Molecular analyses of EGFR: mutation and amplification detection

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Molecular analyses of EGFR: mutation and amplification detection"

Transcription

1 Molecular analyses of EGFR: mutation and amplification detection Petra Nederlof, Moleculaire Pathologie NKI Amsterdam Henrique Ruijter, Ivon Tielen, Lucie Boerrigter, Aafke Ariaens

2 Outline presentation Molecular assays to detect EGFR activating mutations KRAS mutations EGFR gene amplification NKI approach, results, validation Technical issues Other approaches

3 COSMIC database

4 EGFR COSMIC database AA subst. Complex mutations In frame deletions

5 Mutation analysis EGFR Type of mutations Point mutations activating in exons Deletions in exon 19 methods Direct sequencing fragment analysis Melting analysis Real Time PCR Assays In-house tests Commercial kits

6 Current protocol NKI EGFR CISH KRAS sequencing Codon 12 <=60% tumor cells >=60 tumor cells Fragment analysis exon 19 Direct sequencing Exon 18,19,20,21 Enrichment Exon 21 Sequence analysis

7 Sensitivity Limiting factors material Tumor cell percentage may be low Paraffin material: cross-linked and fragmented DNA Biopsies / cytological preps Limited amount of material Limiting factors assays

8 Direct sequencing PCR fragments preferably <250 bp Complete sequence readable in two directions (forward and reverse) Compare with wt sequence same run Check for SNP s Check COSMIC database

9 Primer_ID Naam F/R Label Amplificatie Sequentie 5' - 3' EGFRexon18F F Geen Exon 18 GCT GAG GTG ACC CTT GTC TC EGFRexon18R R Geen Exon 18 CTC CCC ACC AGA CCA TGA EGFRex19F F Geen Exon 19 CAT GTG GCA CCA TCT CAC A EGFRex19R R Geen Exon 19 CAG CTG CCA GAC ATG AGA AA EGFRexon20F F Geen Exon 20 CAT GCG TCT TCA CCT GGA A EGFRexon20R R Geen Exon 20 AGC AGG TAC TGG GAG CCA AT EGFRex21A-F F Geen Exon 21 GAA TTC GGA TGC AGA GCT TC EGFRexon21A-R R Geen Exon 21 TGC CTC CTT CTG CAT GGT AT EGFRex21B-F F Geen Exon 21 GAG GAC CGT CGC TTG GTG EGFRexon21B-R R Geen Exon 21 ATC CTC CCC TGC ATG TGT TA EGFRex19F-FAM F FAM Exon19 6CATGTGGCACCATCTCACA EGFRex19R R Geen Exon 19 GTGTCTTCAGCTGCCAGACATGAGAAA 9700 /mpdiag/egfr 4 min 94 C 1 cyclus 0.5 min 94 C 35 cycli 1.00 min 58 C 1.00 min 72 C 7 min 72 C 1 cyclus soak temp 15 C Size of PCR fragments Exon bp Exon bp Exon bp Exon 21A 220 bp Exon 21B 238 bp Sequence analysis not with M13-tails, but with same primers as initial PCR Results in cleaner sequences

10 Wt EGFR exon 18 sequence paraffin

11 Wt EGFR exon 18 sequence paraffin

12 Exon 19 del18 sequence Female, 64y, PA diagnosis: NSCLC Paraffin embedded biopsy

13 Exon 19 del18 sequence Female, 64y, PA diagnosis: NSCLC Paraffin embedded biopsy

14 Exon 19 del18 sequence Female, 64y, PA diagnosis: NSCLC Paraffin embedded biopsy 18 nucl

15 Exon 19 del15 deletion 15 nucl 15 nucl Tumor cell percentage 70% KRAS: no mutation

16 Cells from pleural fluid Complex mutation: 9bp deletion and point mutation

17 Point mutation exon 21 Exon 21A R Exon 21B F

18 Problems Tumor cell percentage <60% Complex mutations Difficult to determine exact location of aberration (inframe?) Some exons to large for 1 PCR reaction Split exon 21 in two fragments with overlap Point mutations more difficult to detect than deletions Not always Forward and Reverse good sequence

19 Rare but recurrent problems extra peaks may obscure mutation Artifact sequencer?

20 Rare but recurrent problems extra peaks may obscure mutation Artifact sequencer?

21 Zelden zo slecht! Kan komen door slechte DNA kwaliteit, Meestal niet te verklaren (slechts 1 exon 1 richting slecht)

22 What to do in case of low tumor cell % 70% no problems <60% sometimes difficult Sensitivity of direct sequencing enough? Alternatives? Fragment analysis of exon 19 deletions Use restriction sites in wt and mutants Is that an option? Advantages/disadvantages

23 Most common mutations In COSMIC database N=11266 cases 2803 mutated cases 1063 p.l858r exon 21 (38%) 1161 deletions in exon 19 (42%) Together 80% of mutations

