The p53 MUTATION HANDBOOK

Size: px
Start display at page:

Download "The p53 MUTATION HANDBOOK"

Transcription

1 The p MUTATION HANDBOOK Version 1. /7 Thierry Soussi Christophe Béroud, Dalil Hamroun Jean Michel Rubio Nevado

2 The p Mutation HandBook By T Soussi, J.M. Rubio-Nevado, D. Hamroun and C. Béroud What is the p Mutation HandBook? The p Mutation Handbook is a compilation of multiple analyses performed using information from the UMD p Mutation database Which release of the UMD TP database was used for these analyses? Except when otherwise specified, the curated version of the 7_R1 release of the UMD p mutation database was used. What is the difference between the curated and uncurated version of the p database? The curated version of the UMD TP database has been purged from artefactual data known to affect p mutation analysis. More information can be found on our website (http://p.free.fr/database/p_database.html) or in our recent publication (Soussi, T., Asselain, B., Hamroun, D., Kato, S., Ishioka, C., Claustres, M. and Beroud, C. () Meta-analysis of the p mutation database for mutant p biological activity reveals a methodological bias in mutation detection. Clin Cancer Res, 1, -9.) How were the various analyses performed? Using novel software, the entire UMD TP mutation database was automatically analyzed resulting in the p Mutation Handbook as output. What type of information can be found in the p Mutation HandBook? The p Mutation Handbook presents an analysis of TP mutation distribution and mutational events in the most frequent human cancers. It also contains helpful reference pages about the human p sequence and how each codon of the protein is mutated in human cancer. text accompanies the various analyses The p mutation handbook is not intended to be a manuscript. The handbook provides crude data and figures that are open for interpretation and/or discussion by anyone. Data / figures included in this handbook can

3 be used and reproduced freely by anyone as long as the reference to the p mutation handbook is indicated. What is the reference of the p Mutation HandBook? T Soussi, J.M. Rubio-Nevado, D. Hamroun and C. Béroud. The p Mutation handbook, available online; What is the audience for this handbook? Every scientist interested in p mutations or more globally in mutation analysis in human cancer. What if I need a specific analysis which is not included in this p Mutation handbook? Just send us an and, if your request is feasible, the analysis will be performed and added to the handbook. You can also make suggestions via our Forum (http://p.free.fr/forum) What is the future of the p Mutation HandBook? More analyses and novel information will be added to the next version. Stay tuned! Version tory 1.1 March 7 Modification of the CpG mutation analysis page 8 and 9 1. Release of the p Mutation HandBook, February 7

4 DNA substitution mutations are of two types. Transitions are interchanges of purines (A G) or of pyrimdines (C T), which therefore involve bases of similar shape. Transversions are interchanges between purine and pyrmidine bases, which therefore involve exchange of onering and two-ring structures. Although there are twice as many possible transversions, because of the molecular mechanisms by which they are generated, transition mutations occur at higher frequency than transversions p mutational events mutation at CpG 1 mutation outside CpG : transition : transversion Fr: frameshift mutation GC->AT AT->GC GC->CG GC->TA AT->CG AT->TA Fr. MUTATIONAL EVENTS Spectrum of p mutations in various types of tumors. A predominance of the GC->AT transition at the CpG dinucleotide (colon, ovary brain, or leukemia) is the consequence of spontaneous deamination of -methylcytosine. A high frequency of GC->TA transversion (Lung, Head and neck or HCC) is strongly indicative of exposure to exogenous carcinogens. CpG dinucleotide mutates at a high rate because cytosine is vulnerable to deamination. Cytosines in CpG dinucleotides are often methylated, and deamination of - methylcytosine (mc) produces thymidine. Deamination of unmethylated cytosine produces uracil (U), which can be removed by uracil glycosylase, but mc deamination generates thymine (T), which cannot be processed by this enzyme. The consequence in humans is that the mutation rate from mc to T is 1-fold to -fold higher than other transitions.

5 p CODON The human p protein consists of 9 amino acids with evolutionarily conserved domains (I to V). Domains II to V correspond to the DNA binding domain which is the target for p mutations. 9 % of p mutations occur in the central region which harbors four of the five highly conserved evolutionary domains. X-ray crystallography of p-dna complexes shows that this region is essential for the p-dna interaction [Cho, 199, #18]. However, this distribution might be slightly biased since most investigations have focused exclusively on this region of the p gene. More recent studies on all the coding exons (exons through 11) show that a considerable number of mutations are found in exons and 1. Mutations in exons -8 are significantly different from those found in exons, 9 (see exon distribution).

6 Distribution of p mutations in the various functional domains of p. The higher frequency of frameshift mutations between exon - and exon -8 domains is statistically significant (p<.1). Human p protein (Hp) can be divided into five domains, each corresponding to specific functions: i) The amino-terminus part 1- contains the acidic transactivation domain and the mdm protein binding site. It also contains the Highly Conserved Domain I (HCD I) (Yellow) II) Region -9 contains series repeated proline residues that are conserved in the majority of p. it also contains a second transactivation domain (Red). III) The central region (11-) contains the DNA binding domain. It is the target of 9% of p mutations found in human cancers. It contains HCD II to V (Blue). IV) The oligomerization domain (7-, TET) consists of a beta-strand, followed by an alpha-helix necessary for dimerization, as p is composed of a dimer of two dimers. A nuclear export signal (NES) is localized in this oligomerization domain (Green). V) The carboxy-terminus of p (-9) contains nuclear localization signals (NLS) and a non-specific DNA binding domain that binds to damaged DNA. This region is also involved in downregulation of DNA binding of the central domain.

7 p mutation frequency p MUTATION DATABASE ANALYSIS p mutant frequency % 8% 11% 1% % 7% % % 1% Hot spot mutations 1% Codon WT Codon Mutant Codon WT AA Mutant AA Type CpG File Qty 17 CGC CAC 11 CAG Gln 8 CAT TGT GGC AGC Gly Ser 9 AGG AGC Ser 9 TAT TGT Tyr 1 CGA TGA Stop 8 Exon distribution Exon - Exon 9-11 Exon -8 1% 1% 7% % % 1% 8% 1% % Frameshift nsense Missense

8 p MUTATION DATABASE ANALYSIS p mutation distribution p CODON p mutational events 1 mutation at CpG mutation outside CpG GC->AT AT->GC GC->CG GC->TA AT->CG AT->TA Fr. MUTATIONAL EVENTS

9 all 1 1 p MUTATION DATABASE ANALYSIS FREQUENCY OF GC->TA TRANSVERSION All hepatocellular carcinoma rectal ca. lung (sclc) ovarian carcinoma bladder carcinoma endometrial tumor head and neck scc pancreatic cancer gastric carcinoma none breast carcinoma lung (nsclc) prostate ca. glioblastoma astrocytoma b-chronic lymphocytic leukemia skin squamous cell carcinoma b-cell lymphoma li-fraumeni synd. basal cell carcinoma colorectal carcinoma osteosarcoma gliomas esophageal scc esophageal adc CANCER 7 FREQUENCY OF GC->AT TRANSITION pancreatic cancer astrocytoma glioblastoma gastric carcinoma hepatocellular carcinoma bladder carcinoma esophageal scc ovarian carcinoma head and neck scc lung (nsclc) breast carcinoma 1 osteosarcoma endometrial tumor gliomas skin squamous cell carcinoma lung (sclc) b-cell lymphoma prostate ca. basal cell carcinoma esophageal adc none li-fraumeni synd. colorectal carcinoma rectal ca. b-chronic lymphocytic leukemia mutation at CpG mutation outside CpG CANCER

10 p MUTATION DATABASE ANALYSIS UV INDUCED MUTATION IN SKIN CANCER TANDEM MUTATIONS 1 MUTATIONS AT Py-Py SITES Skin tumours Internal tumours Skin tumours Internal Tumours MUTATIONS AT DI-PYRIMIDINE SITES IN VARIOUS CANCER 1 8 AK BCC Melanoma Patches SCC XP Patients Breast ca. Colon ca.

