Mutations and Genetic Variability. 1. What is occurring in the diagram below?

Size: px
Start display at page:

Download "Mutations and Genetic Variability. 1. What is occurring in the diagram below?"

Transcription

1 Mutations and Genetic Variability 1. What is occurring in the diagram below? A. Sister chromatids are separating. B. Alleles are independently assorting. C. Genes are replicating. D. Segments of DNA are crossing over.

2 2. The chart below shows the codons that make up the genetic code and the sequence of nucleotides that corresponds to them. A mistake during DNA replication leads to a mutation in the nucleotide sequence shown below. This mutation results from the insertion of two nucleotides into the original sequence, which causes the reading frame of the sequence to change. This kind of mutation is known as A. a nonsense mutation. B. a silent mutation. C. a chromosomal mutation. D. a frame shift mutation.

3 3. Dr. Stevens is examining the DNA sequences of a group of mice. He notices that in one of the mice, one nucleotide pair is substituted with another in the part of the DNA sequence that codes for fur color. However, despite the substitution, the mouse still has the same fur color as the other mice with the correct DNA sequence. Why doesn't the substitution of nucleotides in the mouse change its phenotype, or physical characteristics? The mouse has a completely different DNA sequence than the other mice. A. The substituted nucleotide has the same directions as the original nucleotide. B. Substitutions in the nucleotides of a mouse's DNA never affect their phenotypes. C. DNA sequences don't determine the color of a mouse's fur. D. 4. Which of the following is a source of genetic variation in sexually-reproducing organisms? A. mitosis B. translation C. meiosis D. all of these 5. Most heritable differences are due to A. the insertion of incorrect sequences of DNA by faulty polymerases. B. point mutations that occur during mitosis. C. the inability to form proper DNA sequences due to poor nutrition. D. gene shuffling that occurs during the production of gametes.

4 6. The chart below shows the codons that make up the genetic code and the sequence of nucleotides that corresponds to them. A mistake during DNA replication leads to a mutation in the nucleotide sequence shown below. What kind of mutation will result from the mistake made during DNA replication in the nucleotide sequence above? A. a frame shift mutation B. a nonsense mutation C. a silent mutation D. a chromosomal mutation

5 7. A frame shift mutation is a genetic mutation that is caused by the insertion or deletion of a specific number of nucleotides that shifts the reading frame of the sequence. The insertion or deletion of how many nucleotides would cause a frame shift mutation? A. 3 B. 2 C. 9 D How do mutations lead to genetic variation? A. by changing the organism's appearance B. by changing the way that the organism reproduces C. by changing the organism's behavior D. by producing random changes in an organism's genetic code 9. How could an apple farmer increase the number of genotypes and phenotypes present in his next apple crop? A. Cross plants that have the same characteristics. B. Cross plants that have very different characteristics. C. Make genetic clones of plants using asexual reproduction. D. It would be impossible for a farmer to increase the genetic variation of plants.

6 10. Down syndrome is a genetic disorder that is typically caused by an extra copy of chromosome 21 in a person's genome. In a small number of cases, however, Down syndrome occurs because a section of chromosome 21 becomes fused onto another chromosome. The type of Down syndrome that occurs because a section of chromosome 21 attaches to another chromosome is an example of a genetic disorder caused by A. chromosome deletion. B. chromosome translocation. C. a recessive allele. D. a frame shift mutation. 11. Triple X syndrome, or trisomy X, occurs when a female has an extra X chromosome in each of her cells. This results when the mother's reproductive cells divide improperly, and two X chromosome are moved into one gamete. When that gamete is fertilized and the father's DNA and X chromosome are combined with the mother's, that gives the cell three X chromosomes instead of two. Triple X syndrome occurs because of. A. deletions B. crossing over C. point mutations D. nondisjunction 12. Technology Enhanced Questions are not available in Word format. 13. During meiosis, the process of crossing over results in new combinations of alleles because A. genetic material always mutates randomly during this process. B. genetic material is added by a third chromosome during this process. C. genetic material is removed during this process. D. genetic material is exchanged between chromosomes during this process.

7 14. Organisms are able to reproduce either sexually or asexually. Which of the following statements is true of these reproductive processes? The sorting of genes during sexual reproduction results in a large amount of genetic variation. A. During every cell division in sexual reproduction, the number of chromosomes is reduced by half. B. During every cell division in asexual reproduction, the number of chromosomes is reduced by half. C. The sorting of genes during asexual reproduction results in a large amount of genetic variation. D. 15. The diagram below illustrates a process that can occur during cell division and results in an alteration in the composition of a chromosome. Each letter in the diagram represents a specific gene on the chromosome. The diagram shows that a section of the chromosome was broken out and reinserted backwards. This is known as A. chromosome translocation. B. chromosome insertion. C. chromosome inversion. D. chromosome deletion.

8 16. The diagram below shows a process that can result in the alteration of the composition of chromosomes. A piece of each chromosome in the diagram has broken off and been reattached to the other chromosome, resulting in an exchange. The process that occurs when a section of a chromosome breaks off and reattaches to another chromosome is known as. A. chromosome nondisjunction B. chromosome deletion C. chromosome inversion D. chromosome translocation 17. A genetic mutation that causes a codon that should code for a specific amino acid to be changed into a stop codon results in a shortened protein product and is known as A. a frame shift mutation. B. a silent mutation. C. a nonsense mutation. D. a chromosomal mutation. 18. Technology Enhanced Questions are not available in Word format.