24 Fragment analysis FAM WT EGFR Exon 19 wt FAM MUT EGFR Exon 19 wt Primers round common deletions in exon 19 Size of the deletion exact position not known Sensitive: 20% tumor cell percentage detectable del 15 wt del 15 del 18

25 exon 21 c.2573 T>G p.l858r Restriction site in wt, not in mutant TGGCCA wt GGGCCA mut MscI Fragment analysis Enrichment for mutant

26 Enrichment for mutation exon 21 c.2573 T>G p.l858r 1st PCR exon 21 Cut wt sequence with restriction enzyme MscI mutant is not cut 2nd PCR exon 21 Analyze on agarose gel cut/uncut PCR products Confirm by sequence analysis both cut and uncut product TGGCCA wt GGGCCA mut MscI

27 Sensitivity assay Un cut cut 70% 30% Mix tumor DNA mut (estimated 70% tumor cells) with wt DNA 70%, 60%, 50%, 40%, 30%, 10%, 5% Direct sequencing 5%

28 PCR RFLP based analysis EGFR exon 21 L858R Sau 96I Sau 96I Exon 21 CGG PCR FAM Digest with SAu96I 180 bp (wild type) or bp (mutant) WT sample H3255 L858R

29 PCR RFLP based analysis EGFR exon 20 T790M FAM 101 bp (wild type) 92 bp (mutant) WT sample H1975 T790M

30 KRAS mutation analysis Methods Direct sequencing codon 12/13 Sensitivity Tested on tumors with different tumor cell % Mutation determined earlier with sensitive radioactive dot-blot assay Sensitivity higher than with EGFR mutations caused by loss of wt allel in tumor?

31 KRAS sensitivity Wt control 10% tumor cells 15% tumor cells 20% tumor cells 50% tumor cells 60% tumor cells

32 Material NKI Total 182 Biopsy 101 (56%) Cytol. Prep 15 (8%) Resection/excision 66 (36%) Female 121 (67%) 6 mutations EGFR

33 NKI tumors 37 EGFR mutations detected 24 female with mutation (24/113 =21%) 13 male with mutation (13/53 =25%) 24/37 =65% of mutants are female!!

34 KRAS and EGFR analyses cases KRAS & EGFR mut analyses 1 no results 3 mutation detected EGFR (11%) 23 no mutation EGFR Conclusion no mut KRAS 17 no mut KRAS 6 mut KRAS 6/27 KRAS mutation (22%) all without EGFR mut KRAS mut en EGFR mut never together

35 KRAS en EGFR analyses cases KRAS & EGFR mut analyses 8 no results 7 mutation EGFR (14%) no mut KRAS 34 no mutation EGFR 24 no mut KRAS 10 mut KRAS Conclusion 10/49 KRAS mutation (20%) no EGFR mut KRAS mut en EGFR mut never seen together

36 EGFR NKI EGFR mutations no mut exon 18 exon 19 exon 19 exon 21 exon 20 exon % 6% 17% 0% 3% 14% % 0% 5% 0% 0% 7% % 0% 14% 1% 1% 4% 85 totaal KRAS mut KRAS geen MUT N EGFR mut 0% 100% 7 EGFR geen mut 29% 71% 34 6x CISH EGFR 1x amplificatie (7spots) N

37 Other approaches

38 Real Time PCR assay DXS EGFR29 Mutation Test kit detects 1% mutant in a background of wt genomic DNA 19 deletions in exon 19 Price 3360,-/20 samples ( 168/sample)

39 Single Stranded Conformation Polymorphism (SSCP) Wild Type Mutant SSCP for K-ras G12C WT WT G12A

40 DHPLC WAVE system transgenomics Fragment collection followed by direct sequencing

41 summary Advantage of sequencing strategy All mutations can be detected if tumor cell percentage is adequate Advantage of fragment analysis Sensitive but: only known mutations and limited by availability of specific enzymes Advantage other techniques High sensitivity but frequently confirmation by sequencing needed Expensive/special equipment required Kits may be expensive

42 CISH for EGFR amplification our still limited experience! Kit tested: Zytovision Zyto dot SPEC EGFR probe Similar system as HER2 CISH kit

43 Method DAB Staining in automatic stainer used for IHC peroxidase Critical step, needs optimizing

44 Method DAB 5μ paraffin section Probe: Digoxigenylated(Dig)-EGFR peroxidase

45

46 F:\2008\ EGFR CISH 20x ampl contrast.jpg

47

48

49 Pro s and Con s test IHC FISH CISH PRO easy low costs 2 easy read-out colorful Normal microscope routine CON sensitivity varies misses low amplification special microscope Costly, deterioration of material by decay Not yet Costs 50

50 Questions Correlation IHC-CISH? Are EGFR genes with activating mutations in kinase domain also amplified? Do both amplified and mutated EGFR tumors react similar to iressa therapy? Does resistance occur in both groups? Is it relevant to be able to detect subpopulations in tumors (1%) with activating mutations? Are KRAS and EGFR mutations mutually exclusive?