11 BREAST CANCER p mutation frequency p mutant frequency % 9% 17% 1% % % 7% % 1% Hot spot mutations 8 7% Codon WT Codon Mutant Codon WT AA Mutant AA Type CpG File Qty 17 CGC CAC 1 CAG Gln 9 CAT 87 GGC AGC Gly Ser TAT TGT Tyr TGT 1 CGA TGA Stop 1 7 ATG ATA Met Ile Exon distribution EXON - EXON -8 EXON % 1% % 8% % % % 77% Frameshift nsense Missense %

12 BREAST CANCER p mutation distribution p CODON p mutational events 1 mutation at CpG mutation outside CpG GC->AT AT->GC GC->CG GC->TA AT->CG AT->TA Fr. MUTATIONAL EVENTS

13 CRC CANCER p mutation frequency p mutant frequency % 9% 1% 1% % 7% 7% % 1% Hot spot mutations 8 % Codon WT Codon Mutant Codon WT AA Mutant AA Type CpG File Qty 17 CGC CAC 18 CAG Gln CAT GGC AGC Gly Ser 117 TGT CGA TGA Stop 1 CGA TGA Stop 1 GGC GAC Gly Asp 8 Exon distribution EXON - EXON -8 EXON % % 9% 9% % % 1% 8% % Frameshift nsense Missense

14 CRC CANCER p mutation distribution p CODON p mutational events 7 mutation at CpG mutation outside CpG 1 GC->AT AT->GC GC->CG GC->TA AT->CG AT->TA Fr. MUTATIONAL EVENTS

15 ASTROCYTOMA p mutation frequency p mutant frequency % % 8% 1% 1% 7% % 19% 1% Hot spot mutations 1% Codon WT Codon Mutant Codon WT AA Mutant AA Type CpG File Qty TGT CGC CAC 7 CAG Gln CAT TAC TGC Tyr CAT 7 1 TAC TGC Tyr GGC AGC Gly Ser Exon distribution EXON - EXON -8 8% 8% % 17% % EXON 9-11 % 7% 89% Frameshift nsense Missense 8%

16 ASTROCYTOMA p mutation distribution p CODON p mutational events mutation at CpG mutation outside CpG 1 GC->AT AT->GC GC->CG GC->TA AT->CG AT->TA Fr. MUTATIONAL EVENTS

17 GLIOBLASTOMA p mutation frequency p mutant frequency % % 8% 1% 1% 81% % 1% 1% Hot spot mutations 7 % Codon WT Codon Mutant Codon WT AA Mutant AA Type CpG File Qty TGT 1 17 CGC CAC CAG Gln 7 CAT 8 17 GGC AGC Gly Ser 1 7 ATG ATA Met Ile 1 18 CGC CAC 8 TAT TGT Tyr 8 Exon distribution EXON - EXON -8 7% % 8% % EXON % 89% Frameshift nsense Missense

18 GLIOBLASTOMA p mutation distribution p CODON p mutational events mutation at CpG mutation outside CpG 1 GC->AT AT->GC GC->CG GC->TA AT->CG AT->TA Fr. MUTATIONAL EVENTS

19 LUNG (NSCLC ) p mutation frequency p mutant frequency % 9% 11% 1% % 71% 7% % 1% Hot spot mutations % Codon WT Codon Mutant Codon WT AA Mutant AA Type CpG File Qty 18 CGC CTC Leu 1 CTT Leu 7 9 AGG AGT Ser 17 GTC TTC Val Phe TAT TGT Tyr 8 CTG Leu 7 GGC TGC Gly CAT 17 CGC CAC Exon distribution EXON - EXON -8 EXON % 1% 9% 1% % % 81% % 9% Frameshift nsense Missense

20 LUNG (NSCLC ) p mutation distribution p CODON p mutational events mutation at CpG 1 mutation outside CpG GC->AT AT->GC GC->CG GC->TA AT->CG AT->TA Fr. MUTATIONAL EVENTS

21 LUNG (SCLC ) p mutation frequency p mutant frequency % 1% 8% 1% % 78% 1% 1% 1% Hot spot mutations 8 % Codon WT Codon Mutant Codon WT AA Mutant AA Type CpG File Qty CTG Leu 1 17 GTC TTC Val Phe 8 98 GAG TAG Glu Stop 7 9 AGG AGT Ser 18 CGC CTC Leu 171 GAG TAG Glu Stop 17 CGC CAC 17 CGC TGC TGC TTC Phe GGC TGC Gly Exon distribution EXON - EXON -8 EXON 9-11 % % % 11% % 8% % 8% Frameshift nsense Missense 8%

22 LUNG (SCLC ) p mutation distribution p CODON p mutational events mutation at CpG 1 mutation outside CpG GC->AT AT->GC GC->CG GC->TA AT->CG AT->TA Fr. MUTATIONAL EVENTS

23 BLADDER CANCER p mutation frequency p mutant frequency % 9% % 1% % 79% 8% 1% 1% Hot spot mutations 9 11% Codon WT Codon Mutant Codon WT AA Mutant AA Type CpG File Qty 8 GAG AAG Glu Lys 8 AGA ACA Thr CAG Gln 17 CGC CAC 7 CAT 8 AGA AAA Lys 1 TAT TGT Tyr GAG AAG Glu Lys 18 GGC AGC Gly Ser 1 Exon distribution EXON - EXON -8 1% % 8% EXON % 7% 1% % % 87% Frameshift nsense Missense

24 BLADDER CANCER p mutation distribution p CODON p mutational events mutation at CpG mutation outside CpG 1 GC->AT AT->GC GC->CG GC->TA AT->CG AT->TA Fr. MUTATIONAL EVENTS

25 ENDOMETRIAL CANCER p mutation frequency p mutant frequency % 8% 11% 1% 1% 77% 8% 1% 1% Hot spot mutations 1 1% Codon WT Codon Mutant Codon WT AA Mutant AA Type CpG File Qty 1 CAG Gln 1 17 CGC CAC 8 CAT TGC TTC Phe 1 CGA TGA Stop GGC AGC Gly Ser 8 17 GTC TTC Val Phe 1 TAC TGC Tyr Exon distribution EXON - EXON -8 EXON 9-11 % 7% 11% 8% % % % 81% 7% Frameshift nsense Missense

26 ENDOMETRIAL CANCER p mutation distribution p CODON p mutational events 1 mutation at CpG mutation outside CpG GC->AT AT->GC GC->CG GC->TA AT->CG AT->TA Fr. MUTATIONAL EVENTS

27 p mutation frequency ESOPHAGEAL ADC p mutant frequency % 1% 1% 1% % 8% 8% % 1% Hot spot mutations % Codon WT Codon Mutant Codon WT AA Mutant AA Type CpG File Qty 17 CGC CAC 1 GGC AGC Gly Ser 1 CAT 1 CAG Gln 8 1 CGA TGA Stop 7 TGT 8 19 CGA TGA Stop 78 CCT TCT Pro Ser Exon distribution EXON - EXON -8 EXON % 1% % % 78% Frameshift nsense Missense %

28 ESOPHAGEAL ADC p mutation distribution p CODON p mutational events mutation at CpG mutation outside CpG 1 GC->AT AT->GC GC->CG GC->TA AT->CG AT->TA Fr. MUTATIONAL EVENTS

29 ESOPHAGEAL SCC p mutation frequency p mutant frequency % 1% 1% 1% % % 1% % 1% Hot spot mutations 9 % Codon WT Codon Mutant Codon WT AA Mutant AA Type CpG File Qty 17 CGC CAC CAT TAT TGT Tyr CAG Gln 179 CAT 18 TGT TGC TTC Phe 1 17 GTC TTC Val Phe 11 Exon distribution EXON - EXON -8 EXON 9-11 % % 1% 1% 9% % 1% 77% 8% Frameshift nsense Missense

30 ESOPHAGEAL SCC p mutation distribution p CODON p mutational events 1 mutation at CpG mutation outside CpG GC->AT AT->GC GC->CG GC->TA AT->CG AT->TA Fr. MUTATIONAL EVENTS

31 GASTRIC CANCER p mutation frequency p mutant frequency % 7% 9% 1% % 7% % 17% 1% Hot spot mutations 1% Codon WT Codon Mutant Codon WT AA Mutant AA Type CpG File Qty 17 CGC CAC 9 8 CAT CAG Gln GGC AGC Gly Ser 9 TGT 19 CGA TGA Stop 1 1 CGA TGA Stop 1 TAT TGT Tyr 1 Exon distribution EXON - EXON -8 EXON 9-11 % 9% 7% % % 8% Frameshift nsense Missense

32 GASTRIC CANCER p mutation distribution p CODON p mutational events mutation at CpG mutation outside CpG 1 GC->AT AT->GC GC->CG GC->TA AT->CG AT->TA Fr. MUTATIONAL EVENTS

33 HCC p mutation frequency p mutant frequency % % % 1% % 78% 9% 1% 1% Hot spot mutations 1 % Codon WT Codon Mutant Codon WT AA Mutant AA Type CpG File Qty 9 AGG AGT Ser TGT GTC TTC Val Phe 1 1 ATC AAC Ile Asn 1 TAT TGT Tyr 9 9 AGG ATG Met 9 19 GCC CCC Ala Pro 7 17 CGC CAC 7 CAG Gln 7 1 CAT Exon distribution EXON - EXON -8 18% % % EXON 9-11 % 8% 1% % 9% % Frameshift nsense Missense

34 HCC p mutation distribution p CODON p mutational events 1 mutation at CpG mutation outside CpG GC->AT AT->GC GC->CG GC->TA AT->CG AT->TA Fr. MUTATIONAL EVENTS

35 HEAD AND NECK SCC p mutation frequency p mutant frequency % 1% 1% 1% % % 8% % 1% Hot spot mutations 7 7% Codon WT Codon Mutant Codon WT AA Mutant AA Type CpG File Qty CAG Gln 8 17 CGC CAC CAT 8 1 TAT TGT Tyr 17 TGC TTC Phe 1 TGT TAT TGT Tyr 7 17 GTC TTC Val Phe Exon distribution EXON - EXON -8 EXON % 1% 7% 9% % % % 77% 1% Frameshift nsense Missense

36 HEAD AND NECK SCC p mutation distribution p CODON p mutational events mutation at CpG 1 mutation outside CpG GC->AT AT->GC GC->CG GC->TA AT->CG AT->TA Fr. MUTATIONAL EVENTS