9 Disease Characteristics Cause Cri-du-chat Syndrome (Cry of the Cat) improperly developed larynx babies cry like distressed cats severe mental retardation small round faces small cranium deletion of parts of chromosome 5 Edward's Syndrome (Trisomy 18) severe mental retardation elongated skull very narrow pelvis feet with round bottoms two central fingers grasped by thumb and little finger death in early infancy extra chromosome 18 Down Syndome (Trisomy 21) mild to severe retardation short height broad hands stubby fingers and toes round face large protruding tongue speech difficulties extra chromosome 21 Down Syndrome (14-21 Translocation) same as Trisomy 21 extra chromosome 21 attached to chromosome 14 Turner's Syndrome (XO) female appearance infertility lack of a second sex chromosome Klinefelter's Syndrome (XXY) female characteristics infertility extra X chromosome 19. A cat's coloring is mostly determined by genes on their X chromosomes, which contain alleles for colors, such as black, orange, gray, and cream. The allele for white fur is located on a different gene.calico cats, by definition, must display three different colors in their fur - white plus two of the other colors. This is easily possible in female cats, because females normally possess two X chromosomes. However, this occurs rarely in male cats, because males typically possess only one X chromosome plus one Y chromosome.what must be the genetic make-up of a male calico cat, and what type of chromosome disorder does this most resemble? A. XO, Turner's syndrome B. XX, Down's syndrome C. XYY, Cri-du-chat syndrome D. XXY, Klinefelter's syndrome 20. Errors that are made during DNA replication may result in

10 A. a viral infection. B. mutations. C. identical twins. D. radioactive decay. 21. Technology Enhanced Questions are not available in Word format. 22. A genetic mutation that does not result in a change in the amino acid sequence of the resulting protein is called A. a silent mutation. B. a frame shift mutation. C. a nonsense mutation. D. a chromosomal mutation.

11 The table below shows various DNA codons and their corresponding amino acids. Amino Acid DNA Codon(s) Alanine GCT, GCC, GCA, GCG Arginine AGA, AGG, CGT, CGC, CGA, CGG Asparagine AAT, AAC Aspartic Acid GAT, GAC Cysteine TGT, TGC Glutamic Acid GAA, GAG Glutamine CAA, CAG Glycine GGT, GGC, GGA, GGG Histadine CAT, CAC Isoleucine ATT, ATC, ATA Leucine CTT, CTC, CTA, CTG, TTA, TTG Lysine AAA, AAG Methionine (Start) ATG Phenylalanine TTT, TTC Proline CCT, CCC, CCA, CCG Serine TCT, TCC, TCA, TCG, AGT, AGC Threonine ACT, ACC, ACA, ACG Tryptophan TGG Tyrosine TAT, TAC Valine GTT, GTC, GTA, GTG Stop TAA, TAG, TGA 23. In the DNA strand below, two nucleotides were reversed during replication. What will happen when the replicated DNA strand is translated into proteins? A. No proteins will be formed at all. B. Nothing will happen. C. The same protein, isoleucine, will be formed. D. Tyrosine will be formed instead of isoleucine.

12 24. An organism's genotype describes its specific combination of alleles. For example, an Aa genotype is heterozygous for the A allele. An organism's phenotype describes a visible trait, such as tall height, brown eyes, or black fur. How does genotypic variation occur? Genotypic variation occurs when alleles are randomly sorted during asexual reproduction. A. Genotypic variation occurs when alleles are randomly sorted during sexual reproduction. B. Genotypic variation only occurs when genetic mutations occur. C. Genotypic variation only occurs during binary fission. D.

13 25. The chart below shows the codons that make up the genetic code and the sequence of nucleotides that corresponds to them. A mistake during DNA replication leads to a mutation in the nucleotide sequence shown below. What kind of mutation will result from the mistake made during DNA replication in the nucleotide sequence above? A. nonsense mutation B. silent mutation C. frame shift mutation D. chromosomal mutation

14 26. When environmental conditions change, it is more likely that at least some members of a species will survive if A. the species reproduces asexually. B. the members are genetically identical. C. there is variation among the members. D. the species requires very specific environmental conditions. 27. During meiosis, homologous chromosomes frequently exchange portions of their DNA. This process increases the number of different genotypes that an offspring can inherit. What is the name of this process? A. genetic transfer B. transduction C. crossing-over D. mutation 28. During normal meiosis, homologous chromosomes pair up and separate so that each gamete receives a copy of every chromosome. Sometimes an error is made during this separation and homologous chromosomes fail to separate. This results in one gamete that has two copies of the chromosome, and another gamete that does not have the chromosome at all. This type of error is known as and usually results in zygotes that either do not develop to term or have severe abnormalities. A. chromosome translocation B. chromosome insertion C. chromosome inversion D. chromosome nondisjunction

15 29. is a source of genetic variation that involves the swapping of sections of chromosomes during meiosis. A. Fertilization B. Transcription C. Translation D. Crossing over 30. Technology Enhanced Questions are not available in Word format. Answers 1. D 2. D 3. B 4. C 5. D 6. B 7. B 8. D 9. B 10. B 11. D D 14. A 15. C 16. D 17. C D 20. B A 23. D 24. B 25. B 26. C 27. C 28. D 29. D Explanations 1. In the diagram, segments of DNA from homologous chromosomes are crossing over. This process, which occurs during Prophase I of meiosis, happens randomly and frequently. In fact, it can even occur at more than one place along the same chromosome. Meiosis and crossing-over are important processes because they contribute to the genetic variation found in organisms that undergo sexual reproduction.

16 2. Frame shift mutations cause the reading frame of the sequence to be shifted. Since a codon is a sequence of three nucleotides that code for a specific amino acid, any insertion or deletion that is not a sequence of three causes a frame shift mutation. Insertions or deletions in multiples of 3 will cause a protein to be shorter or longer than normal, but the entire sequence of the amino acids will not be shifted. 3. A mutation (substitution, insertion, deletion, etc.) can cause changes in the phenotype of an organism. These changes may be beneficial and produce organisms that are better suited to their environments, or they may be detrimental. However, in some cases, there is no effect, and a change of phenotype does not occur. If a mutation occurs that does not dramatically change the DNA sequence, it is possible that it can be translated properly into proteins. In this example, the substituted nucleotide provides the same directions as the original nucleotide. This occurs when one nucleotide is replaced with another, but the resulting nucleotide group (codon) still codes for the same protein. If the protein that is made is the same as it would normally be, the mutation is called a silent mutation, and the organism's phenotype will be normal. 4. In sexually-reproducing organisms, meiosis helps contribute to genetic variation. Meiosis is the process by which sexually-reproducing organisms produce gametes, or sex cells. Meiosis produces gametes that are unique from each other and from the "parent genome". The gametes will be passed on to future offspring. 5. Many factors can cause a change in a gene over time. However, most heritable differences are due to gene shuffling that occurs during the production of gametes. Gametes are produced when cells undergo meiosis. Mutations or changes in DNA sequences can occur spontaneously, but this happens infrequently. 6. As shown in the chart, UGU codes for cysteine (Cys), but the mutated mrna codon, UGA, is a stop codon, which signals the end of transcription. This is a nonsense mutation, which is a mutation that changes a codon that codes for a specific amino acid into a stop codon. If the mutation occurs during DNA replication, the mrna strand that is produced will result in a shortened protein product. The earlier in a nucleotide sequence that this mutation occurs, the shorter the resulting protein will be. 7. Frame shift mutations cause the reading frame of the sequence to be shifted. Since a codon is a sequence of three nucleotides that code for a specific amino acid, any insertion or deletion that is not a sequence of three causes a frame shift mutation. Therefore, the insertion or deletion of 2 nucleotides would cause a frame shift mutation. Insertions or deletions in multiples of 3 will cause a protein to be shorter or longer than normal, but the entire sequence of the amino acids will not be shifted. 8. A mutation is a random change in a cell's genetic code due to a variety of causes. The change can be small and insignificant, or it can be major. Mutations can be passed on to offspring through reproduction, thus increasing the genetic variation within a population. 9. Farmers can enhance the genotypic variety of their crops by crossing crops with very different characteristics, resulting in new combinations of alleles. This genotypic variety will result in phenotypic variety. 10. Chromosome translocation is caused when material is exchanged between two chromosomes or part of one chromosome becomes fused onto another chromosome. Some human disorders are caused by chromosome translocation, such as cancer, infertility, and translocation Down syndrome.