51 QAQC Exchange of material between labs needed to check efficiency of techniques used

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core DNA Sequencing Services Pre-Mixed o Provide template and primer, mixed into the same tube* Pre-Defined o Provide template and primer in separate tubes* Custom o Full-service for samples with unknown concentration

More information

HP22.1 Roth Random Primer Kit A für die RAPD-PCR

HP22.1 Roth Random Primer Kit A für die RAPD-PCR HP22.1 Roth Random Kit A für die RAPD-PCR Kit besteht aus 20 Einzelprimern, jeweils aufgeteilt auf 2 Reaktionsgefäße zu je 1,0 OD Achtung: Angaben beziehen sich jeweils auf ein Reaktionsgefäß! Sequenz

More information

(http://genomes.urv.es/caical) TUTORIAL. (July 2006)

(http://genomes.urv.es/caical) TUTORIAL. (July 2006) (http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA

More information

DNA Sample preparation and Submission Guidelines

DNA Sample preparation and Submission Guidelines DNA Sample preparation and Submission Guidelines Requirements: Please submit samples in 1.5ml microcentrifuge tubes. Fill all the required information in the Eurofins DNA sequencing order form and send

More information

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors.

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. Legends of supplemental figures and tables Figure 1: Overview of study design and results. (A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. After raw data gene expression

More information

pcas-guide System Validation in Genome Editing

pcas-guide System Validation in Genome Editing pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing 38. Informationsgespräch der Blutspendezentralefür Wien, Niederösterreich und Burgenland Österreichisches Rotes Kreuz 22. November 2014, Parkhotel Schönbrunn Die Zukunft hat

More information

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C)

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C) TECHNICAL DATA SHEET BIOLUMINESCENCE RESONANCE ENERGY TRANSFER RENILLA LUCIFERASE FUSION PROTEIN EXPRESSION VECTOR Product: prluc-c Vectors Catalog number: Description: Amount: The prluc-c vectors contain

More information

Grundlagen der Bioinformatik, SS 08, D. Huson, April 21,

Grundlagen der Bioinformatik, SS 08, D. Huson, April 21, Grundlagen der Bioinformatik, SS 08, D. Huson, April 21, 2008 7 2 Introduction to Molecular Biology We will start with a very short repetition of the basics of molecular biology, including a summary of

More information

To measure the expression and regulation of the srfa and myc operons, lacz-reporter gene

To measure the expression and regulation of the srfa and myc operons, lacz-reporter gene SUPPLEMENTAL MATERIAL 1 1 1 1 1 0 1 Construction of reporter gene fusions To measure the expression and regulation of the srfa and myc operons, lacz-reporter gene fusions were made. For this the plasmid

More information

DNA and Protein Synthesis Grade 10

DNA and Protein Synthesis Grade 10 Ohio Standards Connection: Life Sciences Benchmark C Explain the genetic mechanisms and molecular basis of inheritance. Indicator 5 Illustrate the relationship of the structure and function of DNA to protein

More information

TA PCR Cloning Kit. Product Name:

TA PCR Cloning Kit. Product Name: Product Name: Kit Component DynaExpress TA PCR Cloning Kit (ptac-2) Cat. # Product Size DS126 DynaExpress TA PCR Cloning Kit (ptac-2) 20 reactions Box 1 (-20 ) ptac-2 Vector, linearized 20 µl (50 ng/µl)

More information

The p53 MUTATION HANDBOOK

The p53 MUTATION HANDBOOK The p MUTATION HANDBOOK Version 1. /7 Thierry Soussi Christophe Béroud, Dalil Hamroun Jean Michel Rubio Nevado http://p/free.fr The p Mutation HandBook By T Soussi, J.M. Rubio-Nevado, D. Hamroun and C.

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:

More information

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES SERVICES CATALOGUE WITH SUBMISSION GUIDELINES 3921 Montgomery Road Cincinnati, Ohio 45212 513-841-2428 www.agctsequencing.com CONTENTS Welcome Dye Terminator Sequencing DNA Sequencing Services - Full Service

More information

Table S1. Related to Figure 4

Table S1. Related to Figure 4 Table S1. Related to Figure 4 Final Diagnosis Age PMD Control Control 61 15 Control 67 6 Control 68 10 Control 49 15 AR-PD PD 62 15 PD 65 4 PD 52 18 PD 68 10 AR-PD cingulate cortex used for immunoblot

More information

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation BDGP Resources Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation For recovery of sequences flanking PZ, PlacW and PEP elements E. Jay Rehm Berkeley Drosophila Genome Project I.

