Chapter 9. Applications of probability. 9.1 The genetic code

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Chapter 9. Applications of probability. 9.1 The genetic code"

Transcription

1 Chapter 9 Applications of probability In this chapter we use the tools of elementary probability to investigate problems of several kinds. First, we study the language of life by focusing on the universal genetic code. We ask how that code (consisting of four letters, called nucleotides or bases) is distributed over the 20 or so words (amino acids) that make up functional units, the proteins. We find that there are interesting properties of that code that make some amino acids more likely to occur than others (given random sequences of bases). Next, we turn attention to how the sentences made up of these elementary words are shaped by enzymes that cut DNA. We then turn to genetics, and ask how traits are inherited and passed from one generation to the next. We explore how information about family traits can help to answer questions about the likelihood of a genetic disease being transmitted. We end the chapter with other examples of biological and non-biological applications of the laws of chance. 9.1 The genetic code All living things are made of basic building blocks called proteins. These proteins come in a rich diversity, and each of these is in turn composed of elementary units called amino acids. A protein is created from a linear chain of such units, assembled one unit at a time in a long string. As it is being produced, the chain folds back on itself to produce a three-dimensional structure, like a beaded necklace that curls and folds up on itself. The beads (representing amino acids) come in 20 varieties. All share an identical framework, with distinct side chains that give them each unique properties: some are polar, and tend to favor interactions with water, while others are hydrophobic - i.e. favor an environment that is protected from water. Although the primary structure of the protein constrains the overall structure that can form, the side chains influence which amino acids like to be in proximity to which (in the folded 3D protein), and which sections of the chain form helical or flat portions of the protein. The sequence in which these beads are strung together, i.e. the linear sequence of amino acids, determines the final structure of the protein. All our cells are made up of a dazzling variety of proteins. Some are structural, and some functional enzyme proteins, that carry out catalytic activity. Instructions for the assembly of each and every one of these proteins is encoded in the genetic material, i.e. in DNA (deoxyribonucleic acid). This instruction book is itself a linear chain of code, composed of letters that represent v January 5,

2 A T T G A G C A T G C A nucleotides on DNA strand showing 4 codons I E H A amino acid sequence on protein 3D protein structure composed of amino acid subunits Figure 9.1: The sequence of nucleotides on a DNA chain represents a sequence of amino acids along the length of a protein. (DNA is actually a double-helix, with two intertwined complementary strands, but here we show only one of these strands). The strand illustrates four typical codons, and their corresponding amino acids (I=Isoleucine, E=Glutamic acid, H=Histidine, A=Alanine; see the Appendix for common abbreviations of the names of the amino acids). The lower panel shows the 3D structure formed by the folded protein chain. the sequence of amino acids in each protein. Let us consider one such portion of DNA that encodes a single protein, i.e. one gene. DNA is composed of just four distinct units, called nucleotides. These four components, Adenine, Cytosine, Guanine, and Thymine (A, C, G, T) arranged in a long string, one after the other, are translated into the corresponding necklace of amino acids that compose a protein whenever the given gene is activated. (We shall not here discuss the details of the amazing processes that handle this process of translation, since our focus will be on some aspects of the code.) DNA nucleotide words have to spell out 20 distinct meanings, corresponding to the 20 amino acids listed in Table 1. We first consider what features of this code follow from these simple facts. 1. DNA is composed of 4 nucleotides, (A, T, G, C). 2. These nucleotides, arranged one after the other, code for 20 amino acids. Facts 1 and 2 imply that we cannot make a simple correspondence of one nucleotide representing one amino acid. This implies that the code must contain longer words. Assuming that all words v January 5,

3 T C A G T C A G TTT Phe (F) TTC Phe (F) TTA Leu (L) TTG Leu (L) CTT Leu (L) CTC Leu (L) CTA Leu (L) CTG Leu (L) ATT Ile (I) ATC Ile (I) ATA Ile (I) ATG Met (M) GTT Val (V) GTC Val (V) GTA Val (V) GTG Val (V) TCT Ser (S) TCC Ser (S) TCA Ser (S) TCG Ser (S) CCT Pro (P) CCC Pro (P) CCA Pro (P) CCG Pro (P) ACT Thr (T) ACC Thr (T) ACA Thr (T) ACG Thr (T) GCT Ala (A) GCC Ala (A) GCA Ala (A) GCG Ala (A) TAT Tyr (Y) TAC Tyr (Y) TAA STOP TAG STOP CAT His (H) CAC His (H) CAA Gln (Q) CAG Gln (Q) AAT Asn (N) AAC Asn (N) AAA Lys (K) AAG Lys (K) GAT Asp (D) GAC Asp (D) GAA Glu (E) GAG Glu (E) TGT Cys (C) TGC Cys (C) TGA STOP TGG Trp (W) CGT Arg (R) CGC Arg (R) CGA Arg (R) CGG Arg (R) AGT Ser (S) AGC Ser (S) AGA Arg (R) AGG Arg (R) GGT Gly (G) GGC Gly (G) GGA Gly (G) GGG Gly (G) Table 9.1: Table of genetic code are the same length, we consider pairs of nucleotides. Then there are 4 4 = 16 possible two-nucleotide words, and this is still not enough to represent 20 amino acids. Consider all three-nucleotide words. There are = 64 such words. This would more than suffice, and if we assume that there are no nonsense words (that represent no amino acid at all) then it is clear that many synonyms must exist, i.e. several distinct three-nucleotide words that all represent the same amino acid. It is now known that, indeed, the three- letter words here envisioned form the standard basic genetic code, i.e. the code shared by most organisms on our planet. From now on, we refer to the three-nucleotide word that codes for an amino acid as a codon. Table 9.1 lists the amino acids with their corresponding codons. (We also observe that there are three codons that are used to punctuate the code, i.e. signal the end of a sequence coding for one protein.) Simple arguments, phrased in terms of probabilities, can be used to study properties of this universal code of life. We shall use this biological example to motivate some very elementary calculations in probability Simple amino acid probabilities Let us imagine selecting one codon at random from a DNA sequence. How likely is it that the codon represents a specific amino acid, e.g. Glycine (Gly)? To answer this question, we need to know something about the probability of finding a given nucleotide in the three positions within a v January 5,

