Pairwise Sequence Alignment

Size: px
Start display at page:

Download "Pairwise Sequence Alignment"

Transcription

1 Pairwise Sequence Alignment SS 2013

2 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics

3 What is a Sequence Alignment? Quite simply, the comparison of two or more DNA or protein sequences to each other. The purpose of alignment is to highlight similarity between sequences. Alignment is the procedure of writing two (or more) sequences in a way that a maximum of identical or similar characters are placed in the same column by -

4 Word Alignment Species 1: SOMEONE Species 2: AWESOME Species 1: SOMEONE Species 2: AWESOME - - -

5 Less trivial Species 1: ACGTTAGA Species 2: CGTTGAA Species 1: ACGTTAGA Species 2: CGTTGAA Species 1: ACGTTAGA Species 2: - CGTT- GAA

6 Less trivial Species 1: ACGTTAGA Species 2: CGTTGAA score: -15 (gaps = -1, match = 1) Species 1: ACGTTAGA Species 2: - CGTT - GAA score: 3

7 FASTA Format - Input Standard input format for alignment programs >Name1 ASEQUENCE1 >Name2 comments SEQU CE2 Strictly speaking, should not contain gaps

8 FASTA Format - Output Increasingly, multiple alignment returned in FASTAlike format >Name1 ASEQUENCE1 >Name2 comments -SEQU--CE2 etc... - Order of sequences may be different in output to input.

9 Relatedness of residues in same column Making these alignments is EASY... As we know where and which evolutionary events occurred - and must infer it

10 Quiz Which alignment (X, Y or Z) shows only residues related by substitution events in the same column?

11 Types of alignments methods We cannot enummerate all possible alignments. Approaches are: Dot matrix Dynamic Programming Word-based or k-tupel methods (database searches)

12 Dot Matrix Given two

13 In a dot matrix we can identify: Existing alignable parts of sequences Possible indels Duplicated sequences and repeats Self-complementarity Gene-order differences among genomes

14 Dot plots

15 a) A continuous main diagonal shows perfect similarity for symbols with the same indices. b) Parallels to the main diagonal indicate repeated regions in the same reading direction on different parts of the sequences. In this case a region D is found twice in the sequence (D1, D2, so called c) Lines perpendicular to the main diagonal indicate palindromic areas. In this case the sequence is completely palindromic in the displayed area. d) Partially palindromic sequence (For DNA sequences this refers to a perfect match of the normal strand with its reverse complement, which is frequently found for many transposable elements. e) Bold blocks on the main diagonal indicate repetition of the same symbol in both sequences, e.g. (G)50, so called microsatellite repeats f) Parallel lines indicate tandem repeats of a larger motif in both sequences, e.g. (AGCTCTGAC)20, so called minisatellite patterns. The distance between the diagonals equals the distance of the motif. g) When the diagonal is a discontinuous line this indicates that the sequences T1 and T2 share a common source. In literal analyses we may have to deal with plagiarism or in DNA analyses sequences may be homologous because of a common ancestor. The number of interruptions increases with modifications on the text or the time of independent evolution and mutation rate. h) indel sequences this can be often observed for many different types of domains, which got lost or substituted during evolution.

16 Aligning a pair of sequences gap = -15 match = +10, mismatch = 0 Aim: get from one corner to other Moves have a cost Choose cheapest way Fill in table Trace route backwards to find alignment

17 Aligning a pair of sequences (Dynamic Programming) Aim: get from one corner to other Moves have a cost Choose cheapest way Fill in table Trace route backwards to find alignment A G G G A - - G C Aim: get from one corner to other Moves have a cost Choose cheapest way Fill in table Trace route backwards to find alignment A G G G T T T G C

18 Needlemann-Wunsch Algorithm Initialize NxM matrix with the sequences A and B of length N and M Starting at the top left corner set the intermediate scoring value =

19 Substitution matrices Some amino acids are more similar than others Adjust cost according to some similarity matrix E.g. Blosum62 Leu -> Leu: 4 Leu -> Met: 2 Leu -> Pro: etc.