17 Translocation Down syndrome is caused by a piece of chromosome 21 fusing onto another chromosome. It accounts for less than 5% of the total cases of Down syndrome reported. 11. Syndromes such as triple X syndrome, Turner's syndrome, Down syndrome, and Klinefelter's syndrome occur because of nondisjunction, or the improper separation of the chromosomes during division. In each of these cases, an extra chromosome (X chromosome for triple X, chromosome 21 for Down syndrome, etc.) causes symptoms in the offspring. In some syndromes, such as triple X syndrome, the symptoms are often not very noticeable During meiosis, the process of crossing over results in new combinations of alleles because genetic material is exchanged between homologous chromosomes during this process. When crossing over occurs, different parts of chromosomes are exchanged, meaning that genes (and their alleles) are transferred to new chromosomes. When meiosis separates these chromosomes, the new combination of alleles is transferred to the offspring, resulting in a new combination of traits. 14. Binary fission, budding, and spore formation are all examples of asexual reproduction. This form of reproduction is prevalent among single-celled organisms and some plants and fungi. Although asexual reproduction is faster and requires less energy than sexual reproduction, offspring are almost always genetically identical to their parents; there is little to no genetic variation. Sexual reproduction requires the formation of gametes (e.g. sperm and egg) during the process of meiosis. The advantage of sexual reproduction is that a great variety of possible gene combinations can be produced in the offspring of any two parents. This variety is due to the sorting and recombination of genes that occurs during meiosis. 15. Chromosome inversion occurs when a section of the chromosome breaks out and is reinserted backwards. Inversions usually do not cause physical or mental abnormalities in an individual as long as no genetic information is lost during the inversion. 16. Chromosome translocation occurs when a section of a chromosome breaks off and is added to a different chromosome. The type of chromosome translocation shown in the diagram is known as reciprocal translocation, which involves the exchange of material between two chromosomes. Reciprocal translocations are the most common type of translocation and do not result in a loss of genetic information. 17. A nonsense mutation is a mutation that changes a codon that codes for a specific amino acid into a stop codon. This results in a shortened protein product. The earlier in a nucleotide sequence that this mutation occurs, the shorter the resulting protein will be As mentioned in the question, a calico pattern can only result if a cat has two X chromosomes, but in order for a cat to be male, it must also possess a Y chromosome. So, a male calico cat must have XXY chromosomes. This pattern is also possessed by humans with Klinefelter's syndrome. 20. Errors that are made during DNA replication may result in mutations. Mutations are a source of variation within species. Some mutations are harmless, while others may be harmful to an organism

18 22. A silent mutation is a mutation that does not result in a change in the amino acid sequence of the resulting protein. Most amino acids are coded by several different codon sequences. Therefore, a mutation can occur that changes the nucleotide sequence, but does not change the resulting amino acid. These mutations are referred to as silent because they do not change the product of protein translation and cannot be detected without sequencing the gene. 23. If two or more nucleotides are reversed, it is possible for the same protein to be translated, or a different protein may be translated. In this case, ATT codes for isoleucine, whereas TAT codes for tyrosine. So, tyrosine will be formed instead of isoleucine. If the T in the 5th position and the T in the 6th position had been reversed, however, the same codon (ATT) would have resulted, and the same protein would have been translated. When a mutation occurs that does not affect the amino acid sequence of a protein, it is known as a silent mutation. 24. Genotypic variation occurs when alleles are randomly sorted during sexual reproduction. Since each offspring receives a different combination of alleles from the parent organisms, phenotypic diversity results. Genotypic and phenotypic traits can be predicted using Punnett squares. 25. As shown on the chart, both CCU and CCC code for proline (Pro). This means that the mistake made during DNA replication in the nucleotide sequence in the question will result in a silent mutation, which is a mutation that does not result in a change in the amino acid sequence of the resulting protein. Most amino acids are coded by several different codon sequences. Therefore, a mutation can occur that changes the nucleotide sequence, but does not change the resulting amino acid. These mutations are referred to as silent because they do not change the product of protein translation and cannot be detected without sequencing the gene. 26. When environmental conditions change, it is more likely that at least some members of a species will survive if there is variation among the members. This is because the variant organisms within the species are able to respond differently to the environmental changes. 27. Crossing-over is a process that typically occurs during prophase I of meiosis. During this phase, homologous chromosomes are held tightly together which enables the exchange of segments of DNA. Crossing-over is an important process because it introduces more genetic variation into a species. 28. Chromosome nondisjunction occurs when homologous chromosomes fail to separate during meiosis. The result of chromosome nondisjuction is the formation of one gamete that does not have the chromosome and another gamete that has two copies of the chromosome. Zygotes that have a gamete lacking a chromosome usually do not develop to term. Zygotes that have a gamete with two copies of a chromosome, along with a normal gamete, have a total of three copies of a chromosome and sometimes do develop, although they often have severe abnormalities. Examples of genetic conditions caused by the presence of three chromosomes (also known as a trisomy) include triple X syndrome, Turner's syndrome, Down syndrome, and Klinefelter's syndrome. 29. Crossing over, which occurs in prophase I of meiosis, is a process by which homologous chromosomes swap homologous segments of DNA. This helps produce gametes that are unique from the "parent genome", thus increasing genetic variation

DNA and Protein Synthesis Grade 10

DNA and Protein Synthesis Grade 10 Ohio Standards Connection: Life Sciences Benchmark C Explain the genetic mechanisms and molecular basis of inheritance. Indicator 5 Illustrate the relationship of the structure and function of DNA to protein

More information

Determining the Traits of a Mystery Organism Through Protein Synthesis

Determining the Traits of a Mystery Organism Through Protein Synthesis Determining the Traits of a Mystery Organism Through Protein Synthesis Introduction: Genes determine what characteristics an organism will have. Genes are segments of DNA molecules that are the instructions

More information

PROTEIN SYNTHESIS MAKES SENSE!