4 codon. Some data about this is investigated in the problem set. Here we simplify the discussion by assuming that each of the four nucleotides is equally likely to occur in each of the positions of a given codon. (This is not, in fact, the case, but it serves the purpose of demonstrating essential probability concepts.) P(T) = P(A) = P(G) = P(C) Since only these four nucleotides are used, it must be true that P(T) + P(A) + P(G) + P(C) = 1 and therefore, the equally likely assumption means that P(T) = P(A) = P(G) = P(C) = This means that each of the nucleotides has a probability 1/4 of occurring in any spot. There are = 64 possible combinations of three letters, as shown in Table 1. Out of these, four codons (GGT, GGC, GGA, GGG) code for Glycine. The probability that a codon chosen at random codes for Glycine is then P(Gly)=4/64=1/16. Which amino acid(s) would occur with highest probability? With lowest probability? Amino acids that would be represented with greatest probability include Leucine (Leu), whose codons can be any of (TTA, TTG, CTT, CTC, CTA, CTG). This means that the probability of leucine is P(Leu)=6/64 = 3/32. From Table 1 we can also see that Arginine (Arg) has a similar probability, with codons (CGT, CGC, CGA, CGG, AGA, AGG). The amino acids with fewest codons include Tryptophan (Trp) whose only codon is TGG and methionine (ATG). Each of these would occur with probability 1/64. What is the likelihood that the codon represents the end (STOP) of a protein chain?there are three STOP sequences, so these occur with probability 3/64. Amino acids with multiple (synonymous) codons Since there are 64 possible distinct codons and only 20 amino acids, if the code was assigned uniformly to all the amino acids, then on average there should be 64/20 = 3.2 (i.e. just over 3) different codons representing a single amino acid. (We will refer to such codons as synonymous, since they have the same interpretation). However, the assignment of codons is far from uniform. As shown in Table 9.1, some amino acids have up to 6 synonyms (e.g. Leucine, Arginine, and Serine) whereas others have only 1 (e.g. Methionine, Tryptophan). (The STOP mark is coded by three distinct codons.) We could represent this information using a table, a bar graph, or a cumulative function, just as we did for results of an experiment. An analysis of this type is carried out in the problem set. Mutations and codon volatility A mutation is an event that changes one or more of the instructions encoded in a gene. The simplest conceivable mutation is a single substitution of one nucleotide by some other nucleotide somewhere along the DNA chain. This is called a single nucleotide mutation. Here we will assume that each nucleotide in any codon has an equal probability of being replaced by this type of chance rare event. We will examine how the amino acid represented by the given codon would change. First, we observe that certain nucleotide substitutions result in synonymous codons for the same amino acid. For example, the substitution of adenine for thymosine in GGT to GGA preserves the v January 5,

5 CCG (Pro) CGG (Arg) CAG (Gly) ATG (Met) TAG (Stop) TCG (Ser) TTG (Trp) CTA (Leu) CTG (Leu) TTG (Leu) TTA (Leu) CTT (Leu) CTC (Leu) GTG (Val) TTT (Phe) TTC (Phe) Figure 9.2: A substitution in one nucleotide can change the meaning of a codon. Here we show two codons that both represent the amino acid leucine, and the result of all possible single nucleotide substitutions. assignment of the amino acid glycine. The term volatility of a codon denotes the proportion of its single nucleotide mutations that lead to different amino acids. In general since only one letter in the 3-letter code is changed, there are distinct neighbors of each codon that result from a one-letter change. The volatility will be computed by the fraction of such neighbors (excluding the STOP codons) that result in new assignments. The volatility of a whole gene is defined as the average volatility of its codons. In general, the higher the volatility, the more likely it is that a mutation will result in a change in the structure of a protein. Some changes of this type would be catastrophic, resulting in a broken or nonfunctional protein. Others would be beneficial, leading to changes that improve the function, change the structure, or lead to new properties. One situation in which gene volatility is desirable is the evolution of parasites that must rapidly alter their external coats to avoid being detected and eliminated by a host immune system. The human malaria parasite, Plasmodium falciparum is one example in which high volatility is evident in numerous genes. Examples The amino acid Valine (Val) is coded by any of the four codons GTT, GTC, GTA, and GTG. Clearly changing the last nucleotide in this codon leads to a synonymous codon. Changes in either of the first two nucleotides leads to a distinct amino acid (and none leads to the termination sequence). This means that all codons for Valine have the same volatility. To compute this volatility, we note that three possible substitutions in nucleotide 1 or three possible substitutions in codon 2 (for a total of 6 possible changes) will by nonsynonomous. Thus the volatility of any of the Valine codons is 6/9= Only one sequence, TGG codes for Tryptophan. Any of the 9 possible changes of a single nucleotide will lead to a different amino acid. Thus, tryptophan has volatility 9/9=1. Not all codons for a given amino acid have the same volatility. In Figure 9.2 we show two codons for leucine. The codon CTG has 5 neighbors that are not synonyms (Met, Gly, Arg, Pro, Val), so v January 5,

6 its volatility is 5/9= The codon TTG has 6 out of 8 nonsynonymous neighbors (excluding the STOP sequence TAG), so has volatility 6/8= Cutting the strand: How restriction enzymes work The genetic material in a cell is manipulated in many ways by enzymes that copy, splice, translate, and rearrange it. Certain biomolecules, called restriction enzymes are responsible for carefully cutting DNA at specific markers based on its nucleotide sequence. In general, these enzymes look for some multiple nucleotide pattern, and cut the strand of DNA at the location of that pattern. (Many of these enzymes are now used in biological experiments to manipulate DNA artificially in order to dissect it into manageable fragments for sequencing purposes.) We here consider an example in which the probability of finding a nucleotide at a given position is used to compute the mean length of fragments produced by a simplified DNA-cutting enzyme of this type. We simplify the problem to its most basic level, to illustrate how probabilities of single nucleotides are combined to answer more involved questions. For simplicity, assume that a hypothetical restriction enzyme cuts a DNA strand repeatedly, but only after a specific nucleotide, e.g. the base G, as shown in Figure 9.3. We ask what is the mean length of fragments created? A A T C C T A G T C P(no G here) X P (G here) Figure 9.3: A restriction enzyme (shown here as a pair of scissors ) cuts a DNA strand. In this simple example, the cut is always after the nucleotide G. To compute the mean length of fragments, we first need to find the probability of a given length, l. This is the product of probabilities that no G is found in any of l 1 positions, followed by a G in the l th position. v January 5,

7 Mean length of fragments of a simple restriction enzyme We assume that all nucleotides appear randomly with equal probabilities. Then, as before, P(G)=P(C)=P(A)=P(T) A fragment of length l if the enzyme encounters l 1 bases that are NOT G followed by base G in the l th position. Thus, the probability of a fragment of length l is: ( 3 P(fragment of length l) = ) ( ) l 1 ( ) =. 4 4 } {{ } l 1 terms The mean length of all fragments is found by computing l = lp(l) l=0 where we have used P(l) to denote P(fragment of length l). Then, by the above, l = l l=0 ( ) l ( ) 1 = where we have taken out the common factor (1/4) and used the notation r = 3/4 in the above. In order to evaluate the above, we need a formula for the sum of the series shown here. In the problem set, we show, (using the derivative of a geometric series) that for any r such that r < 1, Thus l = 1 4 kr k 1 = k=0 1 (1 r) 2 = (1 r) 2. l=0 1 (1 (3/4)) 2 = 1 4 Thus the mean length of the fragments is 4 nucleotides long. lr l 1 1 (1/4) 2 = 4 The calculation of mean length of DNA fragments for an enzyme that cuts after every occurrence of G, results in a mean length of 4 bases. We could reason intuitively that this makes sense: If bases are equally likely, then G occurs in roughly 1/4 of the positions. Thus it would occur roughly once per 4 nucleotides, giving rise to a 4-nucleotide fragment on average. 9.2 Hardy-Weinberg genetics Each of us has two entire sets of chromosomes: one set inherited from our mother, and one set from our father. These chromosomes carry genes, the unit of genetic material that codes for proteins and ultimately, through complicated biochemistry and molecular biology, determines all of our physical traits. v January 5,