20 Gap panalties Gaps tend to occur together one penalty unrealistic a gap of length three should not cost three times as much Use affine gap cost Make extending an already existing gap cheaper Gap opening (G) / gap extension (E) Total cost for gap length x: G + x E

21 Global vs Local Alignment Global: Find the best overall alignment between sequences. Local: Find short regions of highly conserved sequence.

22 Global vs Local Species 1: SOMEONE Species 2: AWESOME Species 1: SOMEONE Species 2: AWESOME Species 1: SOME Species 2: SOME

23 Smith Watermann Algorithm Instead of looking at each sequence in its entirety this compares segments of all possible lengths (LOCAL alignments) and chooses whichever maximizes the similarity For every cell the algorithm calculates ALL possible paths leading to it. These paths can be of any length and contain insertions and deletions

24 Calculating significance We have calculated the optimal alignment the alignment with the best score related or not call this the maximum segment pair (MSP) How many MSPs do we expect with at least the same score by chance?

25 Calculating significance We make use of the extreme value distribution (EVD) to calculate the number of alignments between random sequences that we expect given our score or better This is known as the e-value E(S) = Kmn K and = scaling parameters calculated based on the search space (K) and scoring scheme ( ) m, n = size of the search space The probability of finding at least one match with our score(the p value) 1-e -E(S) As both the e value and the p value decrease, the biological significance increases

26 BLAST Basic Local Alignment Search Tool: Used to find local sequence alignments between protein and nucleotide sequences (Altschul et al., 1990, cited over 43,000 times) Heuristic so it is an approximate best match (SW is a guarantee) calculate the high scoring matches instead of the maximum scoring matches (HSP instead of MSP)

27 BLAST 28, we will look at 4) GTTCACATCATCCTGC GTTC TTCA TCAC CACA ACAT CATC ATCA...

28 BLAST on scoring matrices) you could call this the neighborhood GTTCACATCATCCTGC GTTC: CTTC,GTTC,GATC... TTCA: TTCT,TTGA,TTGT... TCAC: AGAC,CCAC,TCTG... CACA:... ACAT:... CATC:... ATCA:......

29 BLAST calculate E values expectation that you would get that alignment by change given the database of sequences return significant results we already talked about these e-values and p-values with Smith-Waterman significance

30 BLAST Types: Nucleotide vs. Nucleotide: blastn Protein vs Protein: blastp Translated Nucleotide vs Protein: blastx Protein vs Translated Nucleotide: tblastn Translated Nucleotide vs translated database: tblastx

31 DNA vs protein Should you use blastn or blastp? There are four potential nucleotides A,C,GT and therefore four potential states There are 22 standard amino acids and therefore 22 potential states blastp should be more sensitive because of the lower chance of a random hit than blastn because of the state space If there is the possibility of highly similar sequences, DNA works well intergenic spacers RNA genes

32 Things to consider nothing is 90% homologous there may be a degree of your belief in homology statistical significance depends on the size of the alignments and the database e-value increases as database gets bigger more chance for a random hit e-value decreases as alignments get longer more significant the longer the alignment

33 Therefore sequence similarity can suggest homology a significant alignment over the length of both sequences strongly suggests homology homologous sequences do not always produce significant alignments! regions with low complexity (but that are not cleaned out by initial steps in BLAST) can produce significant alignments with no homology

34 Rules There are no hard and fast rules Nucleotides it has been suggested that sequence identity of more than 70% suggests homology e-values of 10^-6 or less too bad Proteins 25% or more sequence identity e-values of 10^-3 or less nope you have to verify somehow, and if you are high throughput, there will be errors

35 Next We will go over some examples in lab Needleman-Wunsch BLAST

BLAST. Anders Gorm Pedersen & Rasmus Wernersson

BLAST. Anders Gorm Pedersen & Rasmus Wernersson BLAST Anders Gorm Pedersen & Rasmus Wernersson Database searching Using pairwise alignments to search databases for similar sequences Query sequence Database Database searching Most common use of pairwise