More information

Mutations and Genetic Variability. 1. What is occurring in the diagram below?

Mutations and Genetic Variability. 1. What is occurring in the diagram below? Mutations and Genetic Variability 1. What is occurring in the diagram below? A. Sister chromatids are separating. B. Alleles are independently assorting. C. Genes are replicating. D. Segments of DNA are

More information

FDC-Specific Functions of p55tnfr and IKK2

FDC-Specific Functions of p55tnfr and IKK2 Supplemental Data FDC-Specific Functions of p55tnfr and IKK2 in the Development of FDC Networks and of Antibody Responses Panayiotis Victoratos, Jacques Lagnel, Sotiria Tzima, Marat B. Alimzhanov, Klaus

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:.

More information

Beloit College BIOL Emerging Infectious Diseases

Beloit College BIOL Emerging Infectious Diseases Virus classification and life cycle activity For reference Transcription: Krasner p 131 Translation: Krasner p 132-135 Genetic code: Krasner p 135 A virus is an obligate intracellular parasite, meaning

More information

Supplementary Online Material for Morris et al. sirna-induced transcriptional gene

Supplementary Online Material for Morris et al. sirna-induced transcriptional gene Supplementary Online Material for Morris et al. sirna-induced transcriptional gene silencing in human cells. Materials and Methods Lentiviral vector and sirnas. FIV vector pve-gfpwp was prepared as described

More information

Gene Synthesis 191. Mutagenesis 194. Gene Cloning 196. AccuGeneBlock Service 198. Gene Synthesis FAQs 201. User Protocol 204

Gene Synthesis 191. Mutagenesis 194. Gene Cloning 196. AccuGeneBlock Service 198. Gene Synthesis FAQs 201. User Protocol 204 Gene Synthesis 191 Mutagenesis 194 Gene Cloning 196 AccuGeneBlock Service 198 Gene Synthesis FAQs 201 User Protocol 204 Gene Synthesis Overview Gene synthesis is the most cost-effective way to enhance

More information

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University Egypt Interpretation of sequence results An overview on

More information

Hands on Simulation of Mutation

Hands on Simulation of Mutation Hands on Simulation of Mutation Charlotte K. Omoto P.O. Box 644236 Washington State University Pullman, WA 99164-4236 omoto@wsu.edu ABSTRACT This exercise is a hands-on simulation of mutations and their

More information

Gebruik van predictieve markers voor targeted therapy in de algemene praktijk

Gebruik van predictieve markers voor targeted therapy in de algemene praktijk Gebruik van predictieve markers voor targeted therapy in de algemene praktijk Gerrit A. Meijer, MD, PhD Professor of Pathology Chair of the Department of Pathology VU Universtiy Medical Center Amsterdam

More information

Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation. Beginning Perl, Chap 4 6. Example 1

Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation. Beginning Perl, Chap 4 6. Example 1 Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation Beginning Perl, Chap 4 6 Example 1 #!/usr/bin/perl -w use strict; # version 1: my @nt = ('A', 'C', 'G', 'T'); for

More information

Title : Parallel DNA Synthesis : Two PCR product from one DNA template

Title : Parallel DNA Synthesis : Two PCR product from one DNA template Title : Parallel DNA Synthesis : Two PCR product from one DNA template Bhardwaj Vikash 1 and Sharma Kulbhushan 2 1 Email: vikashbhardwaj@ gmail.com 1 Current address: Government College Sector 14 Gurgaon,

More information

The effect of trna levels on decoding times of mrna codons Supplementary File

The effect of trna levels on decoding times of mrna codons Supplementary File The effect of trna levels on decoding times of mrna codons Supplementary File Authors: Alexandra Dana 1 and Tamir Tuller 1 *. 1 The Department of Biomedical Engineering, Tel-Aviv University, Tel-Aviv 69978,

More information

MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE 6 AND ATPASE 8 GENES IN DIFFERENT MAMMALIAN SPECIES

MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE 6 AND ATPASE 8 GENES IN DIFFERENT MAMMALIAN SPECIES , pp.-068-075. Available online at http://www.bioinfopublication.org/jouarchive.php?opt=&jouid=bpj0000220 MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE

More information

Laboratory diagnostic of Avian Influenza in the Caribbean

Laboratory diagnostic of Avian Influenza in the Caribbean Laboratory diagnostic of Avian Influenza in the Caribbean CIRAD, Guadeloupe CIRAD International Research Centre in Agricultural for Development Research, development, training Veterinary medicine and public

More information

Supplementary Information. Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human

Supplementary Information. Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human Supplementary Information Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human vascular endothelial growth factor 165 revealed by biosensor based assays Yoichi Takakusagi

More information

TCB No May Technical Bulletin. GS FLX and GS Junior Systems. Short Fragment Removal for the Amplicon Library Preparation Procedure