PROTEIN SYNTHESIS MAKES SENSE! PROTEIN SYNTHESIS MAKES SENSE! Anita Gordon Modified by: Marianne Dobrovolny Purpose: To help students understand the role of DNA, mrna, trna, and amino acids in the process of protein synthesis. This

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:

More information

PROTEIN SYNTHESIS MAKES SENSE!

PROTEIN SYNTHESIS MAKES SENSE! PROTEIN SYNTHESIS MAKES SENSE! Anita Gordon Modified by: Marianne Dobrovolny Purpose: To help students understand the role of DNA, mrna, trna, and amino acids in the process of protein synthesis. This

More information

(http://genomes.urv.es/caical) TUTORIAL. (July 2006)

(http://genomes.urv.es/caical) TUTORIAL. (July 2006) (http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA

More information

Unit 6 Cell Growth and Reproduction

Unit 6 Cell Growth and Reproduction Unit 6 Cell Growth and Reproduction Standards Addressed BIO B.1.1.1.Describe the events that occur during the cell cycle: interphase, nuclear division (i.e. mitosis or meiosis), cytokinesis. BIO B.1.1.2.Compare

More information

Supplemental Figure 1. Seedlings of Transgenic and Mutant Plants.

Supplemental Figure 1. Seedlings of Transgenic and Mutant Plants. Supplemental Figure 1. Seedlings of Transgenic and Mutant Plants. Supplemental Figure 2. Role of SPLs in Anthocyanin Accumulation. (A) Inflorescences of spl mutants. Scale bar represents 0.5 cm. (B) Close-ups

More information

Supplementary Materials. Molecular genetic analysis reveals that a nonribosomal peptide synthetase-like

Supplementary Materials. Molecular genetic analysis reveals that a nonribosomal peptide synthetase-like Supplementary Materials Molecular genetic analysis reveals that a nonribosomal peptide synthetase-like (NRPS-like) gene in Aspergillus nidulans is responsible for microperfuranone biosynthesis Applied

More information

Cell, Volume 166. Supplemental Information. Enhancer Control of Transcriptional Bursting. Takashi Fukaya, Bomyi Lim, and Michael Levine

Cell, Volume 166. Supplemental Information. Enhancer Control of Transcriptional Bursting. Takashi Fukaya, Bomyi Lim, and Michael Levine Cell, Volume 166 Supplemental Information Enhancer Control of Transcriptional Bursting Takashi Fukaya, Bomyi Lim, and Michael Levine Supplemental experimental procedures Expression Plasmids pbphi-multi

More information

Amino Acids. Radical. Lattimer, AST 248, Lecture 11 p.1/11

Amino Acids. Radical. Lattimer, AST 248, Lecture 11 p.1/11 Amino Acids + Radical Amino Acid Abbreviation # atoms Radical glycine gly (G) 10 H alanine ala (A) 13 CH 3 cysteine cys (C) 14 CH 3 S serine ser (S) 14 COH 3 aspartic acid asp (D) 15 C 2 H 2 O 2 asparagine

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:.

More information

HP22.1 Roth Random Primer Kit A für die RAPD-PCR

HP22.1 Roth Random Primer Kit A für die RAPD-PCR HP22.1 Roth Random Kit A für die RAPD-PCR Kit besteht aus 20 Einzelprimern, jeweils aufgeteilt auf 2 Reaktionsgefäße zu je 1,0 OD Achtung: Angaben beziehen sich jeweils auf ein Reaktionsgefäß! Sequenz

More information

Mutations & DNA Technology Worksheet

Mutations & DNA Technology Worksheet Mutations & DNA Technology Worksheet Name Section A: Mutations Mutations are changes in DNA. Somatic mutations occur in non-reproductive cells and won't be passed onto offspring. Mutations that occur in

More information

2. Describe (draw) the structure of a chromosome. Identify: DNA, proteins + a gene.

2. Describe (draw) the structure of a chromosome. Identify: DNA, proteins + a gene. Biology 12 DNA Functions Practice Exam - KEY A. DNA Structure 1. DNA is often called the "code of life". Actually it contains the code for a) the sequence of amino acids in a protein b) the sequence of

More information

Grundlagen der Bioinformatik, SS 08, D. Huson, April 21,

Grundlagen der Bioinformatik, SS 08, D. Huson, April 21, Grundlagen der Bioinformatik, SS 08, D. Huson, April 21, 2008 7 2 Introduction to Molecular Biology We will start with a very short repetition of the basics of molecular biology, including a summary of

More information

www.lessonplansinc.com Topic: Gene Mutations WS Summary: Students will learn about frame shift mutations and base substitution mutations. Goals & Objectives: Students will be able to demonstrate how mutations

More information

Protein Synthesis and Words (lesson/class activity) by Lynn Marie Wartski

Protein Synthesis and Words (lesson/class activity) by Lynn Marie Wartski Protein Synthesis and Words (lesson/class activity) by Lynn Marie Wartski Type of Activity: Hands-on, simulation, review/reinforcement, group/cooperative learning Target Audience: Life Science /Biology

More information

How to teach 3rd graders about DNA. David Sabatino

How to teach 3rd graders about DNA. David Sabatino How to teach 3rd graders about DNA David Sabatino A Fundamental Molecule of Life : DNA Objectives : 1) Provide background Information elementary students can understand 2) Test understanding by asking

More information

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations http://members.cox.net/amgough/mutation_chromosome_translocation.gif Introduction: In biology, mutations are changes to the base

More information

Beloit College BIOL Emerging Infectious Diseases

Beloit College BIOL Emerging Infectious Diseases Virus classification and life cycle activity For reference Transcription: Krasner p 131 Translation: Krasner p 132-135 Genetic code: Krasner p 135 A virus is an obligate intracellular parasite, meaning

More information

Chapter : DNA: The Molecule of Heredity

Chapter : DNA: The Molecule of Heredity 1 Chapter : DNA: The Molecule of Heredity DNA Deoxyribonucleic acid Is a type of nucleic acid What chromosomes (and genes) are made of Made up of repeating nucleotide subunits 1 nucleotide looks like:

More information

In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA.

