Molecular analyses of EGFR: mutation and amplification detection

Size: px
Start display at page:

Download "Molecular analyses of EGFR: mutation and amplification detection"

Transcription

1 Molecular analyses of EGFR: mutation and amplification detection Petra Nederlof, Moleculaire Pathologie NKI Amsterdam Henrique Ruijter, Ivon Tielen, Lucie Boerrigter, Aafke Ariaens

2 Outline presentation Molecular assays to detect EGFR activating mutations KRAS mutations EGFR gene amplification NKI approach, results, validation Technical issues Other approaches

3 COSMIC database

4 EGFR COSMIC database AA subst. Complex mutations In frame deletions

5 Mutation analysis EGFR Type of mutations Point mutations activating in exons Deletions in exon 19 methods Direct sequencing fragment analysis Melting analysis Real Time PCR Assays In-house tests Commercial kits

6 Current protocol NKI EGFR CISH KRAS sequencing Codon 12 <=60% tumor cells >=60 tumor cells Fragment analysis exon 19 Direct sequencing Exon 18,19,20,21 Enrichment Exon 21 Sequence analysis

7 Sensitivity Limiting factors material Tumor cell percentage may be low Paraffin material: cross-linked and fragmented DNA Biopsies / cytological preps Limited amount of material Limiting factors assays

8 Direct sequencing PCR fragments preferably <250 bp Complete sequence readable in two directions (forward and reverse) Compare with wt sequence same run Check for SNP s Check COSMIC database

9 Primer_ID Naam F/R Label Amplificatie Sequentie 5' - 3' EGFRexon18F F Geen Exon 18 GCT GAG GTG ACC CTT GTC TC EGFRexon18R R Geen Exon 18 CTC CCC ACC AGA CCA TGA EGFRex19F F Geen Exon 19 CAT GTG GCA CCA TCT CAC A EGFRex19R R Geen Exon 19 CAG CTG CCA GAC ATG AGA AA EGFRexon20F F Geen Exon 20 CAT GCG TCT TCA CCT GGA A EGFRexon20R R Geen Exon 20 AGC AGG TAC TGG GAG CCA AT EGFRex21A-F F Geen Exon 21 GAA TTC GGA TGC AGA GCT TC EGFRexon21A-R R Geen Exon 21 TGC CTC CTT CTG CAT GGT AT EGFRex21B-F F Geen Exon 21 GAG GAC CGT CGC TTG GTG EGFRexon21B-R R Geen Exon 21 ATC CTC CCC TGC ATG TGT TA EGFRex19F-FAM F FAM Exon19 6CATGTGGCACCATCTCACA EGFRex19R R Geen Exon 19 GTGTCTTCAGCTGCCAGACATGAGAAA 9700 /mpdiag/egfr 4 min 94 C 1 cyclus 0.5 min 94 C 35 cycli 1.00 min 58 C 1.00 min 72 C 7 min 72 C 1 cyclus soak temp 15 C Size of PCR fragments Exon bp Exon bp Exon bp Exon 21A 220 bp Exon 21B 238 bp Sequence analysis not with M13-tails, but with same primers as initial PCR Results in cleaner sequences

10 Wt EGFR exon 18 sequence paraffin

11 Wt EGFR exon 18 sequence paraffin

12 Exon 19 del18 sequence Female, 64y, PA diagnosis: NSCLC Paraffin embedded biopsy

13 Exon 19 del18 sequence Female, 64y, PA diagnosis: NSCLC Paraffin embedded biopsy

14 Exon 19 del18 sequence Female, 64y, PA diagnosis: NSCLC Paraffin embedded biopsy 18 nucl

15 Exon 19 del15 deletion 15 nucl 15 nucl Tumor cell percentage 70% KRAS: no mutation

16 Cells from pleural fluid Complex mutation: 9bp deletion and point mutation

17 Point mutation exon 21 Exon 21A R Exon 21B F

18 Problems Tumor cell percentage <60% Complex mutations Difficult to determine exact location of aberration (inframe?) Some exons to large for 1 PCR reaction Split exon 21 in two fragments with overlap Point mutations more difficult to detect than deletions Not always Forward and Reverse good sequence

19 Rare but recurrent problems extra peaks may obscure mutation Artifact sequencer?

20 Rare but recurrent problems extra peaks may obscure mutation Artifact sequencer?

21 Zelden zo slecht! Kan komen door slechte DNA kwaliteit, Meestal niet te verklaren (slechts 1 exon 1 richting slecht)

22 What to do in case of low tumor cell % 70% no problems <60% sometimes difficult Sensitivity of direct sequencing enough? Alternatives? Fragment analysis of exon 19 deletions Use restriction sites in wt and mutants Is that an option? Advantages/disadvantages

23 Most common mutations In COSMIC database N=11266 cases 2803 mutated cases 1063 p.l858r exon 21 (38%) 1161 deletions in exon 19 (42%) Together 80% of mutations

24 Fragment analysis FAM WT EGFR Exon 19 wt FAM MUT EGFR Exon 19 wt Primers round common deletions in exon 19 Size of the deletion exact position not known Sensitive: 20% tumor cell percentage detectable del 15 wt del 15 del 18

25 exon 21 c.2573 T>G p.l858r Restriction site in wt, not in mutant TGGCCA wt GGGCCA mut MscI Fragment analysis Enrichment for mutant

26 Enrichment for mutation exon 21 c.2573 T>G p.l858r 1st PCR exon 21 Cut wt sequence with restriction enzyme MscI mutant is not cut 2nd PCR exon 21 Analyze on agarose gel cut/uncut PCR products Confirm by sequence analysis both cut and uncut product TGGCCA wt GGGCCA mut MscI