TCB No May Technical Bulletin. GS FLX and GS Junior Systems. Short Fragment Removal for the Amplicon Library Preparation Procedure TCB No. 2011-007 May 2013 Technical Bulletin GS FLX and GS Junior Systems Short Fragment Removal for the Amplicon Library Preparation Procedure Introduction Some library preparation methods may result

More information

Provisional inspection method of genetically modified flax (FP967)

Provisional inspection method of genetically modified flax (FP967) Provisional inspection method of genetically modified flax (FP967) The inspection target of this inspection method is flax grains. Extraction and purification of DNA is performed using an anion exchange

More information

RT-PCR: Two-Step Protocol

RT-PCR: Two-Step Protocol RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed

More information

Codon usage bias is correlated with gene expression levels in the fission yeast Schizosaccharomyces pombe

Codon usage bias is correlated with gene expression levels in the fission yeast Schizosaccharomyces pombe Codon usage bias is correlated with gene expression levels Blackwell Y Hiraoka usage Publishing et al. bias in fission Inc yeast in the fission yeast Schizosaccharomyces pombe Yasushi Hiraoka 1,2,3, *,

More information

ALLELIC LOSS ON CHROMOSOMES 8 AND 9 CORRELATES WITH CLINICAL OUTCOME IN LOCALLY ADVANCED CLEAR CELL CARCINOMA OF THE KIDNEY

ALLELIC LOSS ON CHROMOSOMES 8 AND 9 CORRELATES WITH CLINICAL OUTCOME IN LOCALLY ADVANCED CLEAR CELL CARCINOMA OF THE KIDNEY 0022-5347/02/1673-1464/0 THE JOURNAL OF UROLOGY Vol. 167, 1464 1468, March 2002 Copyright 2002 by AMERICAN UROLOGICAL ASSOCIATION, INC. Printed in U.S.A. ALLELIC LOSS ON CHROMOSOMES 8 AND 9 CORRELATES

More information

pcmv6-neo Vector Application Guide Contents

pcmv6-neo Vector Application Guide Contents pcmv6-neo Vector Application Guide Contents Package Contents and Storage Conditions... 2 Product Description... 2 Introduction... 2 Production and Quality Assurance... 2 Methods... 3 Other required reagents...

More information

GMO specific real-time PCR system

GMO specific real-time PCR system GMO specific real-time PCR system Protocol for event-specific quantitation of Bt11 in maize Method development: National Veterinary Institute (Norway) and INRA (France) Method Validation: European Commission

More information

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations http://members.cox.net/amgough/mutation_chromosome_translocation.gif Introduction: In biology, mutations are changes to the base

More information

Gene Finding CMSC 423

Gene Finding CMSC 423 Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher

More information

Supplementary Figure 1: Postive and negative control cell lines wers used as positive and negative controls for HPV16 (A,B) and HPV18 (C,D) PCR.

Supplementary Figure 1: Postive and negative control cell lines wers used as positive and negative controls for HPV16 (A,B) and HPV18 (C,D) PCR. Supplementary Figure 1: Postive and negative control cell lines wers used as positive and negative controls for HPV16 (A,B) and HPV18 (C,D) PCR. (A) (C) (B) (D) Supplementary Figure 2: Representative image

More information

NimbleGen SeqCap EZ Library SR User s Guide Version 3.0

NimbleGen SeqCap EZ Library SR User s Guide Version 3.0 NimbleGen SeqCap EZ Library SR User s Guide Version 3.0 For life science research only. Not for use in diagnostic procedures. Copyright 2011 Roche NimbleGen, Inc. All Rights Reserved. Editions Version

More information

Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project

Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project Protocol for recovery of sequences flanking insertions in the Drosophila Gene Disruption

More information

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct

More information

TITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR

TITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR Page 1 of 5 Materials DNase digestion buffer [13 mm Tris-Cl, ph7,5 / 5 mm MgCl2 / 0,12 mm CaCl2] RSS plasmid ptr-uf11 SV40pA Forward primer (10µM) AGC AAT AGC ATC ACA AAT TTC ACA A SV40pA Reverse Primer

More information

for Detection of Multiple Pathogens and William C. Reeves 1

for Detection of Multiple Pathogens and William C. Reeves 1 Bioelectronic DNA Detection of Human Papillomaviruses Using esensor : A Model System for Detection of Multiple Pathogens Suzanne D. Vernon 1 (svernon@cdc.gov), Daniel H. Farkas 2* (dfarkas@bcm.tmc.edu),

More information

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità Identification and characterization of Verocytotoxin-producing Escherichia coli (VTEC) by Real Time PCR amplification of the main virulence genes and the genes associated with the serogroups mainly associated