37 LI-FRAUMENI SYNDROME p mutation frequency p mutant frequency % 1% 9% 1% % 71% 1% 17% 1% Hot spot mutations % Codon WT Codon Mutant Codon WT AA Mutant AA Type CpG File Qty 17 CGC CAC 1 CAG Gln 1 1 GGC AGC Gly Ser 11 CAT 11 TGT CGA TGA Stop 9 CGC CAC CGA TGA Stop Exon distribution EXON - EXON -8 EXON % 1% 8% Frameshift nsense Missense

38 LI-FRAUMENI SYNDROME p mutation distribution p CODON p mutational events 7 mutation at CpG mutation outside CpG 1 GC->AT AT->GC GC->CG GC->TA AT->CG AT->TA Fr. MUTATIONAL EVENTS

39 SKIN BCC p mutation frequency p mutant frequency % 1% % 1% 9% 8% 9% 9% 1% Hot spot mutations 1 1% Codon WT Codon Mutant Codon WT AA Mutant AA Type CpG File Qty 19 CGA TGA Stop TCC TTC Ser Phe CCC CTC Pro Leu CAT TAT Tyr 8 CAA Gln 8 17 TCC TTC Ser Phe 1 CCG TCG Pro Ser 1 CGA TGA Stop Exon distribution EXON - EXON -8 % 1% EXON 9-11 % 1% % 9% % 87% 71% Frameshift nsense Missense

40 SKIN BCC p mutation distribution p CODON p mutational events 7 1 mutation at CpG mutation outside CpG GC->AT AT->GC GC->CG GC->TA AT->CG AT->TA Fr. MUTATIONAL EVENTS

41 SKIN SCC p mutation frequency p mutant frequency % 11% % 1% 1% 8% 11% % 1% Hot spot mutations 1 11% Codon WT Codon Mutant Codon WT AA Mutant AA Type CpG File Qty CAT TAT Tyr 81 GAC GAT Asp Asp 8 GAA AAA Glu Lys 19 CGA TGA Stop 17 CAG TAG Gln Stop 1 CAG INS1B Gln Fs. Fr GGC AGC Gly Ser CAG Gln Exon distribution EXON - EXON -8 % % 7% % % EXON 9-11 % % % 89% Frameshift nsense Missense

42 SKIN SCC p mutation distribution p CODON p mutational events mutation at CpG mutation outside CpG 1 GC->AT AT->GC GC->CG GC->TA AT->CG AT->TA Fr. MUTATIONAL EVENTS

43 MELANOMA p mutation frequency p mutant frequency % % % 1% 1% 88% % % 1% Hot spot mutations 1 18% Codon WT Codon Mutant Codon WT AA Mutant AA Type CpG File Qty 177 CCC TCC Pro Ser 9 CGC CAC 17 TCC TTC Ser Phe 187 GGT AGT Gly Ser 8 GAA AAA Glu Lys GGA GAA Gly Glu TCC CCC Ser Pro 1 7 CCG TCG Pro Ser 1 9 GGT GAT Gly Asp 1 Exon distribution EXON - EXON -8 % % % 1% % EXON % 88% 9% % Frameshift nsense Missense

44 MELANOMA p mutation distribution p mutational events p CODON mutation at CpG mutation outside CpG 1 GC->AT AT->GC GC->CG GC->TA AT->CG AT->TA Fr. MUTATIONAL EVENTS

45 PANCREAS CARCINOMA p mutation frequency p mutant frequency % % 1% 1% % 7% % % 1% Hot spot mutations 1 % Codon WT Codon Mutant Codon WT AA Mutant AA Type CpG File Qty CAT 17 CGC CAC 1 1 TGT TAT TGT Tyr 1 CAG Gln 8 1 CGA CTA Leu 1 AAG AGG Lys 11 CCC TCC Pro Ser Exon distribution EXON - EXON -8 EXON % % % % % 8% Frameshift nsense Missense

46 PANCREAS CARCINOMA p mutation distribution p CODON p mutational events 1 mutation at CpG mutation outside CpG GC->AT AT->GC GC->CG GC->TA AT->CG AT->TA Fr. MUTATIONAL EVENTS

47 PROSTATE CANCER p mutation frequency p mutant frequency % % 8% 1% 7% 8% 7% 1% 1% Hot spot mutations 1 8% Codon WT Codon Mutant Codon WT AA Mutant AA Type CpG File Qty TGT 1 17 CGC CAC 7 18 GCC DEL1A Ala Fs. Fr 1 ATC AGC Ile Ser CAT 1 CAT 7 GTT TTT Val Phe 1 TAC TGC Tyr 1 CCG CCA Pro Pro Exon distribution EXON - EXON -8 EXON 9-11 % 7% % 11% % 11% 9% 87% 78% Frameshift nsense Missense

48 PROSTATE CANCER p mutation distribution p CODON p mutational events 1 mutation at CpG mutation outside CpG GC->AT AT->GC GC->CG GC->TA AT->CG AT->TA Fr. MUTATIONAL EVENTS

49 p mutation frequency RENAL CELL CARCINOMA p mutant frequency % % 1% 1% % 77% % 19% 1% Hot spot mutations 8% Codon WT Codon Mutant Codon WT AA Mutant AA Type CpG File Qty GGC TGC Gly 8 78 CCT CTT Pro Leu 8 17 TGC TTC Phe CAG Gln 9 GAG TAG Glu Stop 17 GTG GGG Val Gly 19 CCC DEL1A Pro Fs. Fr 9 AGG AGT Ser 9 AGG ATG Met Exon distribution EXON - EXON -8 EXON % % 81% Frameshift nsense Missense

50 RENAL CELL CARCINOMA p mutation distribution p CODON p mutational events 1 mutation at CpG mutation outside CpG GC->AT AT->GC GC->CG GC->TA AT->CG AT->TA Fr. MUTATIONAL EVENTS

51 OSTEOSARCOMA p mutation frequency p mutant frequency % 1% 17% 1% 1% % 1% % 1% Hot spot mutations % Codon WT Codon Mutant Codon WT AA Mutant AA Type CpG File Qty CAG Gln 1 CAT 8 17 CGC CAC 7 7 ATG ATT Met Ile 8 TGC TAC Tyr GGC AGC Gly Ser TGT 81 GAC AAC Asp Asn 81 GAC CAC Asp Exon distribution EXON - EXON -8 EXON % 1% 8% % 19% 78% Frameshift nsense Missense

52 OSTEOSARCOMA p mutation distribution p CODON p mutational events 1 mutation at CpG mutation outside CpG GC->AT AT->GC GC->CG GC->TA AT->CG AT->TA Fr. MUTATIONAL EVENTS

53 OVARIAN CANCER p mutation frequency p mutant frequency % 8% 1% 1% % % 8% 7% 1% Hot spot mutations 1 % Codon WT Codon Mutant Codon WT AA Mutant AA Type CpG File Qty 17 CGC CAC 71 CAT CAG Gln 9 TAT TGT Tyr 7 TGT GGC AGC Gly Ser 19 ATC ACC Ile Thr 7 ATG ATA Met Ile Exon distribution EXON - EXON -8 EXON 9-11 % % 1% 7% % % 1% 79% 1% Frameshift nsense Missense

54 OVARIAN CANCER p mutation distribution p CODON p mutational events 1 mutation at CpG mutation outside CpG GC->AT AT->GC GC->CG GC->TA AT->CG AT->TA Fr. MUTATIONAL EVENTS

55 p mutation frequency ACUTE MYELOID LEUKEMIA p mutant frequency % % 1% 1% % 79% % 1% 1% Hot spot mutations % Codon WT Codon Mutant Codon WT AA Mutant AA Type CpG File Qty 7 CAT TGT 17 CGC CAC TAT TGT Tyr 8 TGT TAT Tyr CAG Gln 1 TGC AGC Ser 17 GTT TTT Val Phe 17 TGC TAC Tyr Exon distribution EXON - EXON -8 EXON % % 8% Frameshift nsense Missense

56 ACUTE MYELOID LEUKEMIA p mutation distribution p CODON p mutational events 1 mutation at CpG mutation outside CpG GC->AT AT->GC GC->CG GC->TA AT->CG AT->TA Fr. MUTATIONAL EVENTS

57 p mutation frequency BURKITT LYMPHOMA p mutant frequency % 9% % 1% % 8% 7% 9% 1% Hot spot mutations % Codon WT Codon Mutant Codon WT AA Mutant AA Type CpG File Qty CAG Gln 1 18 CGC CAC 17 CGC CAC 1 CGA TGA Stop 8 TGT TAT Tyr ATC GAC Ile Asp 1 TAC CAC Tyr 1 CGA CAA Gln 7 ATG ATA Met Ile Exon distribution EXON - EXON -8 EXON 9-11 % 9% 8% Frameshift nsense Missense

58 BURKITT LYMPHOMA p mutation distribution p CODON p mutational events mutation at CpG mutation outside CpG 1 GC->AT AT->GC GC->CG GC->TA AT->CG AT->TA Fr. MUTATIONAL EVENTS

59 p mutation frequency B-CELL LYMPHOMA p mutant frequency % % 7% 1% % 88% % 9% 1% Hot spot mutations % Codon WT Codon Mutant Codon WT AA Mutant AA Type CpG File Qty CAG Gln 1 CAT 9 7 TGT 17 CGC CAC 19 CGA TGA Stop 8 18 CGC CAC 17 TGC GGC Gly TAT TGT Tyr Exon distribution EXON - EXON -8 EXON % % 9% Frameshift nsense Missense