27 Sensitivity assay Un cut cut 70% 30% Mix tumor DNA mut (estimated 70% tumor cells) with wt DNA 70%, 60%, 50%, 40%, 30%, 10%, 5% Direct sequencing 5%

28 PCR RFLP based analysis EGFR exon 21 L858R Sau 96I Sau 96I Exon 21 CGG PCR FAM Digest with SAu96I 180 bp (wild type) or bp (mutant) WT sample H3255 L858R

29 PCR RFLP based analysis EGFR exon 20 T790M FAM 101 bp (wild type) 92 bp (mutant) WT sample H1975 T790M

30 KRAS mutation analysis Methods Direct sequencing codon 12/13 Sensitivity Tested on tumors with different tumor cell % Mutation determined earlier with sensitive radioactive dot-blot assay Sensitivity higher than with EGFR mutations caused by loss of wt allel in tumor?

31 KRAS sensitivity Wt control 10% tumor cells 15% tumor cells 20% tumor cells 50% tumor cells 60% tumor cells

32 Material NKI Total 182 Biopsy 101 (56%) Cytol. Prep 15 (8%) Resection/excision 66 (36%) Female 121 (67%) 6 mutations EGFR

33 NKI tumors 37 EGFR mutations detected 24 female with mutation (24/113 =21%) 13 male with mutation (13/53 =25%) 24/37 =65% of mutants are female!!

34 KRAS and EGFR analyses cases KRAS & EGFR mut analyses 1 no results 3 mutation detected EGFR (11%) 23 no mutation EGFR Conclusion no mut KRAS 17 no mut KRAS 6 mut KRAS 6/27 KRAS mutation (22%) all without EGFR mut KRAS mut en EGFR mut never together

35 KRAS en EGFR analyses cases KRAS & EGFR mut analyses 8 no results 7 mutation EGFR (14%) no mut KRAS 34 no mutation EGFR 24 no mut KRAS 10 mut KRAS Conclusion 10/49 KRAS mutation (20%) no EGFR mut KRAS mut en EGFR mut never seen together

36 EGFR NKI EGFR mutations no mut exon 18 exon 19 exon 19 exon 21 exon 20 exon % 6% 17% 0% 3% 14% % 0% 5% 0% 0% 7% % 0% 14% 1% 1% 4% 85 totaal KRAS mut KRAS geen MUT N EGFR mut 0% 100% 7 EGFR geen mut 29% 71% 34 6x CISH EGFR 1x amplificatie (7spots) N

37 Other approaches

38 Real Time PCR assay DXS EGFR29 Mutation Test kit detects 1% mutant in a background of wt genomic DNA 19 deletions in exon 19 Price 3360,-/20 samples ( 168/sample)

39 Single Stranded Conformation Polymorphism (SSCP) Wild Type Mutant SSCP for K-ras G12C WT WT G12A

40 DHPLC WAVE system transgenomics Fragment collection followed by direct sequencing

41 summary Advantage of sequencing strategy All mutations can be detected if tumor cell percentage is adequate Advantage of fragment analysis Sensitive but: only known mutations and limited by availability of specific enzymes Advantage other techniques High sensitivity but frequently confirmation by sequencing needed Expensive/special equipment required Kits may be expensive

42 CISH for EGFR amplification our still limited experience! Kit tested: Zytovision Zyto dot SPEC EGFR probe Similar system as HER2 CISH kit

43 Method DAB Staining in automatic stainer used for IHC peroxidase Critical step, needs optimizing

44 Method DAB 5μ paraffin section Probe: Digoxigenylated(Dig)-EGFR peroxidase

45

46 F:\2008\ EGFR CISH 20x ampl contrast.jpg

47

48

49 Pro s and Con s test IHC FISH CISH PRO easy low costs 2 easy read-out colorful Normal microscope routine CON sensitivity varies misses low amplification special microscope Costly, deterioration of material by decay Not yet Costs 50

50 Questions Correlation IHC-CISH? Are EGFR genes with activating mutations in kinase domain also amplified? Do both amplified and mutated EGFR tumors react similar to iressa therapy? Does resistance occur in both groups? Is it relevant to be able to detect subpopulations in tumors (1%) with activating mutations? Are KRAS and EGFR mutations mutually exclusive?

51 QAQC Exchange of material between labs needed to check efficiency of techniques used

Supplementary Materials. Molecular genetic analysis reveals that a nonribosomal peptide synthetase-like

Supplementary Materials. Molecular genetic analysis reveals that a nonribosomal peptide synthetase-like Supplementary Materials Molecular genetic analysis reveals that a nonribosomal peptide synthetase-like (NRPS-like) gene in Aspergillus nidulans is responsible for microperfuranone biosynthesis Applied

More information

Supplemental Figure 1. Seedlings of Transgenic and Mutant Plants.