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003

Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Similarity Searches on Sequence Databases: BLAST, FASTA Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Outline Importance of Similarity Heuristic Sequence Alignment:

More information

Protein & DNA Sequence Analysis. Bobbie-Jo Webb-Robertson May 3, 2004

Protein & DNA Sequence Analysis. Bobbie-Jo Webb-Robertson May 3, 2004 Protein & DNA Sequence Analysis Bobbie-Jo Webb-Robertson May 3, 2004 Sequence Analysis Anything connected to identifying higher biological meaning out of raw sequence data. 2 Genomic & Proteomic Data Sequence

More information

Bio-Informatics Lectures. A Short Introduction

Bio-Informatics Lectures. A Short Introduction Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively

More information

PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org

PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,

More information

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

Rapid alignment methods: FASTA and BLAST. p The biological problem p Search strategies p FASTA p BLAST

Rapid alignment methods: FASTA and BLAST. p The biological problem p Search strategies p FASTA p BLAST Rapid alignment methods: FASTA and BLAST p The biological problem p Search strategies p FASTA p BLAST 257 BLAST: Basic Local Alignment Search Tool p BLAST (Altschul et al., 1990) and its variants are some

More information

Network Protocol Analysis using Bioinformatics Algorithms

Network Protocol Analysis using Bioinformatics Algorithms Network Protocol Analysis using Bioinformatics Algorithms Marshall A. Beddoe Marshall_Beddoe@McAfee.com ABSTRACT Network protocol analysis is currently performed by hand using only intuition and a protocol

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

Clone Manager. Getting Started

Clone Manager. Getting Started Clone Manager for Windows Professional Edition Volume 2 Alignment, Primer Operations Version 9.5 Getting Started Copyright 1994-2015 Scientific & Educational Software. All rights reserved. The software

More information

Amino Acids and Their Properties

Amino Acids and Their Properties Amino Acids and Their Properties Recap: ss-rrna and mutations Ribosomal RNA (rrna) evolves very slowly Much slower than proteins ss-rrna is typically used So by aligning ss-rrna of one organism with that

More information

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:

More information

BIOINFORMATICS TUTORIAL

BIOINFORMATICS TUTORIAL Bio 242 BIOINFORMATICS TUTORIAL Bio 242 α Amylase Lab Sequence Sequence Searches: BLAST Sequence Alignment: Clustal Omega 3d Structure & 3d Alignments DO NOT REMOVE FROM LAB. DO NOT WRITE IN THIS DOCUMENT.

More information

Welcome to the Plant Breeding and Genomics Webinar Series

Welcome to the Plant Breeding and Genomics Webinar Series Welcome to the Plant Breeding and Genomics Webinar Series Today s Presenter: Dr. Candice Hansey Presentation: http://www.extension.org/pages/ 60428 Host: Heather Merk Technical Production: John McQueen

More information

A Tutorial in Genetic Sequence Classification Tools and Techniques

A Tutorial in Genetic Sequence Classification Tools and Techniques A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University jakemdrew@gmail.com www.jakemdrew.com Sequence Characters IUPAC nucleotide

More information

Molecular Databases and Tools

Molecular Databases and Tools NWeHealth, The University of Manchester Molecular Databases and Tools Afternoon Session: NCBI/EBI resources, pairwise alignment, BLAST, multiple sequence alignment and primer finding. Dr. Georgina Moulton

More information

Database searching with DNA and protein sequences: An introduction Clare Sansom Date received (in revised form): 12th November 1999

Database searching with DNA and protein sequences: An introduction Clare Sansom Date received (in revised form): 12th November 1999 Dr Clare Sansom works part time at Birkbeck College, London, and part time as a freelance computer consultant and science writer At Birkbeck she coordinates an innovative graduate-level Advanced Certificate

More information

DNA Printer - A Brief Course in sequence Analysis

DNA Printer - A Brief Course in sequence Analysis Last modified August 19, 2015 Brian Golding, Dick Morton and Wilfried Haerty Department of Biology McMaster University Hamilton, Ontario L8S 4K1 ii These notes are in Adobe Acrobat format (they are available