60 B-CELL LYMPHOMA p mutation distribution p CODON p mutational events 1 mutation at CpG mutation outside CpG GC->AT AT->GC GC->CG GC->TA AT->CG AT->TA Fr. MUTATIONAL EVENTS

61 p mutation frequency MYELODYSPLASTIC SYNDROME p mutant frequency % % 9% 1% % 77% 8% 1% 1% Hot spot mutations % Codon WT Codon Mutant Codon WT AA Mutant AA Type CpG File Qty TAT TGT Tyr 7 CAT 7 8 TGT TAT Tyr CAG Gln TAC TGC Tyr 7 ATG ATA Met Ile GGC AGC Gly Ser 11 TGC TAC Tyr 17 GTG CTG Val Leu 17 CGC CAC Exon distribution EXON - EXON -8 EXON % % 8% Frameshift nsense Missense

62 MYELODYSPLASTIC SYNDROME p mutation distribution p CODON p mutational events 1 mutation at CpG mutation outside CpG GC->AT AT->GC GC->CG GC->TA AT->CG AT->TA Fr. MUTATIONAL EVENTS

63 p mutation frequency NON-HODGKIN'S LYMPHOMA p mutant frequency % % % 1% % 9% % % 1% Hot spot mutations 7% Codon WT Codon Mutant Codon WT AA Mutant AA Type CpG File Qty CAG Gln 8 17 CGC CAC 7 TAC AAC Tyr Asn CAT TGT 1 AAG CAG Lys Gln 1 ATG ACG Met Thr 18 GCC GTC Ala Val 11 TGC TAC Tyr 1 CAG Gln Exon distribution EXON - EXON -8 EXON 9-11 % % 9% Frameshift nsense Missense

64 NON-HODGKIN'S LYMPHOMA p mutation distribution p CODON p mutational events mutation at CpG mutation outside CpG 1 GC->AT AT->GC GC->CG GC->TA AT->CG AT->TA Fr. MUTATIONAL EVENTS

65 DISTRIBUTION OF p MUTATION Amino acids residues are shown using both or 1 letter abbreviation Yellow: codon number White: wt codon Light orange: letter aa light blue: 1 letter aa The last lane shows the number of mutations found at this position in the UMD p database The frequency of p mutations is colored coded: Red: between 1 and 1 mutations Green: between 11 and 1 mutations Blue: > 1 mutations ATG GAG GAG CCG CAG TCA GAT CCT AGC GTC GAG CCC CCT CTG AGT CAG GAA ACA TTT TCA Met Glu Glu Pro Gln Ser Asp Pro Ser Val Glu Pro Pro Leu Ser Gln Glu Thr Phe Ser M E E P Q S D P S V E P P L S Q E T F S GAC CTA AAA CTA CTT CCT GAA AAC AAC GTT CTG TCC CCC TTG CCG TCC CAA GCA ATG Asp Leu Lys Leu Leu Pro Glu Asn Asn Val Leu Ser Pro Leu Pro Ser Gln Ala Met D L W K L L P E N N V L S P L P S Q A M GAT GAT TTG ATG CTG TCC CCG GAC GAT ATT GAA CAA TTC ACT GAA GAC CCA GGT CCA Asp Asp Leu Met Leu Ser Pro Asp Asp Iso Glu Gln Phe Thr Glu Asp Pro Gly Pro D D L M L S P D D I E Q W F T E D P G P GAT GAA GCT CCC AGA ATG CCA GAG GCT GCT CCC CCC GTG GCC CCT GCA CCA GCA GCT CCT Asp Glu Ala Pro Met Pro Glu Ala Ala Pro Pro Val Ala Pro Ala Pro Ala Ala Pro D E A P R M P E A A P P V A P A P A A P CGC R ACA CCG GCG GCC CCT GCA CCA GCC CCC TCC CCC CTG TCA TCT TCT GTC CCT TCC CAG Thr Pro Ala Ala Pro Ala Pro Ala Pro Ser Pro Leu Ser Ser Ser Val Pro Ser Gln T P A A P A P A P S W P L S S S V P S Q AAA ACC TAC CAG GGC AGC TAC GGT TTC CTG GGC TTC TTG CAT TCT GGG ACA GCC AAG Lys Thr Tyr Gln Gly Ser Tyr Gly Phe Leu Gly Phe Leu Ser Gly Thr Ala Lys K T Y Q G S Y G F R L G F L H S G T A K TCT GTG ACT TGC ACG TAC TCC CCT GCC CTC AAC AAG ATG TTT TGC CAA CTG GCC AAG ACC Ser Val Thr Thr Tyr Ser Pro Ala Leu Asn Lys Met Phe Gln Leu Ala Lys Thr S V T C T Y S P A L N K M F C Q L A K T

66 TGC CCT GTG CAG CTG GTT GAT TCC ACA CCC CCG CCC GGC ACC CGC GTC CGC GCC ATG Pro Val Gln Leu Val Asp Ser Thr Pro Pro Pro Gly Thr Val Ala Met C P V Q L W V D S T P P P G T R V R A M GCC ATC TAC AAG CAG TCA CAG CAC ATG ACG GAG GTT GTG AGG CGC TGC CCC CAC CAT GAG Ala Iso Tyr Lys Gln Ser Gln Met Thr Glu Val Val Pro Glu A I Y K Q S Q H M T E V V R R C P H H E CGC TGC TCA GAT AGC GAT GGT CTG GCC CCT CCT CAG CAT CTT ATC CGA GTG GAA GGA AAT Ser Asp Ser Asp Gly Leu Ala Pro Pro Gln Leu Iso Val Glu Gly Asn R C S D S D G L A P P Q H L I R V E G N TTG GTG GAG TAT TTG GAT GAC AGA AAC ACT TTT CGA CAT AGT GTG GTG GTG CCC TAT Leu Val Glu Tyr Leu Asp Asp Asn Thr Phe Ser Val Val Val Pro Tyr L R V E Y L D D R N T F H S V V V P Y R GAG CCG CCT GAG GTT GGC TCT GAC TGT ACC ACC ATC CAC TAC AAC TAC ATG TGT AAC AGT Glu Pro Pro Glu Val Gly Ser Asp Thr Thr Iso Tyr Asn Tyr Met Asn Ser E P P E V G S D C T T I H Y N Y M C N S TCC TGC ATG GGC GGC ATG AAC AGG CCC ATC CTC ACC ATC ATC ACA CTG GAA GAC TCC Ser Met Gly Gly Met Asn Pro Iso Leu Thr Iso Iso Thr Leu Glu Asp Ser S C M G G M N R R P I L T I I T L E D S AGT GGT AAT CTA CTG GGA AAC AGC TTT GAG GTG GTT TGT GCC TGT CCT GGG AGA Ser Gly Asn Leu Leu Gly Asn Ser Phe Glu Val Val Ala Pro Gly S G N L L G R N S F E V R V C A C P G R GAC CGC ACA GAG GAA GAG AAT CTC CGC AAG AAA GGG GAG CCT CAC CAC GAG CTG CCC Asp Thr Glu Glu Glu Asn Leu Lys Lys Gly Glu Pro Glu Leu Pro D R R T E E E N L R K K G E P H H E L P CCA GGG AGC ACT AAG CGA GCA CTG CCC AAC AAC ACC AGC TCC TCT CCC CAG CCA AAG AAG Pro Gly Ser Thr Lys Ala Leu Pro Asn Asn Thr Ser Ser Ser Pro Gln Pro Lys Lys P G S T K R A L P N N T S S S P Q P K K

67 AAA CCA CTG GAT GGA GAA TAT TTC ACC CTT CAG ATC GGG GAG CGC TTC GAG ATG Lys Pro Leu Asp Gly Glu Tyr Phe Thr Leu Gln Iso Gly Glu Phe Glu Met K P L D G E Y F T L Q I R G R E R F E M TTC CGA GAG CTG AAT GAG GCC TTG GAA CTC AAG GAT GCC CAG GCT GGG AAG GAG CCA GGG Phe Glu Leu Asn Glu Ala Leu Glu Leu Lys Asp Ala Gln Ala Gly Lys Glu Pro Gly F R E L N E A L E L K D A Q A G K E P G GGG AGC AGG GCT CAC TCC AGC CAC CTG AAG TCC AAA AAG GGT CAG TCT ACC TCC CGC CAT Gly Ser Ala Ser Ser Leu Lys Ser Lys Lys Gly Gln Ser Thr Ser G S R A H S S H L K S K K G Q S T S R H AAA AAA CTC ATG TTC AAG ACA GAA GGG CCT GAC TCA GAC Lys Lys Leu Met Phe Lys Thr Glu Gly Pro Asp Ser Asp K K L M F K T E G P D S D