Supplemental Figure 1. Seedlings of Transgenic and Mutant Plants. Supplemental Figure 1. Seedlings of Transgenic and Mutant Plants. Supplemental Figure 2. Role of SPLs in Anthocyanin Accumulation. (A) Inflorescences of spl mutants. Scale bar represents 0.5 cm. (B) Close-ups

More information

Cell, Volume 166. Supplemental Information. Enhancer Control of Transcriptional Bursting. Takashi Fukaya, Bomyi Lim, and Michael Levine

Cell, Volume 166. Supplemental Information. Enhancer Control of Transcriptional Bursting. Takashi Fukaya, Bomyi Lim, and Michael Levine Cell, Volume 166 Supplemental Information Enhancer Control of Transcriptional Bursting Takashi Fukaya, Bomyi Lim, and Michael Levine Supplemental experimental procedures Expression Plasmids pbphi-multi

More information

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core DNA Sequencing Services Pre-Mixed o Provide template and primer, mixed into the same tube* Pre-Defined o Provide template and primer in separate tubes* Custom o Full-service for samples with unknown concentration

More information

HP22.1 Roth Random Primer Kit A für die RAPD-PCR

HP22.1 Roth Random Primer Kit A für die RAPD-PCR HP22.1 Roth Random Kit A für die RAPD-PCR Kit besteht aus 20 Einzelprimern, jeweils aufgeteilt auf 2 Reaktionsgefäße zu je 1,0 OD Achtung: Angaben beziehen sich jeweils auf ein Reaktionsgefäß! Sequenz

More information

Ablation in Mice of the mtorc Components raptor, rictor, or mlst8 Reveals that mtorc2 Is Required

Ablation in Mice of the mtorc Components raptor, rictor, or mlst8 Reveals that mtorc2 Is Required Developmental Cell 11 Supplemental Data Ablation in Mice of the mtorc Components raptor, rictor, or mlst8 Reveals that mtorc2 Is Required for Signaling to Akt-FOXO and PKCα, but Not S6K1 David A. Guertin,

More information

PROTEIN SYNTHESIS MAKES SENSE!

PROTEIN SYNTHESIS MAKES SENSE! PROTEIN SYNTHESIS MAKES SENSE! Anita Gordon Modified by: Marianne Dobrovolny Purpose: To help students understand the role of DNA, mrna, trna, and amino acids in the process of protein synthesis. This

More information

(http://genomes.urv.es/caical) TUTORIAL. (July 2006)

(http://genomes.urv.es/caical) TUTORIAL. (July 2006) (http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA

More information

Urban et al., http ://www.jcb.org /cgi /content /full /jcb /DC1

Urban et al., http ://www.jcb.org /cgi /content /full /jcb /DC1 Supplemental material JCB Urban et al., http ://www.jcb.org /cgi /content /full /jcb.201507099 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. Interaction between RECQ5 and RNA PI. (A) Reciprocal coimmunoprecipitation

More information

Gene Mutations. Chapter 9. Objectives

Gene Mutations. Chapter 9. Objectives Gene Mutations Chapter 9 Objectives Compare phenotypic consequences of point mutations. Distinguish detection of known mutations from scanning for unknown mutations. Discuss methods used to detect point

More information

SUPPLEMENTAL MATERIAL

SUPPLEMENTAL MATERIAL SUPPLEMENTAL MATERIAL SUPPLEMENTAL METHODS Measurement of mrna expression levels by quantitative RT-PCR. Following primer sequences were used for real-time PCR: The primer sequences were as followed: TNF-α

More information

List of Primers PRIMERS.DOCX 1 /

List of Primers PRIMERS.DOCX 1 / List of Primers petm11/24 REV CAGCAGCCAACTCAGC Vladimir Benes Custom Primer GEMHE_Rev1 5' CACTTTATGCTTCCGGCTCG 3' Sequence found 3' of pgemhe linearization cassette GEMHE_Rev2 5' GAGCAGATACGAATGGCTAC 3'

More information

PROTEIN SYNTHESIS MAKES SENSE!

PROTEIN SYNTHESIS MAKES SENSE! PROTEIN SYNTHESIS MAKES SENSE! Anita Gordon Modified by: Marianne Dobrovolny Purpose: To help students understand the role of DNA, mrna, trna, and amino acids in the process of protein synthesis. This

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Zhang L, Conejo-Garcia JR, Katsaros D, et al., Recurrence,

More information

DNA Sample preparation and Submission Guidelines

DNA Sample preparation and Submission Guidelines DNA Sample preparation and Submission Guidelines Requirements: Please submit samples in 1.5ml microcentrifuge tubes. Fill all the required information in the Eurofins DNA sequencing order form and send

More information

Base Quality Score Recalibra2on

Base Quality Score Recalibra2on talks Base Quality Score Recalibra2on Assigning accurate confidence scores to each sequenced base We are here in the Best Practices workflow Base Recalibra,on PURPOSE Real data is messy - > properly es2ma2ng

More information

Exon Primer name Sequence Amplicon size

Exon Primer name Sequence Amplicon size Supplementary Material PCR amplification of the BRCA2 gene The components of the PCR reaction were: 20mM Tris-HCl(pH8.4), 50mM KCl, 1.5mM MgCl 2, 0.1mM in each of datp, dctp, dgtp, TTP, 0.1µM of each primer,

More information

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C)

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C) TECHNICAL DATA SHEET BIOLUMINESCENCE RESONANCE ENERGY TRANSFER GFP 2 FUSION PROTEIN EXPRESSION VECTOR Product: Codon Humanized pgfp 2 -C Vectors Catalog number: Lot number: -001 Description: Amount: The

More information

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors.