In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA. In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA. For each student: Science notebook Reproducible Master 6, Cooking Up a Protein

More information

Base Quality Score Recalibra2on

Base Quality Score Recalibra2on talks Base Quality Score Recalibra2on Assigning accurate confidence scores to each sequenced base We are here in the Best Practices workflow Base Recalibra,on PURPOSE Real data is messy - > properly es2ma2ng

More information

DNA and Protein Synthesis Note Sheet

DNA and Protein Synthesis Note Sheet DNA and Protein Synthesis Note Sheet DNA = Molecule of heredity Deoxyribonucleic acid Type of nucleic acid (1 of the 4 macromolecules) What chromosomes (and genes) are made of Made up of repeating nucleotide

More information

Genetics. Mendel and Meiosis. DNA and Genes. Patterns of Heredity and Human Genetics. Genetic Technology

Genetics. Mendel and Meiosis. DNA and Genes. Patterns of Heredity and Human Genetics. Genetic Technology Genetics Mendel and Meiosis DNA and Genes Patterns of Heredity and Human Genetics Genetic Technology Chapter 11 DNA and Genes 11.1: DNA: The Molecule of Heredity 11.1: Section Check 11.2: From DNA to Protein

More information

SUPPLEMENTAL MATERIAL

SUPPLEMENTAL MATERIAL SUPPLEMENTAL MATERIAL SUPPLEMENTAL METHODS Measurement of mrna expression levels by quantitative RT-PCR. Following primer sequences were used for real-time PCR: The primer sequences were as followed: TNF-α

More information

Biology Advanced Unit 4: The Natural Environment and Species Survival

Biology Advanced Unit 4: The Natural Environment and Species Survival Write your name here Surname Other names Edexcel GCE Centre Number Candidate Number Biology Advanced Unit 4: The Natural Environment and Species Survival Tuesday 11 June 2013 Morning Time: 1 hour 30 minutes

More information

Urban et al., http ://www.jcb.org /cgi /content /full /jcb /DC1

Urban et al., http ://www.jcb.org /cgi /content /full /jcb /DC1 Supplemental material JCB Urban et al., http ://www.jcb.org /cgi /content /full /jcb.201507099 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. Interaction between RECQ5 and RNA PI. (A) Reciprocal coimmunoprecipitation

More information

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core DNA Sequencing Services Pre-Mixed o Provide template and primer, mixed into the same tube* Pre-Defined o Provide template and primer in separate tubes* Custom o Full-service for samples with unknown concentration

More information

Genetics fill in review

Genetics fill in review Genetics fill in review Completion Complete each sentence or statement. 1. A reproductive process in which fertilization occurs within a single plant is 2. The transferring of pollen between plants is

More information

List of Primers PRIMERS.DOCX 1 /

List of Primers PRIMERS.DOCX 1 / List of Primers petm11/24 REV CAGCAGCCAACTCAGC Vladimir Benes Custom Primer GEMHE_Rev1 5' CACTTTATGCTTCCGGCTCG 3' Sequence found 3' of pgemhe linearization cassette GEMHE_Rev2 5' GAGCAGATACGAATGGCTAC 3'

More information

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct

More information

Exercise- Genetics. 1. Which of the following statements is true of mitosis but not of meiosis?

Exercise- Genetics. 1. Which of the following statements is true of mitosis but not of meiosis? Exercise- Genetics 1. Which of the following statements is true of mitosis but not of meiosis? A. The chromosome number is halved. B. Pairing of homologous chromosome occurs. C. Produces genetic variations.

More information

Section 1 Workbook (unit 2) ANSWERS

Section 1 Workbook (unit 2) ANSWERS Section 1 Workbook (unit 2) ANSWERS Complete the following table: nucleotide DNA RN Name: B5. Describe DNA replication 1) Label each base given in the diagram below and describe the 4 primary characteristics

More information

Chapter 15: The Chromosomal Basis of Inheritance

Chapter 15: The Chromosomal Basis of Inheritance Name Period Chapter 15: The Chromosomal Basis of Inheritance Concept 15.1 Mendelian inheritance has its physical basis in the behavior of chromosomes 1. What is the chromosome theory of inheritance? The

More information

Just One Nucleotide! Exploring the Effects of Random Single Nucleotide Mutations

Just One Nucleotide! Exploring the Effects of Random Single Nucleotide Mutations Just One Nucleotide! Exploring the Effects of Random Single Nucleotide Mutations By Beatriz Gonzalez beatriz.gonzalez@sfcollege.edu Associate Professor, Santa Fe College, Gainesville, Florida In this exercise,

More information

codon, p. 243 that question, but consider the possibilities. If one nucleotide coded for

codon, p. 243 that question, but consider the possibilities. If one nucleotide coded for 8.5 Translation KEY CONCEPT Translation converts an mrna message into a polypeptide, or protein. MAIN IDEAS Amino acids are coded by mrna base sequences. Amino acids are linked to become a protein. VOCABULARY

More information

DNA & RNA. Chapter 10

DNA & RNA. Chapter 10 DNA & RNA Chapter 10 DNA Deoxyribonucleic Acid RNA Ribonucleic Acid Where does DNA live? The NUCLEUS! Why is DNA so Important? * DNA is a nucleic acid that contains the genetic information used in the

More information

Hands on Simulation of Mutation

Hands on Simulation of Mutation Hands on Simulation of Mutation Charlotte K. Omoto P.O. Box 644236 Washington State University Pullman, WA 99164-4236 omoto@wsu.edu ABSTRACT This exercise is a hands-on simulation of mutations and their

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Zhang L, Conejo-Garcia JR, Katsaros D, et al., Recurrence,

More information

Week 5 EOC Review DNA, Mitosis, Meiosis, and Genetics

Week 5 EOC Review DNA, Mitosis, Meiosis, and Genetics Week 5 EOC Review DNA, Mitosis, Meiosis, and Genetics Benchmarks: SC.912.L.16.3 Describe the basic process of DNA replication and how it relates to the transmission and conservation of the genetic information

More information

Asexual - in this case, chromosomes come from a single parent. The text makes the point that you are not exact copies of your parents.