More information

Chapter 9. Applications of probability. 9.1 The genetic code

Chapter 9. Applications of probability. 9.1 The genetic code Chapter 9 Applications of probability In this chapter we use the tools of elementary probability to investigate problems of several kinds. First, we study the language of life by focusing on the universal

More information

2006 7.012 Problem Set 3 KEY

2006 7.012 Problem Set 3 KEY 2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each

More information

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects Mutation Mutation provides raw material to evolution Different kinds of mutations have different effects Mutational Processes Point mutation single nucleotide changes coding changes (missense mutations)

More information

Supplemental Data. Short Article. PPARγ Activation Primes Human Monocytes. into Alternative M2 Macrophages. with Anti-inflammatory Properties

Supplemental Data. Short Article. PPARγ Activation Primes Human Monocytes. into Alternative M2 Macrophages. with Anti-inflammatory Properties Cell Metabolism, Volume 6 Supplemental Data Short Article PPARγ Activation Primes Human Monocytes into Alternative M2 Macrophages with Anti-inflammatory Properties M. Amine Bouhlel, Bruno Derudas, Elena

More information

Supporting information

Supporting information This journal is The Royal Society of Chemistry 213 New Platform for Convenient Genotyping System Keum-Soo Song, b Satish Balasaheb Nimse, a Junghoon Kim, b Danishmalik Rafiq Sayyed, a Taisun Kim* a a Institute

More information

Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians

Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians Vol. 44 No. 3 SCIENCE IN CHINA (Series C) June 2001 Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians KE Yuehai ( `º) 1, SU Bing (3 Á) 1 3, XIAO Junhua

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information

Module 6: Digital DNA

Module 6: Digital DNA Module 6: Digital DNA Representation and processing of digital information in the form of DNA is essential to life in all organisms, no matter how large or tiny. Computing tools and computational thinking

More information

Section 1 Workbook (unit 2) ANSWERS

Section 1 Workbook (unit 2) ANSWERS Section 1 Workbook (unit 2) ANSWERS Complete the following table: nucleotide DNA RN Name: B5. Describe DNA replication 1) Label each base given in the diagram below and describe the 4 primary characteristics

More information

Association of IGF1 and IGFBP3 polymorphisms with colorectal polyps and colorectal cancer risk

Association of IGF1 and IGFBP3 polymorphisms with colorectal polyps and colorectal cancer risk DOI 10.1007/s10552-009-9438-4 ORIGINAL PAPER Association of IGF1 and IGFBP3 polymorphisms with colorectal polyps and colorectal cancer risk Elisabeth Feik Æ Andreas Baierl Æ Barbara Hieger Æ Gerhard Führlinger

More information

Analysis of BRCA1 and BRCA2 mutations in Brazilian breast cancer patients with positive family history

Analysis of BRCA1 and BRCA2 mutations in Brazilian breast cancer patients with positive family history ORIGINAL ARTICLE Rozany Mucha Dufloth Sílvia Carvalho Juliana Karina Heinrich Júlia Yoriko Shinzato César Cabello dos Santos Luiz Carlos Zeferino Fernando Schmitt Analysis of BRCA1 and BRCA2 mutations

More information

Single Nucleotide Polymorphisms (SNPs)

Single Nucleotide Polymorphisms (SNPs) Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded

More information

Event-specific Method for the Quantification of Maize MIR162 Using Real-time PCR. Protocol

Event-specific Method for the Quantification of Maize MIR162 Using Real-time PCR. Protocol Event-specific Method for the Quantification of Maize MIR162 Using Real-time PCR Protocol 31 January 2011 Joint Research Centre Institute for Health and Consumer Protection Molecular Biology and Genomics

More information

Auth required. Mod. Y or N

Auth required. Mod. Y or N Appendix E -Genetic Testing CPT/ HCPCS Codes Description Auth required Y or N Mod Service Limits Age Limits Notes 83890 Molecular diagnostics: molecular isolation or extraction, each nucleic acid type

More information

Tools for human molecular diagnosis. Joris Vermeesch

Tools for human molecular diagnosis. Joris Vermeesch Tools for human molecular diagnosis Joris Vermeesch Chromosome > DNA Genetic Code Effect of point mutations/polymorphisms Effect of deletions/insertions Effect of splicing mutations IVS2-2A>G Normal splice

More information

Nuevas tecnologías basadas en biomarcadores para oncología

Nuevas tecnologías basadas en biomarcadores para oncología Nuevas tecnologías basadas en biomarcadores para oncología Simposio ASEBIO 14 de marzo 2013, PCB Jose Jimeno, MD, PhD Co-Founder / Vice Chairman Pangaea Biotech SL Barcelona, Spain PANGAEA BIOTECH BUSINESS

More information

Mutations & DNA Technology Worksheet

Mutations & DNA Technology Worksheet Mutations & DNA Technology Worksheet Name Section A: Mutations Mutations are changes in DNA. Somatic mutations occur in non-reproductive cells and won't be passed onto offspring. Mutations that occur in