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. Legends of supplemental figures and tables Figure 1: Overview of study design and results. (A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. After raw data gene expression

More information

pcas-guide System Validation in Genome Editing

pcas-guide System Validation in Genome Editing pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing 38. Informationsgespräch der Blutspendezentralefür Wien, Niederösterreich und Burgenland Österreichisches Rotes Kreuz 22. November 2014, Parkhotel Schönbrunn Die Zukunft hat

More information

TA PCR Cloning Kit. Product Name:

TA PCR Cloning Kit. Product Name: Product Name: Kit Component DynaExpress TA PCR Cloning Kit (ptac-2) Cat. # Product Size DS126 DynaExpress TA PCR Cloning Kit (ptac-2) 20 reactions Box 1 (-20 ) ptac-2 Vector, linearized 20 µl (50 ng/µl)

More information

Grundlagen der Bioinformatik, SS 08, D. Huson, April 21,

Grundlagen der Bioinformatik, SS 08, D. Huson, April 21, Grundlagen der Bioinformatik, SS 08, D. Huson, April 21, 2008 7 2 Introduction to Molecular Biology We will start with a very short repetition of the basics of molecular biology, including a summary of

More information

To measure the expression and regulation of the srfa and myc operons, lacz-reporter gene

To measure the expression and regulation of the srfa and myc operons, lacz-reporter gene SUPPLEMENTAL MATERIAL 1 1 1 1 1 0 1 Construction of reporter gene fusions To measure the expression and regulation of the srfa and myc operons, lacz-reporter gene fusions were made. For this the plasmid

More information

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C)

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C) TECHNICAL DATA SHEET BIOLUMINESCENCE RESONANCE ENERGY TRANSFER RENILLA LUCIFERASE FUSION PROTEIN EXPRESSION VECTOR Product: prluc-c Vectors Catalog number: Description: Amount: The prluc-c vectors contain

More information

DNA and Protein Synthesis Grade 10

DNA and Protein Synthesis Grade 10 Ohio Standards Connection: Life Sciences Benchmark C Explain the genetic mechanisms and molecular basis of inheritance. Indicator 5 Illustrate the relationship of the structure and function of DNA to protein

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Llères et al., http://www.jcb.org/cgi/content/full/jcb.200907029/dc1 Figure S1. Structural model organization of a nucleosome core particle

More information

Protein Synthesis and Words (lesson/class activity) by Lynn Marie Wartski

Protein Synthesis and Words (lesson/class activity) by Lynn Marie Wartski Protein Synthesis and Words (lesson/class activity) by Lynn Marie Wartski Type of Activity: Hands-on, simulation, review/reinforcement, group/cooperative learning Target Audience: Life Science /Biology

More information

www.lessonplansinc.com Topic: Gene Mutations WS Summary: Students will learn about frame shift mutations and base substitution mutations. Goals & Objectives: Students will be able to demonstrate how mutations

More information

The p53 MUTATION HANDBOOK

The p53 MUTATION HANDBOOK The p MUTATION HANDBOOK Version 1. /7 Thierry Soussi Christophe Béroud, Dalil Hamroun Jean Michel Rubio Nevado http://p/free.fr The p Mutation HandBook By T Soussi, J.M. Rubio-Nevado, D. Hamroun and C.

More information

2 μ. ori P ADH1. Amp r pgadt7-recab. 8.2 kb. Stuffer Fragment T ADH1. puc. ori LEU2. HA epitope tag. Matchmaker 5' AD LD-Insert Screening Amplimer

2 μ. ori P ADH1. Amp r pgadt7-recab. 8.2 kb. Stuffer Fragment T ADH1. puc. ori LEU2. HA epitope tag. Matchmaker 5' AD LD-Insert Screening Amplimer Amp r puc ori 2 μ ori 8.2 kb LEU2 HA epitope tag P ADH1 SV40 NLS GAL4 AD P T7 Stuffer Fragment T ADH1 MCS B (2245 2298) MCS A (1898 2034) PT3718-5 MCS A 1858 T7 Promoter CTA TTC GAT GAT GAA GAT ACC CCA

More information

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES SERVICES CATALOGUE WITH SUBMISSION GUIDELINES 3921 Montgomery Road Cincinnati, Ohio 45212 513-841-2428 www.agctsequencing.com CONTENTS Welcome Dye Terminator Sequencing DNA Sequencing Services - Full Service

More information

APAgene GOLD-RT Genome Walking Kits

APAgene GOLD-RT Genome Walking Kits Bio S&T Inc., 5020 Fairway Street, Suite 220, Montreal (Quebec) H8T 1B8, Canada Tel.: +1 514 633-6006 FAX: +1 514 633-6011 Email: info@biost.com Web: http://www.biost.com/ APAgene GOLD-RT Genome Walking

More information

Online Supplemental Methods

Online Supplemental Methods Online Supplemental Methods Genomic DNA Extraction Approximately 200 mg (wet weight) of stool were suspended in 250 μl of buffer consisting of 4M guanidine thiocyanate (G-9277, Sigma-Aldrich, UK), 0.1M

More information

Olerup SSP HLA-B*57:01

Olerup SSP HLA-B*57:01 HLA-B*57:01 Product Insert Page 1 of 12 Olerup SSP HLA-B*57:01 Product number: 101.572-12 including Taq polymerase Lot number: 08M Expiry date: 2013-October-01 Number of tests: 12 Number of wells per test:

More information

Bioinformatics Methods

Bioinformatics Methods BINF630/BIOL580/BINF401 Bioinformatics Methods Iosif Vaisman Email: ivaisman@gmu.edu Major focus areas Informatics infrastructure DNA and protein sequence analysis and genomics Protein structure and function

More information

Table S1. Related to Figure 4

Table S1. Related to Figure 4 Table S1. Related to Figure 4 Final Diagnosis Age PMD Control Control 61 15 Control 67 6 Control 68 10 Control 49 15 AR-PD PD 62 15 PD 65 4 PD 52 18 PD 68 10 AR-PD cingulate cortex used for immunoblot

More information

Mutations and Genetic Variability. 1. What is occurring in the diagram below?