68 CpG MUTATION AND LOSS OF p ACTIVITY POS: Codon position (1 to 9) WT: rmal base sequence of the codon in which the mutation occurred Mut: Sequence of the mutated codon WT AA: Wild type amino acid Mut: Mutant amino acid. Event: Mutational event: Number: Number of reccord in the database WAF1: ND: mutant activity available NR: t available Code: Polymorphism Mutant Mutation name Pos. WT Mut. WT AA Mut. AA Event Number WAF1 Code p.proleu CCG CTG Pro Leu C->T 9. p.propro CCG CCA Pro Pro G->A NR 1 p.ser9ser 9 AGC AGT Ser Ser C->T NR p.val1ile 1 GTC ATC Val Ile G->A p.val1val 1 GTC GTT Val Val C->T NR p.glu11lys 11 GAG AAG Glu Lys G->A p.asnasn AAC AAT Asn Asn C->T NR p.val1ile 1 GTT ATT Val Ile G->A.79 7 p.proleu CCG CTG Pro Leu C->T.8 8 p.propro CCG CCA Pro Pro G->A NR 9 p.pro7leu 7 CCG CTG Pro Leu C->T 1. 1 p.pro7pro 7 CCG CCA Pro Pro G->A 1 NR 11 p.asp8asp 8 GAC GAT Asp Asp C->T 1 NR 1 p.asp9asn 9 GAT AAT Asp Asn G->A p.7 7 CGC TGC C->T ND 1 p.7 7 CGC CAC G->A ND 1 p.pro7pro 7 CCC CCT Pro Pro C->T NR 1 p.val7met 7 GTG ATG Val Met G->A p.pro8leu 8 CCG CTG Pro Leu C->T p.pro8pro 8 CCG CCA Pro Pro G->A 1 NR 19 p.ala8val 8 GCG GTG Ala Val C->T 1. p.ala8ala 8 GCG GCA Ala Ala G->A NR 1 p.tyr17tyr 17 TAC TAT Tyr Tyr C->T NR p.gly18ser 18 GGT AGT Gly Ser G->A p TGT C->T p CAT G->A.7 p.thr1met 1 ACG ATG Thr Met C->T p.thr1thr 1 ACG ACA Thr Thr G->A NR 7 p.pro1leu 1 CCG CTG Pro Leu C->T p.pro1pro 1 CCG CCA Pro Pro G->A 1 NR 9 p.pro1pro 1 CCC CCT Pro Pro C->T 1 NR p.gly1ser 1 GGC AGC Gly Ser G->A p.1 1 CGC TGC C->T 8.9 p.1 1 CGC CAC G->A p.1 1 CGC C->T 1 NR p.val17ile 17 GTC ATC Val Ile G->A 1.7 p CGC TGC C->T 1.

69 p CGC CAC G->A p CGC C->T NR 8 p.ala19thr 19 GCC ACC Ala Thr G->A p.thr17met 17 ACG ATG Thr Met C->T 9.8 p.thr17thr 17 ACG ACA Thr Thr G->A 8 NR 1 p CGC TGC C->T 1. p CGC CAC G->A p CGC TGC C->T.1 p CGC CAC G->A.7 p.ser18ser 18 AGC AGT Ser Ser C->T 1 NR p.asp18asn 18 GAT AAT Asp Asn G->A p.19stop 19 CGA TGA Stop C->T 9 8 p.19gln 19 CGA CAA Gln G->A 7. 9 p. TGT C->T 9. p. CAT G->A p.1stop 1 CGA TGA Stop C->T 81 p.1gln 1 CGA CAA Gln G->A 9.19 p.proleu CCG CTG Pro Leu C->T.9 p.propro CCG CCA Pro Pro G->A NR p.glygly GGC GGT Gly Gly C->T 11 NR p.glyser GGC AGC Gly Ser G->A 7 p. C->T 7 8 p.gln CAG Gln G->A 88 9 p.7 7 C->T 1.8 p.7gln 7 CAG Gln G->A p. TGT C->T 8.91 p. CAT G->A p.8 8 C->T 7. p.8gln 8 CAG Gln G->A 7.18 p.8 8 CGC TGC C->T.7 p.8 8 CGC CAC G->A p.9 9 CGC TGC C->T p.9 9 CGC CAC G->A 7. 9 p CAC CAT C->T 1 NR 7 p.glu98lys 98 GAG AAG Glu Lys G->A p.stop CGA TGA Stop C->T 1 7 p.gln CGA CAA Gln G->A p. TGT C->T ND 7 p. CAT G->A p. TGT C->T ND 7 p. CAT G->A p.7 7 CGC TGC C->T p.7 7 CGC CAC G->A p.phe8phe 8 TTC TTT Phe Phe C->T NR 8 p.glu9lys 9 GAG AAG Glu Lys G->A ND 81 p.stop CGA TGA Stop C->T 8 p.gln CGA CAA Gln G->A.9 p CGC TGC G->A 1 8 p CGC CAC C->T 1

70 CpG type I: CGN NUMBER OF MUTATIONS CpG POSITION Mutation targeting the C Mutation targeting the G

71 NUMBER OF MUTATIONS CpG type II: NCG Mutation targeting the C Mutation targeting the G CpG POSITION

72 CpG type III: NNC GNN /1_ 1/11_ /1 8/9 7/7 17/18 1/1 1/17 18/19 18/18 / 97/98 8/9 NUMBER OF MUTATIONS 9/1_ 1/11_ /1 8/9 7/7 17/18 1/1 1/17 18/19 18/18 / 97/98 8/9 CpG POSITION Mutation targeting the C Mutation targeting the G

73 p mutant position p Activity (%) Number of Mutant 1 1 p Activity (%) Number of Mutant

(http://genomes.urv.es/caical) TUTORIAL. (July 2006)

(http://genomes.urv.es/caical) TUTORIAL. (July 2006) (http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:

More information

Hands on Simulation of Mutation

Hands on Simulation of Mutation Hands on Simulation of Mutation Charlotte K. Omoto P.O. Box 644236 Washington State University Pullman, WA 99164-4236 omoto@wsu.edu ABSTRACT This exercise is a hands-on simulation of mutations and their

More information

DNA and Protein Synthesis Grade 10

DNA and Protein Synthesis Grade 10 Ohio Standards Connection: Life Sciences Benchmark C Explain the genetic mechanisms and molecular basis of inheritance. Indicator 5 Illustrate the relationship of the structure and function of DNA to protein

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:.

More information

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core DNA Sequencing Services Pre-Mixed o Provide template and primer, mixed into the same tube* Pre-Defined o Provide template and primer in separate tubes* Custom o Full-service for samples with unknown concentration

More information

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors.

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. Legends of supplemental figures and tables Figure 1: Overview of study design and results. (A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. After raw data gene expression

More information

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C)

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C) TECHNICAL DATA SHEET BIOLUMINESCENCE RESONANCE ENERGY TRANSFER RENILLA LUCIFERASE FUSION PROTEIN EXPRESSION VECTOR Product: prluc-c Vectors Catalog number: Description: Amount: The prluc-c vectors contain

More information

Table S1. Related to Figure 4

Table S1. Related to Figure 4 Table S1. Related to Figure 4 Final Diagnosis Age PMD Control Control 61 15 Control 67 6 Control 68 10 Control 49 15 AR-PD PD 62 15 PD 65 4 PD 52 18 PD 68 10 AR-PD cingulate cortex used for immunoblot

More information

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain?

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain? Networked Systems, COMPGZ01, 2012 Answer TWO questions from Part ONE on the answer booklet containing lined writing paper, and answer ALL questions in Part TWO on the multiple-choice question answer sheet.

More information

Codon usage bias is correlated with gene expression levels in the fission yeast Schizosaccharomyces pombe

Codon usage bias is correlated with gene expression levels in the fission yeast Schizosaccharomyces pombe Codon usage bias is correlated with gene expression levels Blackwell Y Hiraoka usage Publishing et al. bias in fission Inc yeast in the fission yeast Schizosaccharomyces pombe Yasushi Hiraoka 1,2,3, *,

More information

Mutations and Genetic Variability. 1. What is occurring in the diagram below?

Mutations and Genetic Variability. 1. What is occurring in the diagram below? Mutations and Genetic Variability 1. What is occurring in the diagram below? A. Sister chromatids are separating. B. Alleles are independently assorting. C. Genes are replicating. D. Segments of DNA are

More information

Section 1 Workbook (unit 2) ANSWERS

Section 1 Workbook (unit 2) ANSWERS Section 1 Workbook (unit 2) ANSWERS Complete the following table: nucleotide DNA RN Name: B5. Describe DNA replication 1) Label each base given in the diagram below and describe the 4 primary characteristics

More information

Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation. Beginning Perl, Chap 4 6. Example 1

Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation. Beginning Perl, Chap 4 6. Example 1 Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation Beginning Perl, Chap 4 6 Example 1 #!/usr/bin/perl -w use strict; # version 1: my @nt = ('A', 'C', 'G', 'T'); for

More information

MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE 6 AND ATPASE 8 GENES IN DIFFERENT MAMMALIAN SPECIES

MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE 6 AND ATPASE 8 GENES IN DIFFERENT MAMMALIAN SPECIES , pp.-068-075. Available online at http://www.bioinfopublication.org/jouarchive.php?opt=&jouid=bpj0000220 MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing 38. Informationsgespräch der Blutspendezentralefür Wien, Niederösterreich und Burgenland Österreichisches Rotes Kreuz 22. November 2014, Parkhotel Schönbrunn Die Zukunft hat

More information

Molecular analyses of EGFR: mutation and amplification detection

Molecular analyses of EGFR: mutation and amplification detection Molecular analyses of EGFR: mutation and amplification detection Petra Nederlof, Moleculaire Pathologie NKI Amsterdam Henrique Ruijter, Ivon Tielen, Lucie Boerrigter, Aafke Ariaens Outline presentation

