of a 10-nucleotide DNA sequence (synthesis of a single-strand)? 1. (20 points) Provide a brief answer to the following questions. You may use diagrams or equations, as appropriate, but your answer should be largely a written response of two or three sentences. 4. The

More information

7. 3. replication. Unit 7: Molecular biology and genetics

7. 3. replication. Unit 7: Molecular biology and genetics 7. 3 DN replication he fact that DN is a self-replicating molecule and can make copies of itself is the basis of all life forms. It is the essence of what life is. Indeed, according to Richard Dawkins

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites.

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites. 1. A recombinant DNA molecules is one that is a. produced through the process of crossing over that occurs in meiosis b. constructed from DNA from different sources c. constructed from novel combinations

More information

Proteomics: Principles and Techniques Prof: Sanjeeva Srivastava Department of Biosciences and Bioengineering Indian Institute of Technology, Bombay

Proteomics: Principles and Techniques Prof: Sanjeeva Srivastava Department of Biosciences and Bioengineering Indian Institute of Technology, Bombay (Refer Slide Time: 00:29) Proteomics: Principles and Techniques Prof: Sanjeeva Srivastava Department of Biosciences and Bioengineering Indian Institute of Technology, Bombay Lecture No. # 02 Central Dogma:

More information

PCR Polymerase Chain Reaction

PCR Polymerase Chain Reaction Biological Sciences Initiative HHMI PCR Polymerase Chain Reaction PCR is an extremely powerful technique used to amplify any specific piece of DNA of interest. The DNA of interest is selectively amplified

More information

NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document.

NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document. Chapter 8 Study Guide What is the study of genetics, and what topics does it focus on? What is a genome? NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document. Describe

More information

Lecture 13. Molecular Cloning

Lecture 13. Molecular Cloning Lecture 13 Molecular Cloning Recombinant DNA technology depends on the ability to produce large numbers of identical DNA molecules (clones). Clones are typically generated by placing a DNA fragment of

More information

Part 3. Genetic Information Transfer. The biochemistry and molecular biology department of CMU

Part 3. Genetic Information Transfer. The biochemistry and molecular biology department of CMU Part 3 Genetic Information Transfer The biochemistry and molecular biology department of CMU Cell cycle Replication: synthesis of daughter DNA from parental DNA Transcription: synthesis of RNA using DNA

More information

Structure. Structural Components of Nucleotides Base. Introduction Nucleotide to Cells & Microscopy and Nucleic Acid. Sugar. Phosphate Glycosidic bond

Structure. Structural Components of Nucleotides Base. Introduction Nucleotide to Cells & Microscopy and Nucleic Acid. Sugar. Phosphate Glycosidic bond 11 Introduction Nucleotide to Cells & Microscopy and Nucleic Acid Structure Structural Components of Nucleotides Base Sugar Phosphate Glycosidic bond H NUCLEOTIDE H 1 RNA DNA Table 3-1 Nucleic acid polymer

More information

2.7 DNA replication, transcription and translation

2.7 DNA replication, transcription and translation 2.7 DNA replication, transcription and translation Essential Idea: Genetic information in DNA can be accurately copied and can be translated to make the proteins needed by the cell. The image shows an

More information

BIOTECHNOLOGY. What can we do with DNA?

BIOTECHNOLOGY. What can we do with DNA? BIOTECHNOLOGY What can we do with DNA? Biotechnology Manipulation of biological organisms or their components for research and industrial purpose Usually manipulate DNA itself How to study individual gene?

More information

Microbial Genetics. Chapter 8. Structure and Function of the Genetic Material. Genotype and Phenotype. DNA and Chromosomes.

Microbial Genetics. Chapter 8. Structure and Function of the Genetic Material. Genotype and Phenotype. DNA and Chromosomes. Chapter 8 Microbial Genetics Structure and Function of the Genetic Material Chromosomes are cellular structures made up of genes that carry hereditary information. Genetics is the study of how genes carry

More information

Transcription & Translation. Part of Protein Synthesis

Transcription & Translation. Part of Protein Synthesis Transcription & Translation Part of Protein Synthesis Three processes Initiation Transcription Elongation Termination Initiation The RNA polymerase binds to the DNA molecule upstream of the gene at the

More information

NAME. EXAM IV I. / 60 December 7, 1998 Biochemistry I II. / 15 BI/CH421, BI601, BI/CH621 III. / 13 IV. / 12. V. / 10(grads) TOTAL /100 or 110