Mutations and Genetic Variability. 1. What is occurring in the diagram below? Mutations and Genetic Variability 1. What is occurring in the diagram below? A. Sister chromatids are separating. B. Alleles are independently assorting. C. Genes are replicating. D. Segments of DNA are

More information

LORYN NSELLNER, 1* EDWARD EDKINS, 1,2 AND NICHOLAS SMITH 3 ABSTRACT INTRODUCTION

LORYN NSELLNER, 1* EDWARD EDKINS, 1,2 AND NICHOLAS SMITH 3 ABSTRACT INTRODUCTION Pediatric and Developmental Pathology 0, 000 000, 0000 DOI: ª 2006 Society for Pediatric Pathology Screening for RB1 Mutations in Tumor Tissue Using Denaturing High Performance Liquid Chromatography, Multiplex

More information

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation BDGP Resources Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation For recovery of sequences flanking PZ, PlacW and PEP elements E. Jay Rehm Berkeley Drosophila Genome Project I.

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:.

More information

FDC-Specific Functions of p55tnfr and IKK2

FDC-Specific Functions of p55tnfr and IKK2 Supplemental Data FDC-Specific Functions of p55tnfr and IKK2 in the Development of FDC Networks and of Antibody Responses Panayiotis Victoratos, Jacques Lagnel, Sotiria Tzima, Marat B. Alimzhanov, Klaus

More information

COLD-PCR: Very High Sensitivity Mutation Detection

COLD-PCR: Very High Sensitivity Mutation Detection COLD-PCR: Very High Sensitivity Mutation Detection New and Developing Technologies for Genetic Diagnostics Salisbury July 2010 Detection of Somatic Mutations 50% Mutant 10% Mutant 5% Mutant 2% Mutant 1%

More information

Supplemental Table 1. Primer sequences of rat genes probed in RT-PCR assays. Reverse primer. (5 to 3 ) CGA AAG TGT CA TTG T AGG CA CAC ATG T ACA TTT

Supplemental Table 1. Primer sequences of rat genes probed in RT-PCR assays. Reverse primer. (5 to 3 ) CGA AAG TGT CA TTG T AGG CA CAC ATG T ACA TTT Supplemental Table 1. Primer sequences of rat genes probed in RT-PCR assays. Gene Forward primer Reverse primer Ref (5 to 3 ) (5 to 3 ) Ppia CAC CGT GTT CTT CGA CCA GTG CTC AGA GCA (1) CAT CAC CGA AAG

More information

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University Egypt Interpretation of sequence results An overview on

More information

Beloit College BIOL Emerging Infectious Diseases

Beloit College BIOL Emerging Infectious Diseases Virus classification and life cycle activity For reference Transcription: Krasner p 131 Translation: Krasner p 132-135 Genetic code: Krasner p 135 A virus is an obligate intracellular parasite, meaning

More information

Supplementary Online Material for Morris et al. sirna-induced transcriptional gene

Supplementary Online Material for Morris et al. sirna-induced transcriptional gene Supplementary Online Material for Morris et al. sirna-induced transcriptional gene silencing in human cells. Materials and Methods Lentiviral vector and sirnas. FIV vector pve-gfpwp was prepared as described

More information

B) A bromodomain-containing transcription factor binds the modified nucleosomes and then

B) A bromodomain-containing transcription factor binds the modified nucleosomes and then Bio344 Exam 2 Spring 2009 These Multiple choice are choose the single best correct answers. 1. Which statement is false? A) In eukaryotes, histones are poorly conserved. * B) There are at least five different

More information

Reverse SAGE (rsage) Overview. Jian Yu ( Last edited on May 1, 2000

Reverse SAGE (rsage) Overview. Jian Yu (   Last edited on May 1, 2000 Jian Yu ( Email: jianyu@jhmi.edu) Last edited on May 1, 2000 Overview Reverse SAGE (rsage) This protocol was developed in Kinzler/Vogelstein laboratories to isolate cdna fragments corresponding to novel

More information

APPLICATION INFORMATION

APPLICATION INFORMATION A-1892C APPLICATION INFORMATION Genetic Analysis AUTOMATING HETEROZYGOTE DETECTION USING THE HUMAN P53 GENE AS A MODEL SYSTEM Mark Dobbs and Nancy Gee Beckman Coulter, Inc. Identifying heterozygous base

More information

GENETIC CONTROL AND COMPARATIVE GENOMIC ANALYSIS OF FLOWERING TIME IN SETARIA (POACEAE)

GENETIC CONTROL AND COMPARATIVE GENOMIC ANALYSIS OF FLOWERING TIME IN SETARIA (POACEAE) GENETIC CONTROL AND COMPARATIVE GENOMIC ANALYSIS OF FLOWERING TIME IN SETARIA (POACEAE) Margarita Mauro-Herrera *, Xuewen Wang,**, Hugues Barbier, Thomas P. Brutnell,***, Katrien M. Devos, Andrew N. Doust

More information

Hands on Simulation of Mutation

Hands on Simulation of Mutation Hands on Simulation of Mutation Charlotte K. Omoto P.O. Box 644236 Washington State University Pullman, WA 99164-4236 omoto@wsu.edu ABSTRACT This exercise is a hands-on simulation of mutations and their

More information

Python course in Bioinformatics

Python course in Bioinformatics March 31, 2009 Why Python? Scripting language, raplid applications Minimalistic syntax Powerful Flexiablel data structure Widely used in Bioinformatics, and many other domains Where to get Python and