More information

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct

More information

DNA Sample preparation and Submission Guidelines

DNA Sample preparation and Submission Guidelines DNA Sample preparation and Submission Guidelines Requirements: Please submit samples in 1.5ml microcentrifuge tubes. Fill all the required information in the Eurofins DNA sequencing order form and send

More information

Supplementary Online Material for Morris et al. sirna-induced transcriptional gene

Supplementary Online Material for Morris et al. sirna-induced transcriptional gene Supplementary Online Material for Morris et al. sirna-induced transcriptional gene silencing in human cells. Materials and Methods Lentiviral vector and sirnas. FIV vector pve-gfpwp was prepared as described

More information

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects Mutation Mutation provides raw material to evolution Different kinds of mutations have different effects Mutational Processes Point mutation single nucleotide changes coding changes (missense mutations)

More information

Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae

Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae Journal of Cell and Molecular Research (2011) 3 (1), 1-11 Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae Fatemeh Moosavi 1, Hassan Mohabatkar

More information

DNA pol RNA pol ARS trna Ribosome DNA mrna Protein Transcription Translation Replication A B Acceptor stem D-loop T C loop Anticodon loop Variable loop Relative trna gene copy number 0.0 0.2 0.4

More information

Chapter 9. Applications of probability. 9.1 The genetic code

Chapter 9. Applications of probability. 9.1 The genetic code Chapter 9 Applications of probability In this chapter we use the tools of elementary probability to investigate problems of several kinds. First, we study the language of life by focusing on the universal

More information

Gene Synthesis 191. Mutagenesis 194. Gene Cloning 196. AccuGeneBlock Service 198. Gene Synthesis FAQs 201. User Protocol 204

Gene Synthesis 191. Mutagenesis 194. Gene Cloning 196. AccuGeneBlock Service 198. Gene Synthesis FAQs 201. User Protocol 204 Gene Synthesis 191 Mutagenesis 194 Gene Cloning 196 AccuGeneBlock Service 198 Gene Synthesis FAQs 201 User Protocol 204 Gene Synthesis Overview Gene synthesis is the most cost-effective way to enhance

More information

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University Egypt Interpretation of sequence results An overview on

More information

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation BDGP Resources Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation For recovery of sequences flanking PZ, PlacW and PEP elements E. Jay Rehm Berkeley Drosophila Genome Project I.

More information

Molecular Facts and Figures

Molecular Facts and Figures Nucleic Acids Molecular Facts and Figures DNA/RNA bases: DNA and RNA are composed of four bases each. In DNA the four are Adenine (A), Thymidine (T), Cytosine (C), and Guanine (G). In RNA the four are

More information

Drosophila NK-homeobox genes

Drosophila NK-homeobox genes Proc. Natl. Acad. Sci. USA Vol. 86, pp. 7716-7720, October 1989 Biochemistry Drosophila NK-homeobox genes (NK-1, NK-2,, and DNA clones/chromosome locations of genes) YONGSOK KIM AND MARSHALL NIRENBERG

More information

Supplementary Information. Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human

Supplementary Information. Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human Supplementary Information Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human vascular endothelial growth factor 165 revealed by biosensor based assays Yoichi Takakusagi

More information

Gene Finding CMSC 423

Gene Finding CMSC 423 Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher

More information

pcas-guide System Validation in Genome Editing

pcas-guide System Validation in Genome Editing pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible

More information

Blue Heron, Your Gene Synthesis Partner

Blue Heron, Your Gene Synthesis Partner Blue Heron, Your Gene Synthesis Partner You Design it We Build it Simple to Complex Sequences Codon Optimization Any species Variants Single or pooled clone libraries Antibody Affinity Optimization Whole

More information

FDC-Specific Functions of p55tnfr and IKK2

FDC-Specific Functions of p55tnfr and IKK2 Supplemental Data FDC-Specific Functions of p55tnfr and IKK2 in the Development of FDC Networks and of Antibody Responses Panayiotis Victoratos, Jacques Lagnel, Sotiria Tzima, Marat B. Alimzhanov, Klaus

More information

Introduction to Bioinformatics (Master ChemoInformatique)

Introduction to Bioinformatics (Master ChemoInformatique) Introduction to Bioinformatics (Master ChemoInformatique) Roland Stote Institut de Génétique et de Biologie Moléculaire et Cellulaire Biocomputing Group 03.90.244.730 rstote@igbmc.fr Biological Function

More information

Characterization of cdna clones of the family of trypsin/a-amylase inhibitors (CM-proteins) in barley {Hordeum vulgare L.)

Characterization of cdna clones of the family of trypsin/a-amylase inhibitors (CM-proteins) in barley {Hordeum vulgare L.) Characterization of cdna clones of the family of trypsin/a-amylase inhibitors (CM-proteins) in barley {Hordeum vulgare L.) J. Paz-Ares, F. Ponz, P. Rodríguez-Palenzuela, A. Lázaro, C. Hernández-Lucas,

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information

Analysis of BRCA1 and BRCA2 mutations in Brazilian breast cancer patients with positive family history

Analysis of BRCA1 and BRCA2 mutations in Brazilian breast cancer patients with positive family history ORIGINAL ARTICLE Rozany Mucha Dufloth Sílvia Carvalho Juliana Karina Heinrich Júlia Yoriko Shinzato César Cabello dos Santos Luiz Carlos Zeferino Fernando Schmitt Analysis of BRCA1 and BRCA2 mutations

More information

Analysis of Synonymous Codon Usage Bias in Chlamydia

Analysis of Synonymous Codon Usage Bias in Chlamydia ISSN 1672-9145 Acta Biochimica et Biophysica Sinica 2005, 37(1): 1 10 CN 31-1940/Q Analysis of Synonymous Codon Usage Bias in Chlamydia Hui LÜ, Wei-Ming ZHAO*, Yan ZHENG, Hong WANG, Mei QI, and Xiu-Ping

More information

Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project

Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project Protocol for recovery of sequences flanking insertions in the Drosophila Gene Disruption

More information

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES SERVICES CATALOGUE WITH SUBMISSION GUIDELINES 3921 Montgomery Road Cincinnati, Ohio 45212 513-841-2428 www.agctsequencing.com CONTENTS Welcome Dye Terminator Sequencing DNA Sequencing Services - Full Service

More information

ANALYSIS OF A CIRCULAR CODE MODEL

ANALYSIS OF A CIRCULAR CODE MODEL ANALYSIS OF A CIRCULAR CODE MODEL Jérôme Lacan and Chrstan J. Mchel * Laboratore d Informatque de Franche-Comté UNIVERSITE DE FRANCHE-COMTE IUT de Belfort-Montbélard 4 Place Tharradn - BP 747 5 Montbélard

More information

Module 6: Digital DNA

Module 6: Digital DNA Module 6: Digital DNA Representation and processing of digital information in the form of DNA is essential to life in all organisms, no matter how large or tiny. Computing tools and computational thinking

More information

Title : Parallel DNA Synthesis : Two PCR product from one DNA template

Title : Parallel DNA Synthesis : Two PCR product from one DNA template Title : Parallel DNA Synthesis : Two PCR product from one DNA template Bhardwaj Vikash 1 and Sharma Kulbhushan 2 1 Email: vikashbhardwaj@ gmail.com 1 Current address: Government College Sector 14 Gurgaon,

More information

The Adaptation of Temperate Bacteriophages to their Host Genomes

The Adaptation of Temperate Bacteriophages to their Host Genomes Supplementary material for the manuscript by The Adaptation of Temperate Bacteriophages to their Host Genomes Louis-Marie Bobay, Eduardo PC Rocha, Marie Touchon Table of contents: Table S1 - General features

More information

Mutation, Repair, and Recombination

Mutation, Repair, and Recombination 16 Mutation, Repair, and Recombination WORKING WITH THE FIGURES 1. In Figure 16-3a, what is the consequence of the new 5 splice site on the open reading frame? In 16-3b, how big could the intron be to

More information

The making of The Genoma Music

The making of The Genoma Music 242 Summary Key words Resumen Palabras clave The making of The Genoma Music Aurora Sánchez Sousa 1, Fernando Baquero 1 and Cesar Nombela 2 1 Department of Microbiology, Ramón y Cajal Hospital, and 2 Department

More information

Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians

Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians Vol. 44 No. 3 SCIENCE IN CHINA (Series C) June 2001 Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians KE Yuehai ( `º) 1, SU Bing (3 Á) 1 3, XIAO Junhua

More information

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme. Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook)

Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook) Name Date Per Look at the diagrams, then answer the questions. Gene Mutations affect a single gene by changing its base sequence, resulting in an incorrect, or nonfunctional, protein being made. (a) A

More information

ANALYSIS OF GROWTH HORMONE IN TENCH (TINCA TINCA) ANALÝZA RŮSTOVÉHO HORMONU LÍNA OBECNÉHO (TINCA TINCA)