8 We will investigate how a single gene (with two flavors, called alleles ) is passed from one generation to the next. We will consider a particularly simple situation, when the single gene determines some physical trait (such as eye color). The trait (say blue or green eyes) will be denoted the phenotype and the actual pair of genes (one on each parentally derived chromosome) will be called the genotype. Suppose that the gene for eye color comes in two forms that will be referred to as A and a. For example, A might be an allele for blue eyes, whereas a could be an allele for brown eyes. Then each individual must have one of the following pairs of combinations: AA, aa, or aa. (Note that aa and Aa will be considered to be equivalent here, i.e the order of the letters in the genotype is not important.) Suppose we know that the fraction of all genes for eye color of type A in the population is p, and the fraction of all genes for eye color of type a is q, where p+q = 1. (This means that there are only two possibilities for the gene type, of course.) Then we can interpret p and q as probabilities that a gene selected at random from the population will turn out to be type a (respectively A), i.e., P(A) = p, P(a)=q. Now suppose we draw at random two alleles out of the (large) population. (This is like tossing a coin twice). We get the following cases with given probabilities (computed with the second multiplication principle:) The probability of finding the genotypes aa (or the equivalent Aa), say, is the same as the probability of a AND A, and the probability of any genotype (aa, aa, AA, or Aa) is then the same as the product of probabilities as follows: Genotype: aa AA aa Aa Probability: pq p 2 q 2 pq We do not distinguish between genotypes aa and Aa, since the order of the alleles does not matter. Thus the probability of having a genotype which includes a and A (aa or Aa) is 2pq. If the population size is N, then, on average we would expect Np 2 individuals of type AA, Nq 2 of type aa and 2Npq individuals of the mixed type. The total probability of any of the genotypes is p 2 + 2pq + q 2 = (p + q) 2 = Random non-assortative mating We now examine what happens if mates are chosen (at random) and father and mother pass down one or another copy of their alleles to the progeny. We investigate how the proportion of genes of various types is arranged. In the table below, we show the possible genotypes of the mother and father, and calculate the probability that mating of such individuals would occur under the assumption that choice of mate is random - does not depend at all on eye color. We assume that the allele from the father (carried by his sperm) is independent of the allele found in the mother s egg cell. This means that we can use the multiplicative property of probability to determine the probability of a given combination of parental alleles. (i.e. P(x, y) = P(x)P(y)). v January 5,

9 For example, the probability that a couple chosen at random will consist of a woman of genotype aa and a man of genotype aa is a product of the fraction of females that are of type aa and the fraction of males that are of type aa. But that is just (2pq)(p 2 ) = 2p 3 q. Now let us examine the distribution of possible offspring of various parents. In the table, we note, for example, that in the case that the couple are both of type aa, each parent can donate either a or A to the progeny, so we expect to see children of types aa, aa, AA in the ratio 1:2:1. We can now group together and summarize all the progeny of a given genotype, with the probabilities that they are produced by one or another such random mating. Using this table, we can then determine the probability of each of the three genotypes in the next generation. Mother: AA aa aa Frequency: p 2 2pq q 2 Father: AA p 2 1 AA aa 1 AA Aa 2 2 p 4 2pqp 2 p 2 q 2 aa 2pq aa 1 aa 1 AA aa 1 Aa 2 2 2pqp 2 4p 2 q 2 2pqq 2 aa q 2 Aa 1 aa 2 2 aa p 2 q 2 2pqq 2 q 4 Table 9.2: The frequency of progeny of various types in Hardy-Weinberg genetics can be calculated as shown in this table. The genotype of the mother is shown across the top and the father s genotype is shown on the left column. The various progeny resulting from mating are the table entries, with the probabilities directly underneath each genotype. Problem Find the probability that a random (Hardy Weinberg) mating will give rise to a progeny of type AA. Solution 1 Using Table 9.2, we see that there are only four ways that a child of type AA can result from a mating: either both parents are AA, or one or the other parent is Aa, or both parents are Aa. Thus, for children of type AA the probability is P(child of type AA) = p (2pqp2 ) (2pqp2 ) (4p2 q 2 ) v January 5,

10 Simplifying leads to p(child of type AA) = p 2 (p 2 + 2qp + q 2 ) = p 2 (p + q) 2 = p 2 In the problem set, we also find that the probability of a child of type aa is 2qp, the probability of the child being type aa is q 2. We thus observe that the frequency of genotypes of the progeny is exactly the same as that of the parents. This type of genetic makeup is termed Hardy-Weinberg genetics. Alternate solution child AA father mother 2pq p2 2pq p 2 Aa AA Aa AA 1/ /2 A or A A or A (pq+p 2 ). ( pq + p 2 ) Figure 9.4: A tree diagram to aid the calculation of the probability that a child with genotype AA results from random assortative (Hardy Weinberg) mating. In Figure 9.4, we show an alternate solution to the same problem using a tree diagram. Reading from the top down, we examine all the possibilities at each branch point. A child AA cannot have any parent of genotype aa, so both father and mother s genotype could only have been one of AA or Aa. Each arrow indicating the given case is accompanied by the probability of that event. (For example, a random individual has probability 2pq of having genotype Aa, as shown on the arrows from the father and mother to these genotypes.) Continuing down the branches, we ask with what probability the given parent would have contributed an allele of type A to the child. For a parent of type AA, this is certainly true, so the given branch carries probability 1. For a parent of type Aa, the probability that A is passed down to the child is only 1/2. The combined probability is computed as follows: we determine the probability of getting an A from father (of type AA OR Aa): This is P(A from father)=(1/2)2pq+1 p 2 ) = (pq+p 2 ) and multiply it by a similar probability of getting A from the mother (of type AA OR Aa). (We must multiply, since we need A from the father AND A from the mother for the genotype AA. Thus P(child of type AA) =(pq + p 2 )(pq + p 2 ) = p 2 (q + p) 2 = p 2 1 = p 2. It is of interest to investigate what happens when one of the assumptions we made is relaxed, for example, when the genotype of the individual has an impact on survival or ability to reproduce. v January 5,

11 9.3 Random walker In this section we discuss an application of the binomial distribution to the process of a random walk. A shown in Figure 9.5(a), we consider a straight (1 dimensional) path and an erratic walker who takes steps randomly to the left or right. We will assume that the walker never stops. With probability p, she takes a step towards the right, and with probability q she takes a step towards the left. (Since these are the only two choices, it must be true that p + q = 1.) In Figure 9.5(b) we show the walkers position, x plotted versus the number of steps (n) she has taken. (We may as well assume that the steps occur at regular intervals of time, so that the horizontal axis of this plot can be thought of as a time axis.) (a) q p x x (b) n Figure 9.5: A random walker in 1 dimension takes a step to the right with probability p and a step to the left with probability q. The process described here is classic, and often attributed to a drunken wanderer. In our case, we could consider this motion as a 1D simplification of the random tumbles and swims of a bacterium in its turbulent environment. it is usually the case that a goal of this swim is a search for some nutrient source, or possibly avoidance of poor environmental conditions. We shall see that if the probabilities of left and right motion are unequal (i.e. the motion is biased in one direction or another) this swimmer tends to drift along towards a preferred direction. In this problem, each step has only two outcomes (analogous to a trial in a Bernoulli experiment). We could imagine the walker tossing a coin to determine whether to move right or left. We wish to characterize the probability of the walker being at a certain position at a given time, and to find her expected position after n steps. Our familiarity with Bernoulli trials and the binomial distribution will prove useful in this context. Example (a) What is the probability of a run of steps as follows: RLRRRLRLLLL v January 5,