More information

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Focusing on results not data comprehensive data analysis for targeted next generation sequencing Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes

More information

Algorithms in Bioinformatics I, WS06/07, C.Dieterich 47. This lecture is based on the following, which are all recommended reading:

Algorithms in Bioinformatics I, WS06/07, C.Dieterich 47. This lecture is based on the following, which are all recommended reading: Algorithms in Bioinformatics I, WS06/07, C.Dieterich 47 5 BLAST and FASTA This lecture is based on the following, which are all recommended reading: D.J. Lipman and W.R. Pearson, Rapid and Sensitive Protein

More information

CD-HIT User s Guide. Last updated: April 5, 2010. http://cd-hit.org http://bioinformatics.org/cd-hit/

CD-HIT User s Guide. Last updated: April 5, 2010. http://cd-hit.org http://bioinformatics.org/cd-hit/ CD-HIT User s Guide Last updated: April 5, 2010 http://cd-hit.org http://bioinformatics.org/cd-hit/ Program developed by Weizhong Li s lab at UCSD http://weizhong-lab.ucsd.edu liwz@sdsc.edu 1. Introduction

More information

Sequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment

Sequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment Sequence Analysis 15: lecture 5 Substitution matrices Multiple sequence alignment A teacher's dilemma To understand... Multiple sequence alignment Substitution matrices Phylogenetic trees You first need

More information

DNA Insertions and Deletions in the Human Genome. Philipp W. Messer

DNA Insertions and Deletions in the Human Genome. Philipp W. Messer DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.

More information

Design Style of BLAST and FASTA and Their Importance in Human Genome.

Design Style of BLAST and FASTA and Their Importance in Human Genome. Design Style of BLAST and FASTA and Their Importance in Human Genome. Saba Khalid 1 and Najam-ul-haq 2 SZABIST Karachi, Pakistan Abstract: This subjected study will discuss the concept of BLAST and FASTA.BLAST

More information

MORPHEUS. http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix.

MORPHEUS. http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix. MORPHEUS http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix. Reference: MORPHEUS, a Webtool for Transcripton Factor Binding Analysis Using

More information

Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6

Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6 Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6 In the last lab, you learned how to perform basic multiple sequence alignments. While useful in themselves for determining conserved residues

More information

Ordered Index Seed Algorithm for Intensive DNA Sequence Comparison

Ordered Index Seed Algorithm for Intensive DNA Sequence Comparison Ordered Index Seed Algorithm for Intensive DNA Sequence Comparison Dominique Lavenier IRISA / CNRS Campus de Beaulieu 35042 Rennes, France lavenier@irisa.fr Abstract This paper presents a seed-based algorithm

More information

Bioinformática BLAST. Blast information guide. Buscas de sequências semelhantes. Search for Homologies BLAST

Bioinformática BLAST. Blast information guide. Buscas de sequências semelhantes. Search for Homologies BLAST BLAST Bioinformática Search for Homologies BLAST BLAST - Basic Local Alignment Search Tool http://blastncbinlmnihgov/blastcgi 1 2 Blast information guide Buscas de sequências semelhantes http://blastncbinlmnihgov/blastcgi?cmd=web&page_type=blastdocs

More information

Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations

Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations AlCoB 2014 First International Conference on Algorithms for Computational Biology Thiago da Silva Arruda Institute

More information

A COMPARISON OF COMPUTATION TECHNIQUES FOR DNA SEQUENCE COMPARISON

A COMPARISON OF COMPUTATION TECHNIQUES FOR DNA SEQUENCE COMPARISON International Journal of Research in Computer Science eissn 2249-8265 Volume 2 Issue 3 (2012) pp. 1-6 White Globe Publications A COMPARISON OF COMPUTATION TECHNIQUES FOR DNA SEQUENCE COMPARISON Harshita

More information

Core Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1

Core Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1 Core Bioinformatics 2014/2015 Code: 42397 ECTS Credits: 12 Degree Type Year Semester 4313473 Bioinformàtica/Bioinformatics OB 0 1 Contact Name: Sònia Casillas Viladerrams Email: Sonia.Casillas@uab.cat

More information

Linear Sequence Analysis. 3-D Structure Analysis

Linear Sequence Analysis. 3-D Structure Analysis Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical properties Molecular weight (MW), isoelectric point (pi), amino acid content, hydropathy (hydrophilic

More information

Bioinformatics Grid - Enabled Tools For Biologists.