ANALYSIS OF GROWTH HORMONE IN TENCH (TINCA TINCA) ANALÝZA RŮSTOVÉHO HORMONU LÍNA OBECNÉHO (TINCA TINCA) ANALYSIS OF GROWTH HORMONE IN TENCH (TINCA TINCA) ANALÝZA RŮSTOVÉHO HORMONU LÍNA OBECNÉHO (TINCA TINCA) Zrůstová J., Bílek K., Baránek V., Knoll A. Ústav morfologie, fyziologie a genetiky zvířat, Agronomická

More information

Supplemental Data. Short Article. PPARγ Activation Primes Human Monocytes. into Alternative M2 Macrophages. with Anti-inflammatory Properties

Supplemental Data. Short Article. PPARγ Activation Primes Human Monocytes. into Alternative M2 Macrophages. with Anti-inflammatory Properties Cell Metabolism, Volume 6 Supplemental Data Short Article PPARγ Activation Primes Human Monocytes into Alternative M2 Macrophages with Anti-inflammatory Properties M. Amine Bouhlel, Bruno Derudas, Elena

More information

Cloning, sequencing, and expression of H.a. YNRI and H.a. YNII, encoding nitrate and nitrite reductases in the yeast Hansenula anomala

Cloning, sequencing, and expression of H.a. YNRI and H.a. YNII, encoding nitrate and nitrite reductases in the yeast Hansenula anomala Cloning, sequencing, and expression of H.a. YNRI and H.a. YNII, encoding nitrate and nitrite reductases in the yeast Hansenula anomala -'Pablo García-Lugo 1t, Celedonio González l, Germán Perdomo l, Nélida

More information

Marine Biology DEC 2004; 146(1) : 53-64 http://dx.doi.org/10.1007/s00227-004-1423-6 Copyright 2004 Springer

Marine Biology DEC 2004; 146(1) : 53-64 http://dx.doi.org/10.1007/s00227-004-1423-6 Copyright 2004 Springer Marine Biology DEC 2004; 146(1) : 53-64 http://dx.doi.org/10.1007/s00227-004-1423-6 Copyright 2004 Springer Archimer http://www.ifremer.fr/docelec/ Archive Institutionnelle de l Ifremer The original publication

More information

Insulin Receptor Gene Mutations in Iranian Patients with Type II Diabetes Mellitus

Insulin Receptor Gene Mutations in Iranian Patients with Type II Diabetes Mellitus Iranian Biomedical Journal 13 (3): 161-168 (July 2009) Insulin Receptor Gene Mutations in Iranian Patients with Type II Diabetes Mellitus Bahram Kazemi 1*, Negar Seyed 1, Elham Moslemi 2, Mojgan Bandehpour

More information

Association of IGF1 and IGFBP3 polymorphisms with colorectal polyps and colorectal cancer risk

Association of IGF1 and IGFBP3 polymorphisms with colorectal polyps and colorectal cancer risk DOI 10.1007/s10552-009-9438-4 ORIGINAL PAPER Association of IGF1 and IGFBP3 polymorphisms with colorectal polyps and colorectal cancer risk Elisabeth Feik Æ Andreas Baierl Æ Barbara Hieger Æ Gerhard Führlinger

More information

Hiding Data in DNA. 1 Introduction

Hiding Data in DNA. 1 Introduction Hiding Data in DNA Boris Shimanovsky *, Jessica Feng +, and Miodrag Potkonjak + * XAP Corporation + Dept. Computer Science, Univ. of California, Los Angeles Abstract. Just like disk or RAM, DNA and RNA

More information

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination

More information

2006 7.012 Problem Set 3 KEY

2006 7.012 Problem Set 3 KEY 2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each

More information

The nucleotide sequence of the gene for human protein C

The nucleotide sequence of the gene for human protein C Proc. Natl. Acad. Sci. USA Vol. 82, pp. 4673-4677, July 1985 Biochemistry The nucleotide sequence of the gene for human protein C (DNA sequence analysis/vitamin K-dependent proteins/blood coagulation)

More information

pcmv6-neo Vector Application Guide Contents

pcmv6-neo Vector Application Guide Contents pcmv6-neo Vector Application Guide Contents Package Contents and Storage Conditions... 2 Product Description... 2 Introduction... 2 Production and Quality Assurance... 2 Methods... 3 Other required reagents...

More information

Heraeus Sepatech, Kendro Laboratory Products GmbH, Berlin. Becton Dickinson,Heidelberg. Biozym, Hessisch Oldendorf. Eppendorf, Hamburg

Heraeus Sepatech, Kendro Laboratory Products GmbH, Berlin. Becton Dickinson,Heidelberg. Biozym, Hessisch Oldendorf. Eppendorf, Hamburg 13 4. MATERIALS 4.1 Laboratory apparatus Biofuge A Centrifuge 5804R FACScan Gel electrophoresis chamber GPR Centrifuge Heraeus CO-AUTO-ZERO Light Cycler Microscope Motopipet Neubauer Cell Chamber PCR cycler

More information

Mutation of the SPSl-encoded protein kinase of Saccharomyces cerevisiae leads to defects in transcription and morphology during spore formation

Mutation of the SPSl-encoded protein kinase of Saccharomyces cerevisiae leads to defects in transcription and morphology during spore formation Mutation of the SPSl-encoded protein kinase of Saccharomyces cerevisiae leads to defects in transcription and morphology during spore formation Helena Friesen/ Rayna Lunz/* Steven Doyle,^ and Jacqueline

More information

pcdna 3.1/V5-His A, B, and C

pcdna 3.1/V5-His A, B, and C pcdna 3.1/V5-His A, B, and C Catalog no. V810-20 Rev. date: 09 November 2010 Manual part no. 28-0141 MAN0000645 User Manual ii Contents Contents and Storage... iv Methods... 1 Cloning into pcdna 3.1/V5-His

More information

The DNA-"Wave Biocomputer"

The DNA-Wave Biocomputer The DNA-"Wave Biocomputer" Peter P. Gariaev (Pjotr Garjajev)*, Boris I. Birshtein*, Alexander M. Iarochenko*, Peter J. Marcer**, George G. Tertishny*, Katherine A. Leonova*, Uwe Kaempf ***. * Institute

More information

Significance of sarcomere gene mutation in patients with dilated cardiomyopathy

Significance of sarcomere gene mutation in patients with dilated cardiomyopathy Significance of sarcomere gene mutation in patients with dilated cardiomyopathy Y.D. Li 1 *, Y.T. Ji 1 *, X.H. Zhou 1, H.L. Li 2, H.T. Zhang 3, Y. Zhang 1, J.X. Li 1, Q. Xing 1, J.H. Zhang 1, Y.F. Hong

More information

Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus

Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus Cao, H.W. and Zhang, H.* College of Biological Science and Technology, HeiLongJiang BaYi Agricultural University, DaQing 163319, China. *

More information

I Lq A Simplified Procedure for Developing Multiplex PCRs

I Lq A Simplified Procedure for Developing Multiplex PCRs I Lq A Simplified Procedure for Developing Multiplex PCRs Anthony P. Shuber, 1 Valerie J. Grondin, and Katherine W. Klinger Department of Technology Development, Integrated Genetics, Inc., Framingham Massachusetts

More information

Gene Finding. Slides by Carl Kingsford

Gene Finding. Slides by Carl Kingsford Gene Finding Slides by Carl Kingsford Genome of the Cow a sequence of 2.86 billion letters enough letters to fill a million pages of a typical book. TATGGAGCCAGGTGCCTGGGGCAACAAGACTGTGGTCACTGAATTCATCCTTCTTGGTCTAACAGAGAACATAG

More information

BD BaculoGold Baculovirus Expression System Innovative Solutions for Proteomics

BD BaculoGold Baculovirus Expression System Innovative Solutions for Proteomics BD BaculoGold Baculovirus Expression System Innovative Solutions for Proteomics Table of Contents Innovative Solutions for Proteomics...........................................................................

More information

All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI_ NotI

All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI_ NotI 2. Primer Design 2.1 Multiple Cloning Sites All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI NotI XXX XXX GGA TCC CCG AAT

More information

Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell?

Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell? Pipe Cleaner Proteins GPS: SB1 Students will analyze the nature of the relationships between structures and functions in living cells. Essential question: How does the structure of proteins relate to their

More information

TP53 Genotype but Not p53 Immunohistochemical Result Predicts Response to Preoperative Short-Term Radiotherapy in Rectal Cancer

TP53 Genotype but Not p53 Immunohistochemical Result Predicts Response to Preoperative Short-Term Radiotherapy in Rectal Cancer ORIGINAL ARTICLES ANNALS OF SURGERY Vol. 235, No. 4, 493 498 2002 Lippincott Williams & Wilkins, Inc. TP53 Genotype but Not p53 Immunohistochemical Result Predicts Response to Preoperative Short-Term Radiotherapy

More information

http://hdl.handle.net/10197/2727

http://hdl.handle.net/10197/2727 Provided by the author(s) and University College Dublin Library in accordance with publisher policies. Please cite the published version when available. Title Performance of DNA data embedding algorithms

More information

Molecular chaperones involved in preprotein. targeting to plant organelles

Molecular chaperones involved in preprotein. targeting to plant organelles Molecular chaperones involved in preprotein targeting to plant organelles Dissertation der Fakultät für Biologie der Ludwig-Maximilians-Universität München vorgelegt von Christine Fellerer München 29.