Asexual - in this case, chromosomes come from a single parent. The text makes the point that you are not exact copies of your parents. Meiosis The main reason we have meiosis is for sexual reproduction. It mixes up our genes (more on that later). But before we start to investigate this, let's talk a bit about reproduction in general:

More information

Learning Target 1: I can describe the basic process of meiosis. Prophase I - Metaphase I - Anaphase I - Telophase I - Cytokinesis - Prophase II -

Learning Target 1: I can describe the basic process of meiosis. Prophase I - Metaphase I - Anaphase I - Telophase I - Cytokinesis - Prophase II - 2 nd 9 Weeks Study Guide! Aren t you excited?? Chapter 10 Learning Target 1: I can describe the basic process of meiosis Remembering meiosis: Meiosis I: interphase - Prophase I - Metaphase I - Anaphase

More information

Bioinformatics Methods

Bioinformatics Methods BINF630/BIOL580/BINF401 Bioinformatics Methods Iosif Vaisman Email: ivaisman@gmu.edu Major focus areas Informatics infrastructure DNA and protein sequence analysis and genomics Protein structure and function

More information

Bio EOC Topics for Cell Reproduction: Bio EOC Questions for Cell Reproduction:

Bio EOC Topics for Cell Reproduction: Bio EOC Questions for Cell Reproduction: Bio EOC Topics for Cell Reproduction: Asexual vs. sexual reproduction Mitosis steps, diagrams, purpose o Interphase, Prophase, Metaphase, Anaphase, Telophase, Cytokinesis Meiosis steps, diagrams, purpose

More information

Supplemental Table 1. Primer sequences of rat genes probed in RT-PCR assays. Reverse primer. (5 to 3 ) CGA AAG TGT CA TTG T AGG CA CAC ATG T ACA TTT

Supplemental Table 1. Primer sequences of rat genes probed in RT-PCR assays. Reverse primer. (5 to 3 ) CGA AAG TGT CA TTG T AGG CA CAC ATG T ACA TTT Supplemental Table 1. Primer sequences of rat genes probed in RT-PCR assays. Gene Forward primer Reverse primer Ref (5 to 3 ) (5 to 3 ) Ppia CAC CGT GTT CTT CGA CCA GTG CTC AGA GCA (1) CAT CAC CGA AAG

More information

REVIEW 5: GENETICS. a. Humans have chromosomes, or homologous pairs. homologous:

REVIEW 5: GENETICS. a. Humans have chromosomes, or homologous pairs. homologous: Name: 1. Chromosomes: REVIEW 5: GENETICS a. Humans have chromosomes, or homologous pairs. homologous: b. Chromosome pairs carry genes for the same traits. Most organisms have two copies of the! gene for

More information

Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook)

Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook) Name Date Per Look at the diagrams, then answer the questions. Gene Mutations affect a single gene by changing its base sequence, resulting in an incorrect, or nonfunctional, protein being made. (a) A

More information

Ch. 15: Chromosomal Abnormalities

Ch. 15: Chromosomal Abnormalities Ch 15: Chromosomal Abnormalities Abnormalities in Chromosomal Number Abnormalities in Chromosomal Structure: Rearrangements Fragile Sites Define: nondisjunction polyploidy aneupoidy trisomy monosomy Abnormalities

More information

Multiple Choice Identify the letter of the choice that best completes the statement or answers the question.

Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. Human Heredity Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. The X and Y chromosomes are called the a. extra chromosomes. b. phenotypes.

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

Protein Synthesis RNA and the Genetic Code

Protein Synthesis RNA and the Genetic Code Chapter 17 Protein Synthesis Nucleic Acids and 17.4 RNA and the Genetic Code 1 RNA RNA transmits information from DNA to make proteins. has several types Messenger RNA (mrna) carries genetic information

More information

To measure the expression and regulation of the srfa and myc operons, lacz-reporter gene

To measure the expression and regulation of the srfa and myc operons, lacz-reporter gene SUPPLEMENTAL MATERIAL 1 1 1 1 1 0 1 Construction of reporter gene fusions To measure the expression and regulation of the srfa and myc operons, lacz-reporter gene fusions were made. For this the plasmid

More information

The correct answer is c A. Answer a is incorrect. The white-eye gene must be recessive since heterozygous females have red eyes.

The correct answer is c A. Answer a is incorrect. The white-eye gene must be recessive since heterozygous females have red eyes. 1. Why is the white-eye phenotype always observed in males carrying the white-eye allele? a. Because the trait is dominant b. Because the trait is recessive c. Because the allele is located on the X chromosome

More information

Mutations. Section 6.3

Mutations. Section 6.3 Section 6.3 Mutations Objectives Identify different changes to DNA within both genes and chromosomes Evaluate effects of changes to DNA on proteins produced and organisms overall survival New Vocabulary

More information

Table S1. Related to Figure 4

Table S1. Related to Figure 4 Table S1. Related to Figure 4 Final Diagnosis Age PMD Control Control 61 15 Control 67 6 Control 68 10 Control 49 15 AR-PD PD 62 15 PD 65 4 PD 52 18 PD 68 10 AR-PD cingulate cortex used for immunoblot

More information

Genetic code The language of nucleic acids: letters and words (nucleotides and codons) Initiation and termination codons of translation

Genetic code The language of nucleic acids: letters and words (nucleotides and codons) Initiation and termination codons of translation Molecular Biology: From DNA to Protein (cont d) Transcription Purpose and sub-cellular compartment. Steps of transcription and the bio-molecules involved. Terminology: promoter and terminator DNA sequences

More information

MCC Biology Test Ch 9-12

MCC Biology Test Ch 9-12 Class: Date: MCC Biology Test 3 2014 Ch 9-12 Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. As a cell becomes larger, its a. volume increases

More information

10/24/2013. Meiosis and Crossing Over

10/24/2013. Meiosis and Crossing Over Meiosis and Crossing Over In diploid organisms, somatic cells (non-sex-cells), have pairs of homologous chromosomes. Homologous chromosomes share shape and genetic loci, and carry genes that carry the

More information

Genetic Disorders. Galactosemia Caused by autosomal recessive allele

Genetic Disorders. Galactosemia Caused by autosomal recessive allele Genetic Disorders - Autosomal Genetic Disorders - X-Linked Inheritance - Tracking Traits With Pedigrees - Changes in Chromosome Structure - Aberrations in Chromosomal Sets: Polyploidy - Incorrect Chromosome

More information

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors.