More information

ANALYSIS OF GROWTH HORMONE IN TENCH (TINCA TINCA) ANALÝZA RŮSTOVÉHO HORMONU LÍNA OBECNÉHO (TINCA TINCA)

ANALYSIS OF GROWTH HORMONE IN TENCH (TINCA TINCA) ANALÝZA RŮSTOVÉHO HORMONU LÍNA OBECNÉHO (TINCA TINCA) ANALYSIS OF GROWTH HORMONE IN TENCH (TINCA TINCA) ANALÝZA RŮSTOVÉHO HORMONU LÍNA OBECNÉHO (TINCA TINCA) Zrůstová J., Bílek K., Baránek V., Knoll A. Ústav morfologie, fyziologie a genetiky zvířat, Agronomická

More information

Aipotu Part III: Molecular Biology

Aipotu Part III: Molecular Biology Aipotu Part III: Molecular Biology Introduction: The Biological Phenomenon Under Study In this lab, you will continue to explore the biological mechanisms behind the expression of flower color in a hypothetical

More information

Blue Heron, Your Gene Synthesis Partner

Blue Heron, Your Gene Synthesis Partner Blue Heron, Your Gene Synthesis Partner You Design it We Build it Simple to Complex Sequences Codon Optimization Any species Variants Single or pooled clone libraries Antibody Affinity Optimization Whole

More information

Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae

Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae Journal of Cell and Molecular Research (2011) 3 (1), 1-11 Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae Fatemeh Moosavi 1, Hassan Mohabatkar

More information

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain?

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain? Networked Systems, COMPGZ01, 2012 Answer TWO questions from Part ONE on the answer booklet containing lined writing paper, and answer ALL questions in Part TWO on the multiple-choice question answer sheet.

More information

I Lq A Simplified Procedure for Developing Multiplex PCRs

I Lq A Simplified Procedure for Developing Multiplex PCRs I Lq A Simplified Procedure for Developing Multiplex PCRs Anthony P. Shuber, 1 Valerie J. Grondin, and Katherine W. Klinger Department of Technology Development, Integrated Genetics, Inc., Framingham Massachusetts

More information

582670 Algorithms for Bioinformatics

582670 Algorithms for Bioinformatics Adapted from slides by Veli Mäkinen / Algorithms for Bioinformatics 011 which are partly from http://bix.ucsd.edu/bioalgorithms/slides.php 58670 Algorithms for Bioinformatics Lecture 5: Graph Algorithms

More information

Supporting Information

Supporting Information Supporting Information Wiley-VCH 2007 69451 Weinheim, Germany Evolving a Thermostable DNA polymerase that Accurately Amplifies Highly-Damaged Templates Christian Gloeckner, Katharina B. M. Sauter, and

More information

ANALYSIS OF A CIRCULAR CODE MODEL

ANALYSIS OF A CIRCULAR CODE MODEL ANALYSIS OF A CIRCULAR CODE MODEL Jérôme Lacan and Chrstan J. Mchel * Laboratore d Informatque de Franche-Comté UNIVERSITE DE FRANCHE-COMTE IUT de Belfort-Montbélard 4 Place Tharradn - BP 747 5 Montbélard

More information

APOT - Assay. Protocol for HPV16 and 18. Amplification of Papilloma Virus Oncogene Transcripts HPV. E6 E7 E1 Zelluläre DNA poly(a)

APOT - Assay. Protocol for HPV16 and 18. Amplification of Papilloma Virus Oncogene Transcripts HPV. E6 E7 E1 Zelluläre DNA poly(a) E5 E2 E1 APOT - Assay Amplification of Papilloma Virus Oncogene Transcripts URR E6 E7 L1 HPV L2 E4 E6 E7 E1 Zelluläre DNA poly(a) Protocol for HPV16 and 18 Brief summary of the APOT assay Fig.1A shows

More information

SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE

SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,

More information

Woods Biol Hmwk DNA & Genetic Engineering (key) Pg. 1

Woods Biol Hmwk DNA & Genetic Engineering (key) Pg. 1 Woods Biol Hmwk-6 10-1 DNA & Genetic Engineering (key) Pg. 1 NOTE: Unless otherwise indicated in the problem, DNA will be from the Template strand. Figure 1: Look carefully at Fig s 1 & 2 to determine

More information

Significance of sarcomere gene mutation in patients with dilated cardiomyopathy

Significance of sarcomere gene mutation in patients with dilated cardiomyopathy Significance of sarcomere gene mutation in patients with dilated cardiomyopathy Y.D. Li 1 *, Y.T. Ji 1 *, X.H. Zhou 1, H.L. Li 2, H.T. Zhang 3, Y. Zhang 1, J.X. Li 1, Q. Xing 1, J.H. Zhang 1, Y.F. Hong