12 (b) Find the probability that the walker moves k steps to the right out of a total run of n consecutive steps. (c) Suppose that p = q = 1/2. What is the probability that a walker starting at the origin returns to the origin on her 10 th step? Solution (a) The probability of the run RLRRRLRLLL is the product pqpppqpqqq = p 5 q 5. Note the similarity to the question What is the probability of tossing HTHHHTHTTT? (b) This problem is identical to the problem of k heads in n tosses of a coin. The probability of such an event is given by a term in the binomial distribution: P(k out of n moves to right)=c(n, k)p k q n k. (c) The walker returns to the origin after 10 steps only if she has taken 5 steps to the left (total) and 5 steps to the right (total). The order of the steps does not matter. Thus this problem reduces to the problem (b) with 5 steps out of 10 taken to the right. The probability is thus P(back at 0 after 10 steps) = P(5 out of 10 steps to right) ( ) 10 ( ) 1 10! 1 =C(10, 5)p 5 q 5 = C(10, 5) = 2 5!5! 1024 = Mean position We now ask how to determine the expected position of the walker after n steps, i.e. how the mean value of x depends on the number of steps and the probabilities associated with each step. After 1 step, with probability p the position is x = +1 and with probability q, the position is x = 1. The expected (mean) position after 1 move is thus x 1 = p(+1) + q( 1) = p q But the process follows a binomial distribution, and thus the mean after n steps is. x n = n(p q) 9.4 Further examples and problems This section is intended to help with practice of concepts of permutations and combinations, and to provide further examples of calculations of discrete probability. v January 5,

13 The Monty Hall problem Monty Hall was the host of a television game-show called Let s Make a Deal. This example concerns a problem in probability named in his honour. The problem attracted media attention when it was featured in a column written by Marilyn Vos Savant. The game goes as follows: There are three doors, and a contestant is offered the opportunity to win a car (behind one of the doors). Behind the other two doors is a less attractive option (e.g. a goat). The contestant at first selects one door. Monty Hall (who knows what is behind each door) opens one of the other two doors to reveal a goat and asks: Would you like to change your mind, or to stay with your original selection?. The question to be answered is whether, given this information, it is a better strategy to switch or to stay with the first door. We analyze this problem with the tree diagram shown in Figure 9.6. The question we ask is whether the odds of winning are greater if the contestant switches or stays with the original selection. Starting from the top of the diagram, we show each possibility with a branch, and assign a probability, assuming (as usual) that it is equally likely that the car is behind any of the three doors, and that Monty Hall always opens one of the other doors that contains a goat. For example, if your selection is labeled A, and it so happens that there is a goat behind A, then the car is equally likely to be behind doors B or C (probability 1/2 each). Monty will certainly open the other door with the goat (probability 1). In that case, switching leads to a win. We compute the probability of those events by multiplying the assigned probabilities down the length of each branch, and then adding the results of the relevant branches (as shown in the dotted lines at the base of the diagram in Figure 9.6. In case the car is actually behind the initially selected door, staying leads to a win, but as shown in the calculation, this happens with lower probability based on the assumptions in the problem. Therefore, the winning strategy is to switch your selection after Monty Hall opens one of the doors. Example 2 A class of 12 students is divided into three equal teams of 4 to work together on three history group projects. The first team will investigate the civilization of the Mayas (project 1), the second team will research the Aztecs (project 2), and the third team will work on the Incas (project 3). How many different ways are there of forming the teams? Assume that the order of individuals within a team does not matter, but the order in which teams are picked determines which team gets project 1, or project 2, etc. Solution There will be a total of 3 teams formed by this subdivision. As noted above, the order of the teams matters, since the projects assigned are distinct. We must find out how many ways there are of choosing people from the class to fill each of these teams. For the first team, the number of ways of selecting 4 out of 12 people is given by C(12, 4) = 12! 8!4! = = 495 v January 5,

14 You first pick: Door A 2/3 1/3 goat in A 1/2 1/2 car in B 1 1 car in C car in A 1/2 1/2 Monty opens: C B C B You: Result: stay switch stay switch stay switch stay switch to B to C lose win lose win win lose win lose P(win if stay) = P(win if switch)= (2/3)(1/2) + (2/3)(1/2) (1/3)(1/2) + (1/3)(1/2) = 1/3 = 2/3 Figure 9.6: The Monty Hall problem. v January 5,

15 [Remark: we use the formula for combinations here, because the arrangement of individuals within a team is not relevant: a team composed of Mary, Bob, Jack, and Jane is the same as a team composed of Bob, Jane, Jack, and Mary.] For each one of these ways we now have many ways of choosing the remaining teams. Once this team has formed, we have only 8 people left to choose from for the other teams. So for the second team, the number of combinations are C(8, 4) = 8! 4! 4! = 70. We now have only four people left, and they have to form the last team. The total number of ways of forming these teams is the product of the three results obtained above, i.e = Example 3 (a) George has a photograph of each of his 8 sisters, but a wallet-sized photo album with 5 spaces for some of these photos. How many different arrangement of these photos could George make in the available space? (b) What is the probability that both Mary and Jane will be included in the photo album if each photograph is selected randomly for the display? (Assume that Mary and Jane are two of the sisters.) Solution (a) Here the arrangement of the photos is relevant, so we must consider permutations. (This means that a display in which Mary is first and Jane second is considered distinct from a display in which Jane is first and Mary is second.) The number of ways of arranging 8 objects into 5 slots is P(8, 5) = 8! (8 5)! = = (b) The probability that Mary will be selected to fill the first slot is 1/8. The probability that she is selected for any one of the 5 slots is thus 5/8. But if Mary was selected, there would then be 7 sisters left to choose between, and 4 slots in which to place their photographs. Thus the probability that Jane is then selected for one of these other slots is 4/7. The probability that both of the above occur is (5/8) (4/7) = v January 5,

16 9.5 Appendix Abbrev Abbrev Amino acid A Ala Alanine R Arg Arginine N Asn Asparagine D Asp Aspartic acid C Cys Cysteine Q Gln Glutamine E Glu Glutamic acid G Gly Glycine H His Histidine I Ile Isoleucine L Leu Leucine K Lys Lysine M Met Methionine F Phe Phenylalanine P Pro Proline S Ser Serine T Thr Threonine W Trp Tryptophan Y Tyr Tyrosine V Val Valine Table 9.3: Common abbreviations for the amino acids 9.6 For further reading Plotkin JB, Dushoff J, Fraser H B (2004) Detecting selection using a single nucleotide sequence of M tuberculosis and P falciparum, Nature 428: (April 29, 2004). Plotkin JB, Dushoff J (2003) Codon bias and frequency-dependent selection on the hemagglutinin epitopes of influenza A virus, PNAS 100: (June 10, 2003). Zhang J (2005) On the evolution of codon volatility, Genetics 169: (January 2005). v January 5,

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:

More information

Grundlagen der Bioinformatik, SS 08, D. Huson, April 21,

Grundlagen der Bioinformatik, SS 08, D. Huson, April 21, Grundlagen der Bioinformatik, SS 08, D. Huson, April 21, 2008 7 2 Introduction to Molecular Biology We will start with a very short repetition of the basics of molecular biology, including a summary of

More information

DNA and Protein Synthesis Grade 10

DNA and Protein Synthesis Grade 10 Ohio Standards Connection: Life Sciences Benchmark C Explain the genetic mechanisms and molecular basis of inheritance. Indicator 5 Illustrate the relationship of the structure and function of DNA to protein

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:.