NAME. EXAM IV I. / 60 December 7, 1998 Biochemistry I II. / 15 BI/CH421, BI601, BI/CH621 III. / 13 IV. / 12. V. / 10(grads) TOTAL /100 or 110 EXAM IV I. / 60 December 7, 1998 Biochemistry I II. / 15 BI/CH421, BI601, BI/CH621 III. / 13 IV. / 12 V. / 10(grads) TOTAL /100 or 110 I. MULTIPLE CHOICE. (60 points; first 14 are 3 pts the last 9 are

More information

DNA Structure and Replication. Chapter Nine

DNA Structure and Replication. Chapter Nine DNA Structure and Replication Chapter Nine 2005 We know: DNAis the hereditary material DNAhas a double helix structure Made of four bases; A,T,C,G Sugar-Phosphate backbone DNAreplication is semi-conservative

More information

BCOR 011, Exam 3. Multiple Choice: Select the best possible answer. Name KEY Section

BCOR 011, Exam 3. Multiple Choice: Select the best possible answer. Name KEY Section BCOR 011, Exam 3 Name KEY Section Multiple Choice: Select the best possible answer. 1. A parent cell divides to form two genetically identical daughter cells in the nuclear process of mitosis. For mitosis

More information

Lecture 9 DNA Structure & Replication

Lecture 9 DNA Structure & Replication Lecture 9 DNA Structure & Replication What is a Gene? Mendel s work left a key question unanswered: What is a gene? The work of Sutton and Morgan established that genes reside on chromosomes But chromosomes

More information

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication Ch. 12: DNA and RNA 12.1 DNA A. To understand genetics, biologists had to learn the chemical makeup of the gene Genes are made of DNA DNA stores and transmits the genetic information from one generation

More information

The Flow of Genetic Information. MBLG1001 Lecture 9. Replication. Is the process : The Messelson Stahl Experiment. The Messelson Stahl Experiment

The Flow of Genetic Information. MBLG1001 Lecture 9. Replication. Is the process : The Messelson Stahl Experiment. The Messelson Stahl Experiment The Flow of Genetic Information MBLG1001 Lecture 9 Replication Chapter 7 Malacinski Chapter 5 Clark Transcription Translation DNA RNA rotein replication DNA Folding, modification, translocation Functional

More information


BIOLOGICAL BACKGROUND THE CENTRAL DOGMA OF MOLECULAR BIOLOGY BIOLOGICAL BACKGROUND Central Dogma DNA and RNA Structure Replication, Transcription and Translation Techniques of Molecular Genetics Using restriction enzymes Using PCR THE CENTRAL DOGMA OF MOLECULAR

More information

Chapter 29. DNA as the Genetic Material. Recombination of DNA. BCH 4054 Chapter 29 Lecture Notes. Slide 1. Slide 2. Slide 3. Chapter 29, Page 1

Chapter 29. DNA as the Genetic Material. Recombination of DNA. BCH 4054 Chapter 29 Lecture Notes. Slide 1. Slide 2. Slide 3. Chapter 29, Page 1 BCH 4054 Chapter 29 Lecture Notes 1 Chapter 29 DNA: Genetic Information, Recombination, and Mutation 2 DNA as the Genetic Material Griffith Experiment on pneumococcal transformation (Fig 29.1) Avery, MacLeod

More information


VECTOR MAYA SHOVITRI VECTOR MAYA SHOVITRI Brown, T.A. 2010. Gene Cloning and DNA Analysis, an Introduction. 6 th Edition. Wiley-Blackwell A fragment of DNA is inserted into a vector, to produce a recombinant DNA molecule.

More information

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category?

1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? DNA and Genetics 1. Which of the following correctly organizes genetic material from the broadest category to the most specific category? A. genome chromosome gene DNA molecule B. genome chromosome DNA

More information

Transcription Animations

Transcription Animations Transcription Animations Name: Lew Ports Biology Place http://www.lewport.wnyric.org/jwanamaker/animations/protein%20synthesis%20-%20long.html Protein is the making of proteins from the information found

More information

Chem 465 Biochemistry II

Chem 465 Biochemistry II Chem 465 Biochemistry II Name: 2 points Multiple choice (4 points apiece): 1. Which of the following statements about energy conservation in the mitochondrion is false? A) Drug that inhibits the ATP synthase

More information

Biochem 717 Gene Cloning. Prof Amer Jamil Dept of Biochemistry University of Agriculture Faisalabad

Biochem 717 Gene Cloning. Prof Amer Jamil Dept of Biochemistry University of Agriculture Faisalabad Biochem 717 Gene Cloning Prof Amer Jamil Dept of Biochemistry University of Agriculture Faisalabad How to construct a recombinant DNA molecule? DNA isolation Cutting of DNA molecule with the help of restriction