More information

PyCogent Cookbook draft

PyCogent Cookbook draft PyCogent Cookbook draft Patrick Yannul, Kristian Rother, Gavin Huttley, Rob Knight This is a set of working examples for using of the PyCogent bioinformatics Python library (pycogent.sf.net), which I wanted

More information

Application of MLVA-15 genotyping for typing of Brucella abortus isolates from India. Dr. Gita Kumari

Application of MLVA-15 genotyping for typing of Brucella abortus isolates from India. Dr. Gita Kumari Application of MLVA-15 genotyping for typing of Brucella abortus isolates from India Dr. Gita Kumari Introduction Brucellosis is considered as the most wide spread zoonosis in the world and a True zoonosis

More information

Gene Synthesis 191. Mutagenesis 194. Gene Cloning 196. AccuGeneBlock Service 198. Gene Synthesis FAQs 201. User Protocol 204

Gene Synthesis 191. Mutagenesis 194. Gene Cloning 196. AccuGeneBlock Service 198. Gene Synthesis FAQs 201. User Protocol 204 Gene Synthesis 191 Mutagenesis 194 Gene Cloning 196 AccuGeneBlock Service 198 Gene Synthesis FAQs 201 User Protocol 204 Gene Synthesis Overview Gene synthesis is the most cost-effective way to enhance

More information

a reporter gene, -geo (a fusion of β-galactosidase and neomycin phosphotransferase II) 1. These

a reporter gene, -geo (a fusion of β-galactosidase and neomycin phosphotransferase II) 1. These Genotyping BayGenomics Mice 1. Introduction The gene-trap vectors used within BayGenomics contain a splice-acceptor sequence upstream of a reporter gene, -geo (a fusion of β-galactosidase and neomycin

More information

BLAST & Database Search

BLAST & Database Search 6.096 Algorithms for Computational Biology Lecture 2 BLAST & Database Search Manolis Kellis Piotr Indyk In Previous Lecture 1 Gene Finding DNA 2 Sequence alignment 3 Database lookup BLAST and Database

More information

Recombinant Expressed Vector pet32a (+) S Constructed by Ligation Independent Cloning

Recombinant Expressed Vector pet32a (+) S Constructed by Ligation Independent Cloning Molecules 2014, 19, 16179-16189; doi:10.3390/molecules191016179 OPEN ACCESS molecules ISSN 1420-3049 www.mdpi.com/journal/molecules Article Recombinant Expressed Vector pet32a (+) S Constructed by Ligation

More information

Splinkerette Ligation Digest 1-3ug genomic DNA at 100ng/ul with enzyme of choice and heat inactivate.

Splinkerette Ligation Digest 1-3ug genomic DNA at 100ng/ul with enzyme of choice and heat inactivate. Cloning Insertion Sites by Splinkerette PCR - Updated June 2005 protocol based on Devon et al. (1995) Nucleic Acids Research 23:1644-1645 and Mikkers et al. (2002) Nature Genetics 32:153-159 for questions/suggestions

More information

Gebruik van predictieve markers voor targeted therapy in de algemene praktijk

Gebruik van predictieve markers voor targeted therapy in de algemene praktijk Gebruik van predictieve markers voor targeted therapy in de algemene praktijk Gerrit A. Meijer, MD, PhD Professor of Pathology Chair of the Department of Pathology VU Universtiy Medical Center Amsterdam

More information

TaqMan Drug Metabolism Genotyping Assays on OpenArray Plates

TaqMan Drug Metabolism Genotyping Assays on OpenArray Plates TaqMan Drug Metabolism Genotyping Assays on OpenArray Plates June 28, 2014 The world leader in serving science 1 TaqMan Drug Metabolism Genotyping Assays on OpenArray Plates Life Technologies has pretested

More information

Biology Advanced Unit 4: The Natural Environment and Species Survival

Biology Advanced Unit 4: The Natural Environment and Species Survival Write your name here Surname Other names Edexcel GCE Centre Number Candidate Number Biology Advanced Unit 4: The Natural Environment and Species Survival Tuesday 11 June 2013 Morning Time: 1 hour 30 minutes

More information

1 «. XXI (... ),, 2006,.216-250 ( )... petoukhov@hotmail.com, http://www.petoukhov.narod.ru,, ( ),..,,,.,,,.. Genbank : «,?,,.,,,.» [, 1999,. 14]..,..,,,.., -, (, ),.,,,,., 2,.,.,..,.,..,,..,,.,,,.,,,..,,,

More information

inhibitor was determined in a PCR assay based on the amplification of

inhibitor was determined in a PCR assay based on the amplification of Supplementary material S1 Ancient DNA analysis reveals ancient divergence of the cave bear, Ursus spelaeus, and brown bear, Ursus arctos, lineages Odile Loreille, Ludovic Orlando, Marylène Patou-Mathis,

More information

1. PREPARATION OF MATERIALS

1. PREPARATION OF MATERIALS AFLP protocol 1. PREPARATION OF MATERIALS...2 2. RESTRICTION AND LIGATION OF ADAPTERS...3 3. PRE-AMPLIFICATION PCR...4 4. SELECTIVE AMPLIFICATION PCR...5 5. PAGE (POLYACRILAMIDE GEL ELECTROPHORESIS)...6

More information

Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation. Beginning Perl, Chap 4 6. Example 1

Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation. Beginning Perl, Chap 4 6. Example 1 Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation Beginning Perl, Chap 4 6 Example 1 #!/usr/bin/perl -w use strict; # version 1: my @nt = ('A', 'C', 'G', 'T'); for