More information

Mutations and Genetic Variability. 1. What is occurring in the diagram below?

Mutations and Genetic Variability. 1. What is occurring in the diagram below? Mutations and Genetic Variability 1. What is occurring in the diagram below? A. Sister chromatids are separating. B. Alleles are independently assorting. C. Genes are replicating. D. Segments of DNA are

More information

Hands on Simulation of Mutation

Hands on Simulation of Mutation Hands on Simulation of Mutation Charlotte K. Omoto P.O. Box 644236 Washington State University Pullman, WA 99164-4236 omoto@wsu.edu ABSTRACT This exercise is a hands-on simulation of mutations and their

More information

(http://genomes.urv.es/caical) TUTORIAL. (July 2006)

(http://genomes.urv.es/caical) TUTORIAL. (July 2006) (http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA

More information

Molecular Biology Basic Concepts

Molecular Biology Basic Concepts Molecular Biology Basic Concepts Prof. Dr. Antônio Augusto Fröhlich Charles Ivan Wust LISHA - UFSC {guto charles}@lisha.ufsc.br http://www.lisha.ufsc.br/~{guto charles} September 2003 September 2003 http://www.lisha.ufsc.br/~guto

More information

HP22.1 Roth Random Primer Kit A für die RAPD-PCR

HP22.1 Roth Random Primer Kit A für die RAPD-PCR HP22.1 Roth Random Kit A für die RAPD-PCR Kit besteht aus 20 Einzelprimern, jeweils aufgeteilt auf 2 Reaktionsgefäße zu je 1,0 OD Achtung: Angaben beziehen sich jeweils auf ein Reaktionsgefäß! Sequenz

More information

DNA pol RNA pol ARS trna Ribosome DNA mrna Protein Transcription Translation Replication A B Acceptor stem D-loop T C loop Anticodon loop Variable loop Relative trna gene copy number 0.0 0.2 0.4

More information

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations http://members.cox.net/amgough/mutation_chromosome_translocation.gif Introduction: In biology, mutations are changes to the base

More information

In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA.

In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA. In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA. For each student: Science notebook Reproducible Master 6, Cooking Up a Protein

More information

Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell?

Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell? Pipe Cleaner Proteins GPS: SB1 Students will analyze the nature of the relationships between structures and functions in living cells. Essential question: How does the structure of proteins relate to their

More information

Section 1 Workbook (unit 2) ANSWERS

Section 1 Workbook (unit 2) ANSWERS Section 1 Workbook (unit 2) ANSWERS Complete the following table: nucleotide DNA RN Name: B5. Describe DNA replication 1) Label each base given in the diagram below and describe the 4 primary characteristics

More information

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct

More information

Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae

Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae Journal of Cell and Molecular Research (2011) 3 (1), 1-11 Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae Fatemeh Moosavi 1, Hassan Mohabatkar

More information

Codon usage bias is correlated with gene expression levels in the fission yeast Schizosaccharomyces pombe

Codon usage bias is correlated with gene expression levels in the fission yeast Schizosaccharomyces pombe Codon usage bias is correlated with gene expression levels Blackwell Y Hiraoka usage Publishing et al. bias in fission Inc yeast in the fission yeast Schizosaccharomyces pombe Yasushi Hiraoka 1,2,3, *,

More information

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core DNA Sequencing Services Pre-Mixed o Provide template and primer, mixed into the same tube* Pre-Defined o Provide template and primer in separate tubes* Custom o Full-service for samples with unknown concentration

More information

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain?

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain? Networked Systems, COMPGZ01, 2012 Answer TWO questions from Part ONE on the answer booklet containing lined writing paper, and answer ALL questions in Part TWO on the multiple-choice question answer sheet.

More information

Module 6: Digital DNA

Module 6: Digital DNA Module 6: Digital DNA Representation and processing of digital information in the form of DNA is essential to life in all organisms, no matter how large or tiny. Computing tools and computational thinking

More information

The p53 MUTATION HANDBOOK

The p53 MUTATION HANDBOOK The p MUTATION HANDBOOK Version 1. /7 Thierry Soussi Christophe Béroud, Dalil Hamroun Jean Michel Rubio Nevado http://p/free.fr The p Mutation HandBook By T Soussi, J.M. Rubio-Nevado, D. Hamroun and C.

More information

Ruth Sundeen. Lesson 9 Part 1. Help Your Students Learn. Greetings and felicitations from Mrs. Ruth!

Ruth Sundeen. Lesson 9 Part 1. Help Your Students Learn. Greetings and felicitations from Mrs. Ruth! Ruth Sundeen Lesson 9 Part 1 Help Your Students Learn Ages: Eighth grade to high school senior Topics: Protein Synthesis Enzymes Experiment to demonstrate fragility of enzymes Greetings and felicitations

More information

Molecular Facts and Figures

Molecular Facts and Figures Nucleic Acids Molecular Facts and Figures DNA/RNA bases: DNA and RNA are composed of four bases each. In DNA the four are Adenine (A), Thymidine (T), Cytosine (C), and Guanine (G). In RNA the four are

More information

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects Mutation Mutation provides raw material to evolution Different kinds of mutations have different effects Mutational Processes Point mutation single nucleotide changes coding changes (missense mutations)

More information

Aipotu Part III: Molecular Biology

Aipotu Part III: Molecular Biology Aipotu Part III: Molecular Biology Introduction: The Biological Phenomenon Under Study In this lab, you will continue to explore the biological mechanisms behind the expression of flower color in a hypothetical

More information

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors.