More information

Transcription in prokaryotes. Elongation and termination

Transcription in prokaryotes. Elongation and termination Transcription in prokaryotes Elongation and termination After initiation the σ factor leaves the scene. Core polymerase is conducting the elongation of the chain. The core polymerase contains main nucleotide

More information

Solutions to Problem Set 5

Solutions to Problem Set 5 Question 1 Solutions to 7.014 Problem Set 5 a) Which of the following molecules functions directly to transfer information from the nucleus to the cytoplasm? ircle all that apply. DN mrn trn transporter

More information

Transcription Study Guide

Transcription Study Guide Transcription Study Guide This study guide is a written version of the material you have seen presented in the transcription unit. The cell s DNA contains the instructions for carrying out the work of

More information

30. Genetics and recombination in bacteria Lecture Outline 11/16/05. The Bacterial Genome and Its Replication The bacterial chromosome

30. Genetics and recombination in bacteria Lecture Outline 11/16/05. The Bacterial Genome and Its Replication The bacterial chromosome 30. Genetics and recombination in bacteria Lecture Outline 11/16/05 Replication in bacteria Types of recombination in bacteria Transduction by phage Conjugation ( mating ) F+ plasmids Hfr s Transformation

More information

CHAPTER 5 DNA REPLICATION I: Enzymes and mechanism. Basic Mechanisms of Replication

CHAPTER 5 DNA REPLICATION I: Enzymes and mechanism. Basic Mechanisms of Replication CHER 5 DN RELICION I: Enzymes and mechanism fundamental property of living organisms is their ability to reproduce. Bacteria and fungi can divide to produce daughter cells that are identical to the parental

More information

Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Module 2B Viruses Viruses are not complete living organisms. They are smaller and simpler in structure than even the simplest prokaryotic cells. However, because they have some characteristics of life,

More information

DNA & Protein Synthesis Exam

DNA & Protein Synthesis Exam DNA & Protein Synthesis Exam DO NOT WRITE ON EXAM EXAM # VER. B Multiple choice Directions: Answer the following questions based on the following diagram. (1pt. each) 5. The above nucleotide is purine

More information

DNA TECHNOLOGY- methods for studying and manipulating genetic material.

DNA TECHNOLOGY- methods for studying and manipulating genetic material. 1 DNA TECHNOLOGY- methods for studying and manipulating genetic material. BIOTECHNOLOGY, the manipulation of organisms or their components to make useful products. Biotechnology today usually refers to

More information


OUTCOMES. PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation OVERVIEW ANIMATION CONTEXT RIBONUCLEIC ACID (RNA) OUTCOMES PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation 3.5.1 Compare the structure of RNA and DNA. 3.5.2 Outline DNA transcription in terms of the formation of an RNA strand

More information

Tools and Techniques. Chapter 10. Genetic Engineering. Restriction endonuclease. 1. Enzymes

Tools and Techniques. Chapter 10. Genetic Engineering. Restriction endonuclease. 1. Enzymes Chapter 10. Genetic Engineering Tools and Techniques 1. Enzymes 2. 3. Nucleic acid hybridization 4. Synthesizing DNA 5. Polymerase Chain Reaction 1 2 1. Enzymes Restriction endonuclease Ligase Reverse

More information

Target Practice. Cellular Divisions, Molecular Basis of Inheritance, Gene to Protein, and Regulation of Gene Expression. Critical Vocabulary

Target Practice. Cellular Divisions, Molecular Basis of Inheritance, Gene to Protein, and Regulation of Gene Expression. Critical Vocabulary Target Practice Cellular Divisions, Molecular Basis of Inheritance, Gene to Protein, and Regulation of Gene Expression Critical Vocabulary Chapter 12: Cell cycle, genome, chromosomes, somatic cells, gametes,

More information

Chapter 10: Protein Synthesis. Biology

Chapter 10: Protein Synthesis. Biology Chapter 10: Protein Synthesis Biology Let s Review What are proteins? Chains of amino acids Some are enzymes Some are structural components of cells and tissues More Review What are ribosomes? Cell structures

More information

AP Biology -- John Burroughs School -- M. Bahe

AP Biology -- John Burroughs School -- M. Bahe Objectives for Test Eight: Chapter 13 14, 15.2, 17.1 DNA, Protein Synthesis, Gene Regulation & Biotechnology You should be able to: 1. Identify the scientists who contributed pieces of the genetic puzzle,"

More information

DNA Replication and Repair

DNA Replication and Repair DNA Replication and Repair This lecture explores the mechanisms of DNA replication and also the ways in which DNA can repair any replication errors. It also looks at some of the causes of DNA damage and

More information