More information

NimbleGen SeqCap EZ Library SR User s Guide Version 3.0

NimbleGen SeqCap EZ Library SR User s Guide Version 3.0 NimbleGen SeqCap EZ Library SR User s Guide Version 3.0 For life science research only. Not for use in diagnostic procedures. Copyright 2011 Roche NimbleGen, Inc. All Rights Reserved. Editions Version

More information

Peptide bonds: resonance structure. Properties of proteins: Peptide bonds and side chains. Dihedral angles. Peptide bond. Protein physics, Lecture 5

Peptide bonds: resonance structure. Properties of proteins: Peptide bonds and side chains. Dihedral angles. Peptide bond. Protein physics, Lecture 5 Protein physics, Lecture 5 Peptide bonds: resonance structure Properties of proteins: Peptide bonds and side chains Proteins are linear polymers However, the peptide binds and side chains restrict conformational

More information

DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108

DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108 DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108 DISSERTATIONES MEDICINAE UNIVERSITATIS TARTUENSIS 108 THE INTERLEUKIN-10 FAMILY CYTOKINES GENE POLYMORPHISMS IN PLAQUE PSORIASIS KÜLLI KINGO TARTU

More information

Biological One-way Functions

Biological One-way Functions Biological One-way Functions Qinghai Gao, Xiaowen Zhang 2, Michael Anshel 3 gaoj@farmingdale.edu zhangx@mail.csi.cuny.edu csmma@cs.ccny.cuny.edu Dept. Security System, Farmingdale State College / SUNY,

More information

For 5 minute cloning and expression of PCR products fused to GFP in mammalian cells

For 5 minute cloning and expression of PCR products fused to GFP in mammalian cells GFP Fusion TOPO TA Expression Kits Version J 22 April 2004 25-0218 GFP Fusion TOPO TA Expression Kits For 5 minute cloning and expression of PCR products fused to GFP in mammalian cells CT-GFP Fusion TOPO

More information

Chlamydomonas adapted Green Fluorescent Protein (CrGFP)

Chlamydomonas adapted Green Fluorescent Protein (CrGFP) Chlamydomonas adapted Green Fluorescent Protein (CrGFP) Plasmid pfcrgfp for fusion proteins Sequence of the CrGFP In the sequence below, all amino acids which have been altered from the wildtype GFP from

More information

Production and Characterization of a Murine/Human Chimeric Anti-Idiotype Antibody That Mimics Ganglioside1

Production and Characterization of a Murine/Human Chimeric Anti-Idiotype Antibody That Mimics Ganglioside1 (CANCER RESEARCH 52. 1681-1686. April I. 1992] Production and Characterization of a Murine/Human Chimeric Anti-Idiotype Antibody That Mimics Ganglioside1 Alice Hastings, Sherie L. Morrison, Shinji Kanda,

More information

Transmembrane Signaling in Chimeras of the E. coli Chemotaxis Receptors and Bacterial Class III Adenylyl Cyclases

Transmembrane Signaling in Chimeras of the E. coli Chemotaxis Receptors and Bacterial Class III Adenylyl Cyclases Transmembrane Signaling in Chimeras of the E. coli Chemotaxis Receptors and Bacterial Class III Adenylyl Cyclases Dissertation der Mathematisch-Naturwissenschaftlichen Fakultät der Eberhard Karls Universität

More information

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page

More information

and revertant strains. The present paper demonstrates that the yeast gene for subunit II can also be translated to yield a polypeptide

and revertant strains. The present paper demonstrates that the yeast gene for subunit II can also be translated to yield a polypeptide Proc. Nati. Acad. Sci. USA Vol. 76, No. 12, pp. 6534-6538, December 1979 Genetics Five TGA "stop" codons occur within the translated sequence of the yeast mitochondrial gene for cytochrome c oxidase subunit

More information

N-terminal Regulatory Domains of Phosphodiesterases 1, 4, 5 and 10 examined with an Adenylyl Cyclase as a Reporter

N-terminal Regulatory Domains of Phosphodiesterases 1, 4, 5 and 10 examined with an Adenylyl Cyclase as a Reporter N-terminal Regulatory Domains of Phosphodiesterases 1, 4, 5 and 10 examined with an Adenylyl Cyclase as a Reporter Dissertation der Mathematisch-Naturwissenschaftlichen Fakultät der Eberhard Karls Universität

More information

were demonstrated to be, respectively, the catalytic and regulatory subunits of protein phosphatase 2A (PP2A) (29).

were demonstrated to be, respectively, the catalytic and regulatory subunits of protein phosphatase 2A (PP2A) (29). JOURNAL OF VIROLOGY, Feb. 1992, p. 886-893 0022-538X/92/020886-08$02.00/0 Copyright C) 1992, American Society for Microbiology Vol. 66, No. 2 The Third Subunit of Protein Phosphatase 2A (PP2A), a 55- Kilodalton

More information

Protein Synthesis Simulation

Protein Synthesis Simulation Protein Synthesis Simulation Name(s) Date Period Benchmark: SC.912.L.16.5 as AA: Explain the basic processes of transcription and translation, and how they result in the expression of genes. (Assessed

More information

der Strukturbiologie

der Strukturbiologie Einführung Aspekte der in Thermodynamik die Bioinformatik in der Strukturbiologie Wintersemester 2012/13 16:00-16:45 Hörsaal N100 B3 Peter Güntert Literatur Jean-Michel Claverie, Cedric Notredame: Bioinformatics

More information

cdna sequence and expression pattern of the putative

cdna sequence and expression pattern of the putative Proc. Natl. Acad. Sci. USA Vol. 92, pp. 2091-2095, March 1995 Biochemistry cdna sequence and expression pattern of the putative pheromone carrier aphrodisin (lipocalin/hamster/vagina/bartholin's glands)

More information

DNA Sequencing of the eta Gene Coding for Staphylococcal Exfoliative Toxin Serotype A

DNA Sequencing of the eta Gene Coding for Staphylococcal Exfoliative Toxin Serotype A Journal of General Microbiology (1988), 134, 71 1-71 7. Printed in Great Britain 71 1 DNA Sequencing of the eta Gene Coding for Staphylococcal Exfoliative Toxin Serotype A By SUSUMU SAKURA, HTOSH SUZUK

More information

Five-minute cloning of Taq polymerase-amplified PCR products

Five-minute cloning of Taq polymerase-amplified PCR products TOPO TA Cloning Version R 8 April 2004 25-0184 TOPO TA Cloning Five-minute cloning of Taq polymerase-amplified PCR products Catalog nos. K4500-01, K4500-40, K4510-20, K4520-01, K4520-40, K4550-01, K4550-40,

More information

Biopython Tutorial and Cookbook

Biopython Tutorial and Cookbook Biopython Tutorial and Cookbook Jeff Chang, Brad Chapman, Iddo Friedberg, Thomas Hamelryck, Michiel de Hoon, Peter Cock Last Update September 2008 Contents 1 Introduction 5 1.1 What is Biopython?.........................................

More information

Guidelines for Writing a Scientific Paper

Guidelines for Writing a Scientific Paper Guidelines for Writing a Scientific Paper Writing an effective scientific paper is not easy. A good rule of thumb is to write as if your paper will be read by a person who knows about the field in general

More information

Synthetic Biology: DNA Digital Storage, Computation and the Organic Computer

Synthetic Biology: DNA Digital Storage, Computation and the Organic Computer Synthetic Biology: DNA Digital Storage, Computation and the Organic Computer Alex Widdel University of Minnesota, Morris 1 / 27 Outline Overview of Synthetic Biology 1 Overview of Synthetic Biology 2 3

More information

C YTOPLASMIC organelles proliferate by the growth and

C YTOPLASMIC organelles proliferate by the growth and Nuclear and Mitochondrial Inheritance in Yeast Depends on Novel Cytoplasmic Structures Defined by the MDM1 Protein Stephen J. McConnell and Michael P. Yaffe University of California, San Diego, Department

More information

Six Homeoproteins and a Iinc-RNA at the Fast MYH Locus Lock Fast Myofiber Terminal Phenotype

Six Homeoproteins and a Iinc-RNA at the Fast MYH Locus Lock Fast Myofiber Terminal Phenotype Six Homeoproteins and a Iinc-RNA at the Fast MYH Locus Lock Fast Myofiber Terminal Phenotype Iori Sakakibara 1,2,3, Marc Santolini 4, Arnaud Ferry 2,5, Vincent Hakim 4, Pascal Maire 1,2,3 * 1 INSERM U1016,

More information

Transcriptional repressor CopR: dissection of stabilizing motifs within the C terminus

Transcriptional repressor CopR: dissection of stabilizing motifs within the C terminus Microbiology (2001), 147, 3387 3392 Printed in Great Britain Transcriptional repressor CopR: dissection of stabilizing motifs within the C terminus Kornelia Kuhn, 1 Katrin Steinmetzer 2 and Sabine Brantl

More information

Case Study. Malaria and the human genome TEACHER S GUIDE. Steve Cross, Bronwyn Terrill and colleagues. Version 1.0

Case Study. Malaria and the human genome TEACHER S GUIDE. Steve Cross, Bronwyn Terrill and colleagues. Version 1.0 TEACHER S GUIDE Case Study Malaria and the human genome Version 1.0 Steve Cross, Bronwyn Terrill and colleagues Wellcome Trust Sanger Institute Hinxton Malaria and the human genome Each year, the malaria

More information