Bioinformatics Grid - Enabled Tools For Biologists. Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis

More information

Computational searches of biological sequences

Computational searches of biological sequences UNAM, México, Enero 78 Computational searches of biological sequences Special thanks to all the scientis that made public available their presentations throughout the web from where many slides were taken

More information

3. About R2oDNA Designer

3. About R2oDNA Designer 3. About R2oDNA Designer Please read these publications for more details: Casini A, Christodoulou G, Freemont PS, Baldwin GS, Ellis T, MacDonald JT. R2oDNA Designer: Computational design of biologically-neutral

More information

SGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD

SGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD White Paper SGI High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems Haruna Cofer*, PhD January, 2012 Abstract The SGI High Throughput Computing (HTC) Wrapper

More information

Genome Explorer For Comparative Genome Analysis

Genome Explorer For Comparative Genome Analysis Genome Explorer For Comparative Genome Analysis Jenn Conn 1, Jo L. Dicks 1 and Ian N. Roberts 2 Abstract Genome Explorer brings together the tools required to build and compare phylogenies from both sequence

More information

Biological Databases and Protein Sequence Analysis

Biological Databases and Protein Sequence Analysis Biological Databases and Protein Sequence Analysis Introduction M. Madan Babu, Center for Biotechnology, Anna University, Chennai 25, India Bioinformatics is the application of Information technology to

More information

Biological Sequence Data Formats

Biological Sequence Data Formats Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA

More information

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each

More information

Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011

Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011 Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear

More information

Using MATLAB: Bioinformatics Toolbox for Life Sciences

Using MATLAB: Bioinformatics Toolbox for Life Sciences Using MATLAB: Bioinformatics Toolbox for Life Sciences MR. SARAWUT WONGPHAYAK BIOINFORMATICS PROGRAM, SCHOOL OF BIORESOURCES AND TECHNOLOGY, AND SCHOOL OF INFORMATION TECHNOLOGY, KING MONGKUT S UNIVERSITY

More information

Module 1. Sequence Formats and Retrieval. Charles Steward

Module 1. Sequence Formats and Retrieval. Charles Steward The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.

More information

A greedy algorithm for the DNA sequencing by hybridization with positive and negative errors and information about repetitions

A greedy algorithm for the DNA sequencing by hybridization with positive and negative errors and information about repetitions BULLETIN OF THE POLISH ACADEMY OF SCIENCES TECHNICAL SCIENCES, Vol. 59, No. 1, 2011 DOI: 10.2478/v10175-011-0015-0 Varia A greedy algorithm for the DNA sequencing by hybridization with positive and negative

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

PREDA S4-classes. Francesco Ferrari October 13, 2015

PREDA S4-classes. Francesco Ferrari October 13, 2015 PREDA S4-classes Francesco Ferrari October 13, 2015 Abstract This document provides a description of custom S4 classes used to manage data structures for PREDA: an R package for Position RElated Data Analysis.