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. Legends of supplemental figures and tables Figure 1: Overview of study design and results. (A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. After raw data gene expression

More information

MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE 6 AND ATPASE 8 GENES IN DIFFERENT MAMMALIAN SPECIES

MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE 6 AND ATPASE 8 GENES IN DIFFERENT MAMMALIAN SPECIES , pp.-068-075. Available online at http://www.bioinfopublication.org/jouarchive.php?opt=&jouid=bpj0000220 MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE

More information

Blue Heron, Your Gene Synthesis Partner

Blue Heron, Your Gene Synthesis Partner Blue Heron, Your Gene Synthesis Partner You Design it We Build it Simple to Complex Sequences Codon Optimization Any species Variants Single or pooled clone libraries Antibody Affinity Optimization Whole

More information

The amino acids differ in the properties of their side chains. Hydrophobic, non acidic (the H+ ion won t associate with water)

The amino acids differ in the properties of their side chains. Hydrophobic, non acidic (the H+ ion won t associate with water) Amino Acids 101 What is an amino acid? Amino acids, or alpha- amino acids, are the building blocks of peptides and proteins They are composed of amine and carboxylic acid groups, separated by the alpha-carbon

More information

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C)

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C) TECHNICAL DATA SHEET BIOLUMINESCENCE RESONANCE ENERGY TRANSFER RENILLA LUCIFERASE FUSION PROTEIN EXPRESSION VECTOR Product: prluc-c Vectors Catalog number: Description: Amount: The prluc-c vectors contain

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information

Solution Key Problem Set 3

Solution Key Problem Set 3 Solution Key- 7.016 Problem Set 3 Question 1 The following human pedigree shows the inheritance pattern of a specific disease within a family. Assume that the individuals marrying into the family for all

More information

Woods Biol Hmwk DNA & Genetic Engineering (key) Pg. 1

Woods Biol Hmwk DNA & Genetic Engineering (key) Pg. 1 Woods Biol Hmwk-6 10-1 DNA & Genetic Engineering (key) Pg. 1 NOTE: Unless otherwise indicated in the problem, DNA will be from the Template strand. Figure 1: Look carefully at Fig s 1 & 2 to determine

More information

trna and Protein Building Lab Date Period

trna and Protein Building Lab Date Period trna and Protein Building Lab Name Date Period Purpose: RNA produced in the nucleus of a cell moves out of the nucleus to the cell s ribosomes. This RNA is a specific sequence of bases copied from the

More information

Table S1. Related to Figure 4

Table S1. Related to Figure 4 Table S1. Related to Figure 4 Final Diagnosis Age PMD Control Control 61 15 Control 67 6 Control 68 10 Control 49 15 AR-PD PD 62 15 PD 65 4 PD 52 18 PD 68 10 AR-PD cingulate cortex used for immunoblot

More information

Concluding lesson. Student manual. What kind of protein are you? (Basic)

Concluding lesson. Student manual. What kind of protein are you? (Basic) Concluding lesson Student manual What kind of protein are you? (Basic) Part 1 The hereditary material of an organism is stored in a coded way on the DNA. This code consists of four different nucleotides:

More information

BOC334 (Proteomics) Practical 1. Calculating the charge of proteins

BOC334 (Proteomics) Practical 1. Calculating the charge of proteins BC334 (Proteomics) Practical 1 Calculating the charge of proteins Aliphatic amino acids (VAGLIP) N H 2 H Glycine, Gly, G no charge Hydrophobicity = 0.67 MW 57Da pk a CH = 2.35 pk a NH 2 = 9.6 pi=5.97 CH

More information

Gene Finding CMSC 423

Gene Finding CMSC 423 Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher

More information

Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation. Beginning Perl, Chap 4 6. Example 1

Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation. Beginning Perl, Chap 4 6. Example 1 Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation Beginning Perl, Chap 4 6 Example 1 #!/usr/bin/perl -w use strict; # version 1: my @nt = ('A', 'C', 'G', 'T'); for

More information

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme. Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.

More information

Cathryn Kurkjian, PhD Postdoctoral Trainee University of North Carolina, Chapel Hill.

Cathryn Kurkjian, PhD Postdoctoral Trainee University of North Carolina, Chapel Hill. [Type here] [Type here] [Type here], PhD Postdoctoral Trainee University of North Carolina, Chapel Hill Email: kurkjiancj@gmail.com Twitter: @Cate_Kurkjian Image from: http://icsjournal.org/2015/03/02/dna-building-blocks-of-nanotechnology/

More information

DNA Sample preparation and Submission Guidelines

DNA Sample preparation and Submission Guidelines DNA Sample preparation and Submission Guidelines Requirements: Please submit samples in 1.5ml microcentrifuge tubes. Fill all the required information in the Eurofins DNA sequencing order form and send

More information

Unit 6 ~ Learning Guide

Unit 6 ~ Learning Guide Unit 6 ~ Learning Guide Name: INSTRUCTIONS Complete the following notes and questions as you work through the related lessons. You are required to have this package completed BEFORE you write your unit

More information

CHAPTER 16: ANSWERS TO SELECTED PROBLEMS

CHAPTER 16: ANSWERS TO SELECTED PROBLEMS CATER 16: ASWERS T SELECTED RBLEMS SAMLE RBLEMS ( Try it yourself ) 16.1 Connecting the base guanine (shown in Table 16.1) with ribose and phosphate gives the structure of GM. C 2 2 16.2 The complementary

More information

B5 B8 ANWERS DNA & ) DNA

B5 B8 ANWERS DNA & ) DNA Review sheet for test B5 B8 ANWERS DNA review 1. What bonds hold complementary bases between 2 strands of DNA together? Hydrogen bonds 2. What bonds exist between sugars and phosphates? Covalent bonds

More information

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination

More information

4 Titration Curve of an Amino Acid

4 Titration Curve of an Amino Acid p H 4 Titration Curve of an Amino Acid Simple amino acid Acidic amino acid Basic amino acid 7 OH - equivalents Objectives: A) To determine the titration curve for an amino acid and B) to use this curve

More information

Guidelines for Writing a Scientific Paper

Guidelines for Writing a Scientific Paper Guidelines for Writing a Scientific Paper Writing an effective scientific paper is not easy. A good rule of thumb is to write as if your paper will be read by a person who knows about the field in general

More information

REVISING DNA AND PROTEIN SYNTHESIS (LIVE) 01 JULY 2015 Exam Questions

REVISING DNA AND PROTEIN SYNTHESIS (LIVE) 01 JULY 2015 Exam Questions REVISING DNA AND PROTEIN SYNTHESIS (LIVE) 01 JULY 2015 Exam Questions Question 1 (Adapted from Feb/March 2015 Paper 2 DBE, Question 1.4) The diagram below represents DNA replication. 1.1 Identify the following:

More information

Genomes and SNPs in Malaria and Sickle Cell Anemia

Genomes and SNPs in Malaria and Sickle Cell Anemia Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing

More information

DNA: Molecule of Life

DNA: Molecule of Life DNA: Molecule of Life History DNA Structure Protein Synthesis Gene Regulation History of DNA H I S T O By the 1940 s, scientists knew that chromosomes consisted of both DNA and protein but did not know

More information

Shu-Ping Lin, Ph.D. E-mail: splin@dragon.nchu.edu.tw

Shu-Ping Lin, Ph.D. E-mail: splin@dragon.nchu.edu.tw Amino Acids & Proteins Shu-Ping Lin, Ph.D. Institute te of Biomedical Engineering ing E-mail: splin@dragon.nchu.edu.tw Website: http://web.nchu.edu.tw/pweb/users/splin/ edu tw/pweb/users/splin/ Date: 10.13.2010

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing 38. Informationsgespräch der Blutspendezentralefür Wien, Niederösterreich und Burgenland Österreichisches Rotes Kreuz 22. November 2014, Parkhotel Schönbrunn Die Zukunft hat