More information

Genetic Polymorphism in the Second Exon of HLA-DRB1 in Cervical Cancer

Genetic Polymorphism in the Second Exon of HLA-DRB1 in Cervical Cancer Clin Oncol Cancer Res (2010) 7: 27-32 DOI 10.1007/s11805-010-0027-9 27 Genetic Polymorphism in the Second Exon of HLA-DRB1 in Cervical Cancer Yan-yun LI Gui-fang YANG Yan-ju JIA Jun XING Yan-ni LI Wei-ming

More information

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of

More information

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns

More information

All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI_ NotI

All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI_ NotI 2. Primer Design 2.1 Multiple Cloning Sites All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI NotI XXX XXX GGA TCC CCG AAT

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

Gene Mapping Techniques

Gene Mapping Techniques Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction

More information

PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI,

PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Supplemental Text/Tables PCR Amplification and Sequencing PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Foster City, CA). Each PCR reaction contained 20 ng genomic

More information

DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108

DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108 DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108 DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108 THE INTERLEUKIN-10 FAMILY CYTOKINES GENE POLYMORPHISMS IN PLAQUE PSORIASIS KÜLLI KINGO TARTU

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information

On Covert Data Communication Channels Employing DNA Recombinant and Mutagenesis-based Steganographic Techniques

On Covert Data Communication Channels Employing DNA Recombinant and Mutagenesis-based Steganographic Techniques On Covert Data Communication Channels Employing DNA Recombinant and Mutagenesis-based Steganographic Techniques MAGDY SAEB 1, EMAN EL-ABD 2, MOHAMED E. EL-ZANATY 1 1. School of Engineering, Computer Department,

More information

PCR & DNA Sequencing. PCR= Polymerase Chain Reaction. PCR applications

PCR & DNA Sequencing. PCR= Polymerase Chain Reaction. PCR applications PCR= Polymerase Chain Reaction PCR & DNA Sequencing Biology 224 Instructor: Tom Peavy March 20, 2006 DNA photocopier integral tool for molecular biologists work horse versatile (many applications) not

More information

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination

More information

High-quality genomic DNA isolation and sensitive mutation analysis

High-quality genomic DNA isolation and sensitive mutation analysis Application Note High-quality genomic DNA isolation and sensitive mutation analysis Izabela Safin, Ivonne Schröder-Stumberger and Peter Porschewski Introduction A major objective of cancer research is

More information

Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541

Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541 PRODUCT INFORMATION Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541 Lot _ Store at -20 C Expiry Date _ www.thermoscientific.com/onebio CERTIFICATE OF ANALYSIS The Phusion Site-Directed Mutagenesis

More information

EGFR mutation testing: what is the best choice?

EGFR mutation testing: what is the best choice? EGFR? EGFR mutation testing: what is the best choice? Dekairelle Anne-France, PhD Center for Applied Molecular Technologies Prof GALA Jean-Luc, MD, PhD In response to ligand binding, EGFR is activated

More information

Gene Finding. Slides by Carl Kingsford

Gene Finding. Slides by Carl Kingsford Gene Finding Slides by Carl Kingsford Genome of the Cow a sequence of 2.86 billion letters enough letters to fill a million pages of a typical book. TATGGAGCCAGGTGCCTGGGGCAACAAGACTGTGGTCACTGAATTCATCCTTCTTGGTCTAACAGAGAACATAG

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

Marine Biology DEC 2004; 146(1) : 53-64 http://dx.doi.org/10.1007/s00227-004-1423-6 Copyright 2004 Springer

Marine Biology DEC 2004; 146(1) : 53-64 http://dx.doi.org/10.1007/s00227-004-1423-6 Copyright 2004 Springer Marine Biology DEC 2004; 146(1) : 53-64 http://dx.doi.org/10.1007/s00227-004-1423-6 Copyright 2004 Springer Archimer http://www.ifremer.fr/docelec/ Archive Institutionnelle de l Ifremer The original publication

More information

GENOTYPING ASSAYS AT ZIRC

GENOTYPING ASSAYS AT ZIRC GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed

More information

June 09, 2009 Random Mutagenesis

June 09, 2009 Random Mutagenesis Why Mutagenesis? Analysis of protein function June 09, 2009 Random Mutagenesis Analysis of protein structure Protein engineering Analysis of structure-function relationship Analysis of the catalytic center

More information

Event-specific Method for the Quantification of Soybean DAS by Real-time PCR. Validated Method

Event-specific Method for the Quantification of Soybean DAS by Real-time PCR. Validated Method EUROPEAN COMMISSION JOINT RESEARCH CENTRE Institute for Health and Consumer Protection Molecular Biology and Genomics Unit Event-specific Method for the Quantification of Soybean DAS-81419-2 by Real-time

More information