More information

Phylogenetic Trees Made Easy

Phylogenetic Trees Made Easy Phylogenetic Trees Made Easy A How-To Manual Fourth Edition Barry G. Hall University of Rochester, Emeritus and Bellingham Research Institute Sinauer Associates, Inc. Publishers Sunderland, Massachusetts

More information

Phylogenetic Analysis using MapReduce Programming Model

Phylogenetic Analysis using MapReduce Programming Model 2015 IEEE International Parallel and Distributed Processing Symposium Workshops Phylogenetic Analysis using MapReduce Programming Model Siddesh G M, K G Srinivasa*, Ishank Mishra, Abhinav Anurag, Eklavya

More information

Chapter 6 DNA Replication

Chapter 6 DNA Replication Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore

More information

Guide for Bioinformatics Project Module 3

Guide for Bioinformatics Project Module 3 Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first

More information

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want 1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very

More information

Innovations in Molecular Epidemiology

Innovations in Molecular Epidemiology Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether

More information

Apply PERL to BioInformatics (II)

Apply PERL to BioInformatics (II) Apply PERL to BioInformatics (II) Lecture Note for Computational Biology 1 (LSM 5191) Jiren Wang http://www.bii.a-star.edu.sg/~jiren BioInformatics Institute Singapore Outline Some examples for manipulating

More information

Analyzing A DNA Sequence Chromatogram

Analyzing A DNA Sequence Chromatogram LESSON 9 HANDOUT Analyzing A DNA Sequence Chromatogram Student Researcher Background: DNA Analysis and FinchTV DNA sequence data can be used to answer many types of questions. Because DNA sequences differ

More information

BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16

BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16 Course Director: Dr. Barry Grant (DCM&B, bjgrant@med.umich.edu) Description: This is a three module course covering (1) Foundations of Bioinformatics, (2) Statistics in Bioinformatics, and (3) Systems

More information

Module 10: Bioinformatics

Module 10: Bioinformatics Module 10: Bioinformatics 1.) Goal: To understand the general approaches for basic in silico (computer) analysis of DNA- and protein sequences. We are going to discuss sequence formatting required prior

More information

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized: Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took

More information

HIV NOMOGRAM USING BIG DATA ANALYTICS

HIV NOMOGRAM USING BIG DATA ANALYTICS HIV NOMOGRAM USING BIG DATA ANALYTICS S.Avudaiselvi and P.Tamizhchelvi Student Of Ayya Nadar Janaki Ammal College (Sivakasi) Head Of The Department Of Computer Science, Ayya Nadar Janaki Ammal College

More information

Biological Sciences Initiative. Human Genome

Biological Sciences Initiative. Human Genome Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.

More information

Efficient Parallel Execution of Sequence Similarity Analysis Via Dynamic Load Balancing

Efficient Parallel Execution of Sequence Similarity Analysis Via Dynamic Load Balancing Efficient Parallel Execution of Sequence Similarity Analysis Via Dynamic Load Balancing James D. Jackson Philip J. Hatcher Department of Computer Science Kingsbury Hall University of New Hampshire Durham,

More information

Developing an interactive webbased learning. environment for bioinformatics. Master thesis. Daniel Løkken Rustad UNIVERSITY OF OSLO

Developing an interactive webbased learning. environment for bioinformatics. Master thesis. Daniel Løkken Rustad UNIVERSITY OF OSLO UNIVERSITY OF OSLO Department of Informatics Developing an interactive webbased learning environment for bioinformatics Master thesis Daniel Løkken Rustad 27th July 2005 Preface Preface This thesis is

More information

Geospiza s Finch-Server: A Complete Data Management System for DNA Sequencing

Geospiza s Finch-Server: A Complete Data Management System for DNA Sequencing KOO10 5/31/04 12:17 PM Page 131 10 Geospiza s Finch-Server: A Complete Data Management System for DNA Sequencing Sandra Porter, Joe Slagel, and Todd Smith Geospiza, Inc., Seattle, WA Introduction The increased

More information

Multiple Sequence Alignment. Hot Topic 5/24/06 Kim Walker

Multiple Sequence Alignment. Hot Topic 5/24/06 Kim Walker Multiple Sequence Alignment Hot Topic 5/24/06 Kim Walker Outline Why are Multiple Sequence Alignments useful? What Tools are Available? Brief Introduction to ClustalX Tools to Edit and Add Features to

More information

Final Project Report

Final Project Report CPSC545 by Introduction to Data Mining Prof. Martin Schultz & Prof. Mark Gerstein Student Name: Yu Kor Hugo Lam Student ID : 904907866 Due Date : May 7, 2007 Introduction Final Project Report Pseudogenes