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. Legends of supplemental figures and tables Figure 1: Overview of study design and results. (A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. After raw data gene expression

More information

Genetics Notes: Chromosomes and Karyotypes

Genetics Notes: Chromosomes and Karyotypes Name: Per: Date: Genetics Notes: Chromosomes and Karyotypes Chromosome Number All cells in the human body ( ) have or of chromosomes Called the or number (eggs & sperm) have only chromosomes Called the

More information

BLAST & Database Search

BLAST & Database Search 6.096 Algorithms for Computational Biology Lecture 2 BLAST & Database Search Manolis Kellis Piotr Indyk In Previous Lecture 1 Gene Finding DNA 2 Sequence alignment 3 Database lookup BLAST and Database

More information

BioBoot Camp Genetics

BioBoot Camp Genetics BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before

More information

Biology Ch 14 Human Genetics (14.1)

Biology Ch 14 Human Genetics (14.1) Biology Ch 14 Human Genetics (14.1) For Questions 1 7, write the letter of the correct answer on the line at the left. 1. The complete set of genetic information an organism carries in its DNA is its A.

More information

B-4.6 Predict inherited traits by using the principles of Mendelian genetics (including segregation, independent assortment, and dominance).

B-4.6 Predict inherited traits by using the principles of Mendelian genetics (including segregation, independent assortment, and dominance). B-4.6 Predict inherited traits by using the principles of Mendelian genetics (including segregation, independent assortment, and dominance). - Genes control each trait of a living thing by controlling

More information

DNA, Inheritance, and Genetic Variation. Crazy. Chromosomes. Real Investigations in Science and Engineering

DNA, Inheritance, and Genetic Variation. Crazy. Chromosomes. Real Investigations in Science and Engineering Crazy DNA, Inheritance, and Genetic Variation Real Investigations in Science and Engineering A1 A2 A3 Overview Chart for Investigations Crazy DNA Structure Pages 1 6 Genes and Pages 7 12 Creature Genome

More information

Mitosis & Meiosis Practice Test. 4. Which is the correct sequence for the stages of mitotic cell division represented by the diagrams shown?

Mitosis & Meiosis Practice Test. 4. Which is the correct sequence for the stages of mitotic cell division represented by the diagrams shown? 1. The diagram shown represents a cell that will undergo mitosis. Which diagrams below best illustrate the nuclei of the daughter cells that result from a normal mitotic cell division of the parent cell

More information

Nondisjunction. Chromosomes may fail to separate during meiosis Resulting gametes may have too few or too many chromosomes Common Disorders:

Nondisjunction. Chromosomes may fail to separate during meiosis Resulting gametes may have too few or too many chromosomes Common Disorders: 1 Chromosomes 2 Chromosome Number All cells in the human body (SOMATIC CELLS) have 46 or 23 pairs of chromosomes Called the DIPLOID or 2n number GAMETES (eggs & sperm) have only 23 chromosomes Called the

More information

UNIT 3: Genetics Chapter 6: Meiosis and Mendel

UNIT 3: Genetics Chapter 6: Meiosis and Mendel CORNELL NOTES Directions: You must create a minimum of 5 questions in this column per page (average). Use these to study your notes and prepare for tests and quizzes. Notes will be stamped after each assigned

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Llères et al., http://www.jcb.org/cgi/content/full/jcb.200907029/dc1 Figure S1. Structural model organization of a nucleosome core particle

More information

Sequence comparison, Part I: Substitution and Scores

Sequence comparison, Part I: Substitution and Scores Sequence comparison, Part I: Substitution and Scores David H. Ardell Docent of Bioinformatics Outline of the lecture Convergence and Divergence Similarity and Homology Percent Difference as Evolutionary

More information

meiosis and heredity Multiple Choice Identify the choice that best completes the statement or answers the question.

meiosis and heredity Multiple Choice Identify the choice that best completes the statement or answers the question. meiosis and heredity Multiple Choice Identify the choice that best completes the statement or answers the question. 1. The advantage of sexual reproduction over asexual reproduction is a. sexual reproduction

More information

The Leucine Binding Proteins of Escherichia coli as Models for Studying the Relationships Between Protein Structure and Function

The Leucine Binding Proteins of Escherichia coli as Models for Studying the Relationships Between Protein Structure and Function Journal of Cellular Biochemistry 29:209-216 (1985) Protein Structure, Folding, and Design 39-46 The Leucine Binding Proteins of Escherichia coli as Models for Studying the Relationships Between Protein

More information

Mendel's findings were made between 1853 and In those days, nothing was known about chromosomes or genes or meiosis.

Mendel's findings were made between 1853 and In those days, nothing was known about chromosomes or genes or meiosis. Mendel's findings were made between 1853 and 1861. In those days, nothing was known about chromosomes or genes or meiosis. He had concluded: each trait is governed by two factors the factors segregate

More information

Meiosis & Genetics Unit Review Guide YMartinez

Meiosis & Genetics Unit Review Guide YMartinez Meiosis & Genetics Unit Review Guide 2011 YMartinez MEIOSIS 1. Chromosome: 1. Chromosome threadlike strands made of DNA and PROTEIN 2. Homologous Chromosome: 2. Homologous Chromosome: chromosomes that

More information

Cell Cycle, Chromosomes, Mitosis & Meiosis Test Study Guide Key

Cell Cycle, Chromosomes, Mitosis & Meiosis Test Study Guide Key Cell Cycle, Chromosomes, Mitosis & Meiosis Test Study Guide Key DNA 1. a. What is DNA? - DNA stores and encodes all of the information in an organism, such as which proteins to make, and how to make them.