More information

Advanced Medicinal & Pharmaceutical Chemistry CHEM 5412 Dept. of Chemistry, TAMUK

Advanced Medicinal & Pharmaceutical Chemistry CHEM 5412 Dept. of Chemistry, TAMUK Advanced Medicinal & Pharmaceutical Chemistry CHEM 5412 Dept. of Chemistry, TAMUK Dai Lu, Ph.D. dlu@tamhsc.edu Tel: 361-221-0745 Office: RCOP, Room 307 Drug Discovery and Development Drug Molecules Medicinal

More information

From Gene to Protein Transcription and Translation i

From Gene to Protein Transcription and Translation i From Gene to Protein Transcription and Translation i How do the genes in our DNA influence our characteristics? For example, how can a gene determine whether a person is an albino with very pale skin and

More information

Chemical Structures. Part I: Structures on paper and in 3-d

Chemical Structures. Part I: Structures on paper and in 3-d hemical Structures bjectives 1. To practice with the different atoms used in Bio 111: to know the number of bonds made by each kind of atom, the structures that they form, and the charges they have. 2.

More information

Answers and Solutions to Text Problems

Answers and Solutions to Text Problems 22 Answers and Solutions to Text roblems 22.1 DA contains two purines, adenine (A) and guanine (G) and two pyrimidines, cytosine (C) and thymine (T). RA contains the same bases, except thymine (T) is replaced

More information

Amino Acids, Peptides, Proteins

Amino Acids, Peptides, Proteins Amino Acids, Peptides, Proteins Functions of proteins: Enzymes Transport and Storage Motion, muscle contraction Hormones Mechanical support Immune protection (Antibodies) Generate and transmit nerve impulses

More information

Part A: Amino Acids and Peptides (Is the peptide IAG the same as the peptide GAI?)

Part A: Amino Acids and Peptides (Is the peptide IAG the same as the peptide GAI?) ChemActivity 46 Amino Acids, Polypeptides and Proteins 1 ChemActivity 46 Part A: Amino Acids and Peptides (Is the peptide IAG the same as the peptide GAI?) Model 1: The 20 Amino Acids at Biological p See

More information

Molecular analyses of EGFR: mutation and amplification detection

Molecular analyses of EGFR: mutation and amplification detection Molecular analyses of EGFR: mutation and amplification detection Petra Nederlof, Moleculaire Pathologie NKI Amsterdam Henrique Ruijter, Ivon Tielen, Lucie Boerrigter, Aafke Ariaens Outline presentation

More information

Supplementary Online Material for Morris et al. sirna-induced transcriptional gene

Supplementary Online Material for Morris et al. sirna-induced transcriptional gene Supplementary Online Material for Morris et al. sirna-induced transcriptional gene silencing in human cells. Materials and Methods Lentiviral vector and sirnas. FIV vector pve-gfpwp was prepared as described

More information

PRACTICE TEST QUESTIONS

PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

2006 7.012 Problem Set 3 KEY

2006 7.012 Problem Set 3 KEY 2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each

More information

Gene Synthesis 191. Mutagenesis 194. Gene Cloning 196. AccuGeneBlock Service 198. Gene Synthesis FAQs 201. User Protocol 204

Gene Synthesis 191. Mutagenesis 194. Gene Cloning 196. AccuGeneBlock Service 198. Gene Synthesis FAQs 201. User Protocol 204 Gene Synthesis 191 Mutagenesis 194 Gene Cloning 196 AccuGeneBlock Service 198 Gene Synthesis FAQs 201 User Protocol 204 Gene Synthesis Overview Gene synthesis is the most cost-effective way to enhance

More information

Solutions to Problem Set 5

Solutions to Problem Set 5 Question 1 Solutions to 7.014 Problem Set 5 a) Which of the following molecules functions directly to transfer information from the nucleus to the cytoplasm? ircle all that apply. DN mrn trn transporter

More information

Conversion of nucleotides sequences into genomic signals

Conversion of nucleotides sequences into genomic signals J.Cell.Mol.Med. Vol 6, No 2, 2002 pp. 279-303 Special Article: Getting DNA to numbers Conversion of nucleotides sequences into genomic signals P. D. Cristea * Bio-Medical Engineering Center, Politehnica

More information

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation BDGP Resources Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation For recovery of sequences flanking PZ, PlacW and PEP elements E. Jay Rehm Berkeley Drosophila Genome Project I.

More information

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University Egypt Interpretation of sequence results An overview on

More information

Case Study. Malaria and the human genome TEACHER S GUIDE. Steve Cross, Bronwyn Terrill and colleagues. Version 1.0

Case Study. Malaria and the human genome TEACHER S GUIDE. Steve Cross, Bronwyn Terrill and colleagues. Version 1.0 TEACHER S GUIDE Case Study Malaria and the human genome Version 1.0 Steve Cross, Bronwyn Terrill and colleagues Wellcome Trust Sanger Institute Hinxton Malaria and the human genome Each year, the malaria

More information

Drosophila NK-homeobox genes

Drosophila NK-homeobox genes Proc. Natl. Acad. Sci. USA Vol. 86, pp. 7716-7720, October 1989 Biochemistry Drosophila NK-homeobox genes (NK-1, NK-2,, and DNA clones/chromosome locations of genes) YONGSOK KIM AND MARSHALL NIRENBERG

More information

pcas-guide System Validation in Genome Editing

pcas-guide System Validation in Genome Editing pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible

More information

From DNA to Protein. Chapter 14

From DNA to Protein. Chapter 14 From DNA to Protein Chapter 14 Impacts, Issues: Ricin and your Ribosomes Ricin is toxic because it inactivates ribosomes, the organelles which assemble amino acids into proteins, critical to life processes

More information

1. 1. Amino acids and proteins. 1: Biochemistry of macromolecules and metabolic pathways. Key terms

1. 1. Amino acids and proteins. 1: Biochemistry of macromolecules and metabolic pathways. Key terms 1. 1 Amino acids and proteins Key terms Polymer: A large molecule made from repeating units called monomers. Monomer: A molecule that is a basic unit; many monomers join together to make a polymer. Amino

More information

Math 30-1: Permutations and Combinations PRACTICE EXAM

Math 30-1: Permutations and Combinations PRACTICE EXAM A. B. C. D. Math 30-1: Permutations and Combinations PRACTICE EXAM n! 1. The expression is equivalent to: (n - 2)! 2. A Grade 12 student is taking Biology, English, Math, and Physics in her first term.