More information

Introduction to Genome Annotation

Introduction to Genome Annotation Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT

More information

Hidden Markov Models

Hidden Markov Models 8.47 Introduction to omputational Molecular Biology Lecture 7: November 4, 2004 Scribe: Han-Pang hiu Lecturer: Ross Lippert Editor: Russ ox Hidden Markov Models The G island phenomenon The nucleotide frequencies

More information

The Central Dogma of Molecular Biology

The Central Dogma of Molecular Biology Vierstraete Andy (version 1.01) 1/02/2000 -Page 1 - The Central Dogma of Molecular Biology Figure 1 : The Central Dogma of molecular biology. DNA contains the complete genetic information that defines

More information

Data for phylogenetic analysis

Data for phylogenetic analysis Data for phylogenetic analysis The data that are used to estimate the phylogeny of a set of tips are the characteristics of those tips. Therefore the success of phylogenetic inference depends in large

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

Interaktionen von RNAs und Proteinen

Interaktionen von RNAs und Proteinen Sonja Prohaska Computational EvoDevo Universitaet Leipzig June 9, 2015 Studying RNA-protein interactions Given: target protein known to bind to RNA problem: find binding partners and binding sites experimental

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

Protein Sequence Analysis - Overview -

Protein Sequence Analysis - Overview - Protein Sequence Analysis - Overview - UDEL Workshop Raja Mazumder Research Associate Professor, Department of Biochemistry and Molecular Biology Georgetown University Medical Center Topics Why do protein

More information

Usability in bioinformatics mobile applications

Usability in bioinformatics mobile applications Usability in bioinformatics mobile applications what we are working on Noura Chelbah, Sergio Díaz, Óscar Torreño, and myself Juan Falgueras App name Performs Advantajes Dissatvantajes Link The problem

More information

BASIC STATISTICAL METHODS FOR GENOMIC DATA ANALYSIS

BASIC STATISTICAL METHODS FOR GENOMIC DATA ANALYSIS BASIC STATISTICAL METHODS FOR GENOMIC DATA ANALYSIS SEEMA JAGGI Indian Agricultural Statistics Research Institute Library Avenue, New Delhi-110 012 seema@iasri.res.in Genomics A genome is an organism s

More information

EMBOSS A data analysis package

EMBOSS A data analysis package EMBOSS A data analysis package Adapted from course developed by Lisa Mullin (EMBL-EBI) and David Judge Cambridge University EMBOSS is a free Open Source software analysis package specially developed for

More information

Hidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006

Hidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006 Hidden Markov Models in Bioinformatics By Máthé Zoltán Kőrösi Zoltán 2006 Outline Markov Chain HMM (Hidden Markov Model) Hidden Markov Models in Bioinformatics Gene Finding Gene Finding Model Viterbi algorithm

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

MUTATION, DNA REPAIR AND CANCER

MUTATION, DNA REPAIR AND CANCER MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful

More information

Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS

Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS Lab 2/Phylogenetics/September 16, 2002 1 Read: Tudge Chapter 2 PHYLOGENETICS Objective of the Lab: To understand how DNA and protein sequence information can be used to make comparisons and assess evolutionary

More information

Lecture 4: Exact string searching algorithms. Exact string search algorithms. Definitions. Exact string searching or matching

Lecture 4: Exact string searching algorithms. Exact string search algorithms. Definitions. Exact string searching or matching COSC 348: Computing for Bioinformatics Definitions A pattern (keyword) is an ordered sequence of symbols. Lecture 4: Exact string searching algorithms Lubica Benuskova http://www.cs.otago.ac.nz/cosc348/

More information

Gene mutation and molecular medicine Chapter 15

Gene mutation and molecular medicine Chapter 15 Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to

More information

MASCOT Search Results Interpretation

MASCOT Search Results Interpretation The Mascot protein identification program (Matrix Science, Ltd.) uses statistical methods to assess the validity of a match. MS/MS data is not ideal. That is, there are unassignable peaks (noise) and usually

More information

Sequencing of DNA modifications

Sequencing of DNA modifications Sequencing of DNA modifications part of High-Throughput Analyzes of Genome Sequenzes Bioinformatics University of Leipzig Leipzig, WS 2014/15 Chemical modifications DNA modifications: 5-Methylcytosine

More information

Gene Models & Bed format: What they represent.