More information

1 «. XXI (... ),, 2006,.216-250 ( )... petoukhov@hotmail.com, http://www.petoukhov.narod.ru,, ( ),..,,,.,,,.. Genbank : «,?,,.,,,.» [, 1999,. 14]..,..,,,.., -, (, ),.,,,,., 2,.,.,..,.,..,,..,,.,,,.,,,..,,,

More information

Python course in Bioinformatics

Python course in Bioinformatics March 31, 2009 Why Python? Scripting language, raplid applications Minimalistic syntax Powerful Flexiablel data structure Widely used in Bioinformatics, and many other domains Where to get Python and

More information

Unit 8.2: Human Inheritance

Unit 8.2: Human Inheritance Unit 8.2: Human Inheritance Lesson Objectives Describe inheritance in humans for autosomal and X-linked traits. Identify complex modes of human inheritance. Describe genetic disorders caused by mutations

More information

Chapter 15: The Chromosomal Basis of Inheritance

Chapter 15: The Chromosomal Basis of Inheritance Name Period Concept 15.1 Mendelian inheritance has its physical basis in the behavior of chromosomes 1. What is the chromosome theory of inheritance? 2. Explain the law of segregation. Use two different

More information

Chromosomes and Meiosis

Chromosomes and Meiosis Chromosomes and Meiosis Chromosomes are long, thread-like structures that form part of the chromatin network in the nuclei of cells. They are made up of a strand of DNA wound around histones (proteins).

More information

Genetics (20%) Sample Test Prep Questions

Genetics (20%) Sample Test Prep Questions Genetics (20%) Sample Test Prep Questions Grade 7 (2a Genetics) Students know the differences between the life cycles and reproduction methods of sexual and asexual organisms. (pg. 106 Science Framework)

More information

Meiosis and Sexual Life Cycles

Meiosis and Sexual Life Cycles Meiosis and Sexual Life Cycles Chapter 13 1 Ojectives Distinguish between the following terms: somatic cell and gamete; autosome and sex chromosomes; haploid and diploid. List the phases of meiosis I and

More information

Chapter 11~ The Basic Principles of Heredity

Chapter 11~ The Basic Principles of Heredity Chapter 11~ The Basic Principles of Heredity Mendelian genetics Character (heritable feature, i.e., fur color) Trait (variant for a character, i.e., brown) True-bred (all offspring of same variety) Hybridization

More information

DNA pol RNA pol ARS trna Ribosome DNA mrna Protein Transcription Translation Replication A B Acceptor stem D-loop T C loop Anticodon loop Variable loop Relative trna gene copy number 0.0 0.2 0.4

More information

14.1 Human Chromosomes

14.1 Human Chromosomes 14.1 Human Chromosomes Lesson Objectives Identify the types of human chromosomes in a karotype. Describe the patterns of the inheritance of human traits. Explain how pedigrees are used to study human traits.

More information

Chapter 9. Applications of probability. 9.1 The genetic code

Chapter 9. Applications of probability. 9.1 The genetic code Chapter 9 Applications of probability In this chapter we use the tools of elementary probability to investigate problems of several kinds. First, we study the language of life by focusing on the universal

More information

Chapter 8: The Cellular Basis of Reproduction and Inheritance

Chapter 8: The Cellular Basis of Reproduction and Inheritance Chapter 8: The Cellular Basis of Reproduction and Inheritance Introduction Stages of an Organism s Life Cycle: Development: All changes that occur from a fertilized egg or an initial cell to an adult organism.

More information

Practice Questions 1: Genetics

Practice Questions 1: Genetics Practice Questions 1: Genetics 1. In one variety of corn, the kernels turn red when exposed to sunlight. In the absence of sunlight, the kernels remain yellow. Based on this information, it can be concluded

More information

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C)

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C) TECHNICAL DATA SHEET BIOLUMINESCENCE RESONANCE ENERGY TRANSFER GFP 2 FUSION PROTEIN EXPRESSION VECTOR Product: Codon Humanized pgfp 2 -C Vectors Catalog number: Lot number: -001 Description: Amount: The

More information

Chapter 13: Meiosis & Sexual Life Cycles

Chapter 13: Meiosis & Sexual Life Cycles Chapter 13: Meiosis & Sexual Life Cycles What you must know The difference between asexual and sexual reproduction. The role of meiosis and fertilization in sexually reproducing organisms. The importance

More information

6/2/2015. (Sperm could also be XY)

6/2/2015. (Sperm could also be XY) Chapter 6 Genetics and Inheritance Sometimes there is not one clear dominant allele In a heterozygous individual, both alleles are expressed Phenotype is a blend of both traits Lecture 2: Genetics and

More information

Exon Primer name Sequence Amplicon size

Exon Primer name Sequence Amplicon size Supplementary Material PCR amplification of the BRCA2 gene The components of the PCR reaction were: 20mM Tris-HCl(pH8.4), 50mM KCl, 1.5mM MgCl 2, 0.1mM in each of datp, dctp, dgtp, TTP, 0.1µM of each primer,

More information

11.1 The Work of Gregor Mendel

11.1 The Work of Gregor Mendel 11.1 The Work of Gregor Mendel Lesson Objectives Describe Mendel s studies and conclusions about inheritance. Describe what happens during segregation. Lesson Summary The Experiments of Gregor Mendel The

More information

mutagen Somatic mutation Germ cell mutation A change in the DNA of an organism. Mutation Inversion Translocation deletion Non-disjunction Monosomy

mutagen Somatic mutation Germ cell mutation A change in the DNA of an organism. Mutation Inversion Translocation deletion Non-disjunction Monosomy Any substance that causes changes in the DNA of an organism. mutagen A change in the DNA of an organism which affects the body cells and cannot be passed down to offspring. A change in the DNA of an organism

More information

X Biology I. Unit 1-7: Genetics

X Biology I. Unit 1-7: Genetics NOTE/STUDY GUIDE: Unit 1-7, Genetics X Biology I, Mr. Doc Miller, M.Ed. North Central High School Name: ID#: NORTH CENTRAL HIGH SCHOOL NOTE & STUDY GUIDE X Biology I Unit 1-7: Genetics Additional resources

More information

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C)

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C) TECHNICAL DATA SHEET BIOLUMINESCENCE RESONANCE ENERGY TRANSFER RENILLA LUCIFERASE FUSION PROTEIN EXPRESSION VECTOR Product: prluc-c Vectors Catalog number: Description: Amount: The prluc-c vectors contain

More information