More information

IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon. V. Polypeptides and Proteins

IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon. V. Polypeptides and Proteins IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon A. Acid/Base properties 1. carboxyl group is proton donor! weak acid 2. amino group is proton acceptor! weak base 3. At physiological ph: H

More information

Proteins. Amino Acids. Chapter 3. Molecular Diagnostics Fundamentals, Methods and Clinical Applications Second Edition 2/5/2013

Proteins. Amino Acids. Chapter 3. Molecular Diagnostics Fundamentals, Methods and Clinical Applications Second Edition 2/5/2013 Proteins Chapter 3 Amino Acids Nonpolar Alanine, Ala, A Isoleucine, Ile, I Leucine, Leu, L Methionine, Met, M Phenylalanine, Phe, F Tryptophan,Trp, W Valine, Val, V Negatively Charged (Acidic) Aspartic

More information

Introduction to Bioinformatics (Master ChemoInformatique)

Introduction to Bioinformatics (Master ChemoInformatique) Introduction to Bioinformatics (Master ChemoInformatique) Roland Stote Institut de Génétique et de Biologie Moléculaire et Cellulaire Biocomputing Group 03.90.244.730 rstote@igbmc.fr Biological Function

More information

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES SERVICES CATALOGUE WITH SUBMISSION GUIDELINES 3921 Montgomery Road Cincinnati, Ohio 45212 513-841-2428 www.agctsequencing.com CONTENTS Welcome Dye Terminator Sequencing DNA Sequencing Services - Full Service

More information

Supplementary Information. Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human

Supplementary Information. Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human Supplementary Information Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human vascular endothelial growth factor 165 revealed by biosensor based assays Yoichi Takakusagi

More information

Applications in population genetics. Hanan Hamamy Department of Genetic Medicine and Development Geneva University

Applications in population genetics. Hanan Hamamy Department of Genetic Medicine and Development Geneva University Applications in population genetics Hanan Hamamy Department of Genetic Medicine and Development Geneva University Training Course in Sexual and Reproductive Health Research Geneva 2013 Population genetics

More information

Mutations & DNA Technology Worksheet

Mutations & DNA Technology Worksheet Mutations & DNA Technology Worksheet Name Section A: Mutations Mutations are changes in DNA. Somatic mutations occur in non-reproductive cells and won't be passed onto offspring. Mutations that occur in

More information

Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook)

Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook) Name Date Per Look at the diagrams, then answer the questions. Gene Mutations affect a single gene by changing its base sequence, resulting in an incorrect, or nonfunctional, protein being made. (a) A

More information

Molecular Cloning, DNA Nucleotide Sequencing, and Expression in Bacillus subtilis Cells of the Bacillus macerans Cyclodextrin Glucanotransferase Gene

Molecular Cloning, DNA Nucleotide Sequencing, and Expression in Bacillus subtilis Cells of the Bacillus macerans Cyclodextrin Glucanotransferase Gene JOURNAL OF BACTERIOLOGY, June 1986, p. 11181122 00219193/86/06111805$02.00/0 Copyright 1986, American Society for Microbiology Vol. 166, No. 3 Molecular Cloning, DNA Nucleotide Sequencing, and Expression

More information

C1. A gene pool is all of the genes present in a particular population. Each type of gene within a gene pool may exist in one or more alleles.

C1. A gene pool is all of the genes present in a particular population. Each type of gene within a gene pool may exist in one or more alleles. C1. A gene pool is all of the genes present in a particular population. Each type of gene within a gene pool may exist in one or more alleles. The prevalence of an allele within the gene pool is described

More information

Analysis of Synonymous Codon Usage Bias in Chlamydia

Analysis of Synonymous Codon Usage Bias in Chlamydia ISSN 1672-9145 Acta Biochimica et Biophysica Sinica 2005, 37(1): 1 10 CN 31-1940/Q Analysis of Synonymous Codon Usage Bias in Chlamydia Hui LÜ, Wei-Ming ZHAO*, Yan ZHENG, Hong WANG, Mei QI, and Xiu-Ping

More information

Prep Time: 1 hour. Class Time: 45 minutes

Prep Time: 1 hour. Class Time: 45 minutes ACTIVITY OVERVIEW Abstract: Students use edible models of the DNA molecule to transcribe an mrna sequence, then translate it into a protein. Module: The Basics and Beyond Prior Knowledge Needed: A basic

More information

RNA and Protein Synthesis

RNA and Protein Synthesis Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic

More information

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page

More information

Introduction to Proteins; Amino Acids, the Building Blocks of Proteins

Introduction to Proteins; Amino Acids, the Building Blocks of Proteins Introduction to Proteins; Amino Acids, the Building Blocks of Proteins Reading: Berg, Tymoczko & Stryer: Chapter 2, pp. 25-34 Appendix to Chapter 2, pp. 60-61 (visualizing protein structures) Review General

More information

Chapter 25: Population Genetics

Chapter 25: Population Genetics Chapter 25: Population Genetics Student Learning Objectives Upon completion of this chapter you should be able to: 1. Understand the concept of a population and polymorphism in populations. 2. Apply the

More information

Honors Biology Practice Questions #1. Name. 6. Seastars have a diploid number of 24 chromosomes. The haploid number would be

Honors Biology Practice Questions #1. Name. 6. Seastars have a diploid number of 24 chromosomes. The haploid number would be Honors Biology Practice Questions #1 1. Donkeys have 68 chromosomes in each body cell. If a donkey cell undergoes meiosis, how many chromosomes should be in each gamete? A. 18 B. 34 C. 68 D. 132 2. A sperm

More information

Activity. 6.2 Chromosomes. Cell division

Activity. 6.2 Chromosomes. Cell division 120 6.2 Chromosomes Cell division The photo below shows some plant cells. The nuclei have been stained blue so that you can see them easily. The cell in the middle of the photo is in the process of dividing.

More information

Lab #5: DNA, RNA & Protein Synthesis. Heredity & Human Affairs (Biology 1605) Spring 2012

Lab #5: DNA, RNA & Protein Synthesis. Heredity & Human Affairs (Biology 1605) Spring 2012 Lab #5: DNA, RNA & Protein Synthesis Heredity & Human Affairs (Biology 1605) Spring 2012 DNA Stands for : Deoxyribonucleic Acid Double-stranded helix Made up of nucleotides Each nucleotide= 1. 5-carbon

More information

Gene Finding. Slides by Carl Kingsford

Gene Finding. Slides by Carl Kingsford Gene Finding Slides by Carl Kingsford Genome of the Cow a sequence of 2.86 billion letters enough letters to fill a million pages of a typical book. TATGGAGCCAGGTGCCTGGGGCAACAAGACTGTGGTCACTGAATTCATCCTTCTTGGTCTAACAGAGAACATAG

More information

Genetics 1. Defective enzyme that does not make melanin. Very pale skin and hair color (albino)

Genetics 1. Defective enzyme that does not make melanin. Very pale skin and hair color (albino) Genetics 1 We all know that children tend to resemble their parents. Parents and their children tend to have similar appearance because children inherit genes from their parents and these genes influence

More information

Bio 102 Practice Problems Genetic Code and Mutation

Bio 102 Practice Problems Genetic Code and Mutation Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine

More information

13.2 Ribosomes & Protein Synthesis

13.2 Ribosomes & Protein Synthesis 13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).

More information

Assessment Schedule 2014 Biology: Demonstrate understanding of genetic variation and change (91157) Evidence Statement

Assessment Schedule 2014 Biology: Demonstrate understanding of genetic variation and change (91157) Evidence Statement NCEA Level 2 Biology (91157) 2014 page 1 of 5 Assessment Schedule 2014 Biology: Demonstrate understanding of genetic variation and change (91157) Evidence Statement NCEA Level 2 Biology (91157) 2014 page

More information