More information

Department of Chemical and Biomolecular Engineering (BK 21+ program),

Department of Chemical and Biomolecular Engineering (BK 21+ program), Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2016 Supporting Information Metal ion triggers for reversible switching of DNA polymerase Ki Soo Park,

More information

Title : Parallel DNA Synthesis : Two PCR product from one DNA template

Title : Parallel DNA Synthesis : Two PCR product from one DNA template Title : Parallel DNA Synthesis : Two PCR product from one DNA template Bhardwaj Vikash 1 and Sharma Kulbhushan 2 1 Email: vikashbhardwaj@ gmail.com 1 Current address: Government College Sector 14 Gurgaon,

More information

MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE 6 AND ATPASE 8 GENES IN DIFFERENT MAMMALIAN SPECIES

MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE 6 AND ATPASE 8 GENES IN DIFFERENT MAMMALIAN SPECIES , pp.-068-075. Available online at http://www.bioinfopublication.org/jouarchive.php?opt=&jouid=bpj0000220 MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE

More information

Genetics of Haemophilia

Genetics of Haemophilia Genetics of Haemophilia Dr. Adel Abuzenadah Faculty of Applied Medical Sciences Centre of Excellence in Genomic Medicine Research King Abdulaziz University Haemophilia A & Royalty Haemophilia Inheritance

More information

Machine Learning Classifiers and Boosting

Machine Learning Classifiers and Boosting Machine Learning Classifiers and Boosting Reading Ch. 18.6-18.12, 20.1-20.3.2 (Not Ch. 18.5) Outline Different types of learning problems Different types of learning algorithms Supervised learning Decision

More information

a reporter gene, -geo (a fusion of β-galactosidase and neomycin phosphotransferase II) 1. These

a reporter gene, -geo (a fusion of β-galactosidase and neomycin phosphotransferase II) 1. These Genotyping BayGenomics Mice 1. Introduction The gene-trap vectors used within BayGenomics contain a splice-acceptor sequence upstream of a reporter gene, -geo (a fusion of β-galactosidase and neomycin

More information

A Good morning dictionary

A Good morning dictionary Dictionaries A Good morning dictionary English: Good morning Spanish: Buenas días Swedish: God morgon German: Guten morgen Venda: Ndi matscheloni Afrikaans: Goeie môre Italian: Buon Giorno What s a dictionary?

More information

The effect of trna levels on decoding times of mrna codons Supplementary File

The effect of trna levels on decoding times of mrna codons Supplementary File The effect of trna levels on decoding times of mrna codons Supplementary File Authors: Alexandra Dana 1 and Tamir Tuller 1 *. 1 The Department of Biomedical Engineering, Tel-Aviv University, Tel-Aviv 69978,

More information

High polymorphism at microsatellite loci in the Chinese donkey

High polymorphism at microsatellite loci in the Chinese donkey High polymorphism at microsatellite loci in the Chinese donkey R.F. Zhang 1, W.M. Xie 2, T. Zhang 3 and C.Z. Lei 4 1 National Experiment Teaching Center of Biology, College of Life Science, Hubei Normal

More information

Laboratory diagnostic of Avian Influenza in the Caribbean

Laboratory diagnostic of Avian Influenza in the Caribbean Laboratory diagnostic of Avian Influenza in the Caribbean CIRAD, Guadeloupe CIRAD International Research Centre in Agricultural for Development Research, development, training Veterinary medicine and public

More information

HaloTag mediated artificial cellulosome assembly. on rolling circle amplification DNA template for

HaloTag mediated artificial cellulosome assembly. on rolling circle amplification DNA template for Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2016 HaloTag mediated artificial cellulosome assembly on rolling circle amplification DNA template for

More information

Supplementary Information. Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human

Supplementary Information. Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human Supplementary Information Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human vascular endothelial growth factor 165 revealed by biosensor based assays Yoichi Takakusagi

More information

Amino Acids. Radical. Lattimer, AST 248, Lecture 11 p.1/11

Amino Acids. Radical. Lattimer, AST 248, Lecture 11 p.1/11 Amino Acids + Radical Amino Acid Abbreviation # atoms Radical glycine gly (G) 10 H alanine ala (A) 13 CH 3 cysteine cys (C) 14 CH 3 S serine ser (S) 14 COH 3 aspartic acid asp (D) 15 C 2 H 2 O 2 asparagine

More information

Provisional inspection method of genetically modified flax (FP967)

Provisional inspection method of genetically modified flax (FP967) Provisional inspection method of genetically modified flax (FP967) The inspection target of this inspection method is flax grains. Extraction and purification of DNA is performed using an anion exchange

More information

The Leucine Binding Proteins of Escherichia coli as Models for Studying the Relationships Between Protein Structure and Function

The Leucine Binding Proteins of Escherichia coli as Models for Studying the Relationships Between Protein Structure and Function Journal of Cellular Biochemistry 29:209-216 (1985) Protein Structure, Folding, and Design 39-46 The Leucine Binding Proteins of Escherichia coli as Models for Studying the Relationships Between Protein

More information

LIGHTS ON/OFF: CLINICAL EVALUATION IN SOUTH AFRICA

LIGHTS ON/OFF: CLINICAL EVALUATION IN SOUTH AFRICA LIGHTS ON/OFF: CLINICAL EVALUATION IN SOUTH AFRICA ROB WARREN LARRY WANGH, BARRY KREISWIRT, JOHN RICE, MARGARETHA DE VOS, MICHAL WHITFIELD, SALVATOR MARRAS OUTLINE Background LATE-PCR description LATE-PCR