Gene Models & Bed format: What they represent. GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,

More information

1. INTRODUCTION TABLE OF CONTENTS INTRODUCTION 1-3. How This Guide Is Organized 1-3 Additional Documentation 1-4 Conventions Used in This Guide 1-4

1. INTRODUCTION TABLE OF CONTENTS INTRODUCTION 1-3. How This Guide Is Organized 1-3 Additional Documentation 1-4 Conventions Used in This Guide 1-4 1. INTRODUCTION TABLE OF CONTENTS The Introduction to the HUSAR/GCG User s Guide describes basic information you need to get started with the HUSAR/GCG Sequence Analysis Software Package. INTRODUCTION

More information

Genetomic Promototypes

Genetomic Promototypes Genetomic Promototypes Mirkó Palla and Dana Pe er Department of Mechanical Engineering Clarkson University Potsdam, New York and Department of Genetics Harvard Medical School 77 Avenue Louis Pasteur Boston,

More information

Choices, choices, choices... Which sequence database? Which modifications? What mass tolerance?

Choices, choices, choices... Which sequence database? Which modifications? What mass tolerance? Optimization 1 Choices, choices, choices... Which sequence database? Which modifications? What mass tolerance? Where to begin? 2 Sequence Databases Swiss-prot MSDB, NCBI nr dbest Species specific ORFS

More information

Human-Mouse Synteny in Functional Genomics Experiment

Human-Mouse Synteny in Functional Genomics Experiment Human-Mouse Synteny in Functional Genomics Experiment Ksenia Krasheninnikova University of the Russian Academy of Sciences, JetBrains krasheninnikova@gmail.com September 18, 2012 Ksenia Krasheninnikova

More information

An FPGA Acceleration of Short Read Human Genome Mapping

An FPGA Acceleration of Short Read Human Genome Mapping An FPGA Acceleration of Short Read Human Genome Mapping Corey Bruce Olson A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science in Electrical Engineering University

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

Dynamic Programming. Lecture 11. 11.1 Overview. 11.2 Introduction

Dynamic Programming. Lecture 11. 11.1 Overview. 11.2 Introduction Lecture 11 Dynamic Programming 11.1 Overview Dynamic Programming is a powerful technique that allows one to solve many different types of problems in time O(n 2 ) or O(n 3 ) for which a naive approach

More information

Activity 7.21 Transcription factors

Activity 7.21 Transcription factors Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation

More information

Okami Study Guide: Chapter 3 1

Okami Study Guide: Chapter 3 1 Okami Study Guide: Chapter 3 1 Chapter in Review 1. Heredity is the tendency of offspring to resemble their parents in various ways. Genes are units of heredity. They are functional strands of DNA grouped

More information

BUDAPEST: Bioinformatics Utility for Data Analysis of Proteomics using ESTs

BUDAPEST: Bioinformatics Utility for Data Analysis of Proteomics using ESTs BUDAPEST: Bioinformatics Utility for Data Analysis of Proteomics using ESTs Richard J. Edwards 2008. Contents 1. Introduction... 2 1.1. Version...2 1.2. Using this Manual...2 1.3. Why use BUDAPEST?...2

More information

Genomes and SNPs in Malaria and Sickle Cell Anemia

Genomes and SNPs in Malaria and Sickle Cell Anemia Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing

More information

Current Motif Discovery Tools and their Limitations

Current Motif Discovery Tools and their Limitations Current Motif Discovery Tools and their Limitations Philipp Bucher SIB / CIG Workshop 3 October 2006 Trendy Concepts and Hypotheses Transcription regulatory elements act in a context-dependent manner.

More information