More information

Sequence comparison, Part I: Substitution and Scores

Sequence comparison, Part I: Substitution and Scores Sequence comparison, Part I: Substitution and Scores David H. Ardell Docent of Bioinformatics Outline of the lecture Convergence and Divergence Similarity and Homology Percent Difference as Evolutionary

More information

TCB No May Technical Bulletin. GS FLX and GS Junior Systems. Short Fragment Removal for the Amplicon Library Preparation Procedure

TCB No May Technical Bulletin. GS FLX and GS Junior Systems. Short Fragment Removal for the Amplicon Library Preparation Procedure TCB No. 2011-007 May 2013 Technical Bulletin GS FLX and GS Junior Systems Short Fragment Removal for the Amplicon Library Preparation Procedure Introduction Some library preparation methods may result

More information

POSITIVE Darwinian selection at the DNA sequence ally high volatility simply because it has a high proporlevel

POSITIVE Darwinian selection at the DNA sequence ally high volatility simply because it has a high proporlevel Copyright 2005 by the Genetics Society of America DOI: 10.1534/genetics.104.034884 Note On the Evolution of Codon Volatility Jianzhi Zhang 1 Department of Ecology and Evolutionary Biology, University of

More information

Trinucleotides. Giuseppe Pirillo. Dipartimento di matematica Ulisse Dini. Giuseppe Pirillo (IASI CNR) trinucleotides / 40

Trinucleotides. Giuseppe Pirillo. Dipartimento di matematica Ulisse Dini. Giuseppe Pirillo (IASI CNR) trinucleotides / 40 Trinucleotides Giuseppe Pirillo Dipartimento di matematica Ulisse Dini 26 03 2013 Giuseppe Pirillo (IASI CNR) trinucleotides 26 03 2013 1 / 40 UUU Phe UUC Phe UUA Leu UUG Leu CUU Leu CUC Leu CUA Leu CUG

More information

A comparative study of ARMS PCR and RFLP PCR as methods for rapid SNP identification

A comparative study of ARMS PCR and RFLP PCR as methods for rapid SNP identification Romanian Biotechnological Letters Vol. 14, No. 6, 2009, pp. 4845-4850 Copyright 2009 Bucharest University Printed in Romania. All rights reserved Romanian Society of Biological Sciences ORIGINAL PAPER

More information

Ensemble and Single Molecule FRET analysis of the Structure and Dynamics of the c-kit Promoter Quadruplexes.

Ensemble and Single Molecule FRET analysis of the Structure and Dynamics of the c-kit Promoter Quadruplexes. This journal is The Royal Society of Chemistry 29 Ensemble and Single Molecule FRET analysis of the Structure and Dynamics of the c-kit Promoter Quadruplexes. Adrian Fegan, Pravin S. Shirude, Liming Ying,

More information

RT-PCR: Two-Step Protocol

RT-PCR: Two-Step Protocol RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed

More information

Determining the Traits of a Mystery Organism Through Protein Synthesis

Determining the Traits of a Mystery Organism Through Protein Synthesis Determining the Traits of a Mystery Organism Through Protein Synthesis Introduction: Genes determine what characteristics an organism will have. Genes are segments of DNA molecules that are the instructions

More information

A Good morning dictionary

A Good morning dictionary Dictionaries A Good morning dictionary English: Good morning Spanish: Buenas días Swedish: God morgon German: Guten morgen Venda: Ndi matscheloni Afrikaans: Goeie môre What s a dictionary? A dictionary

More information

In-Fusion HD Cloning Kit. User Manual. User Manual. PT (PR133833) April 2011

In-Fusion HD Cloning Kit. User Manual. User Manual. PT (PR133833) April 2011 User Manual In-Fusion HD Cloning Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 PT5162-1 (PR133833) April 2011 Clontech

More information

In-Fusion HD EcoDry Cloning Kit User Manual

In-Fusion HD EcoDry Cloning Kit User Manual User Manual In-Fusion HD EcoDry Cloning Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 PT5165-1 (PR133834) April 2011

More information

Concept for seed analysis for genetically modified plant content

Concept for seed analysis for genetically modified plant content Concept for seed analysis for genetically modified plant content Sub-Committee for Method Development of the German National and Federal Länder Joint Committee on Genetic Engineering (LAG) (as of: March

More information

Detection by PCR and Comparison of Sequences of VP28 Gene of White Spot Syndrome Virus Affecting Penaeus monodon in India

Detection by PCR and Comparison of Sequences of VP28 Gene of White Spot Syndrome Virus Affecting Penaeus monodon in India Detection by PCR and Comparison of Sequences of VP28 Gene of White Spot Syndrome Virus Affecting Penaeus monodon in India A. UMA, Y. KRISHNAMOHAN REDDY, N. RAMANATHAN, K. SARAVANABAVA and A. KOTEESWARAN

More information

What is DNA Fingerprinting?

What is DNA Fingerprinting? What is DNA Fingerprinting? A collection of techniques used to determine the genetic identity of an organism based on its unique DNA patterns Can use trace amounts of hair, skin, body fluids Based on the

More information

Codon usage bias is correlated with gene expression levels in the fission yeast Schizosaccharomyces pombe

Codon usage bias is correlated with gene expression levels in the fission yeast Schizosaccharomyces pombe Codon usage bias is correlated with gene expression levels Blackwell Y Hiraoka usage Publishing et al. bias in fission Inc yeast in the fission yeast Schizosaccharomyces pombe Yasushi Hiraoka 1,2,3, *,

More information