Pairwise Sequence Alignment
|
|
- Richard Jennings
- 8 years ago
- Views:
Transcription
1 Pairwise Sequence Alignment SS 2013
2 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics
3 What is a Sequence Alignment? Quite simply, the comparison of two or more DNA or protein sequences to each other. The purpose of alignment is to highlight similarity between sequences. Alignment is the procedure of writing two (or more) sequences in a way that a maximum of identical or similar characters are placed in the same column by -
4 Word Alignment Species 1: SOMEONE Species 2: AWESOME Species 1: SOMEONE Species 2: AWESOME - - -
5 Less trivial Species 1: ACGTTAGA Species 2: CGTTGAA Species 1: ACGTTAGA Species 2: CGTTGAA Species 1: ACGTTAGA Species 2: - CGTT- GAA
6 Less trivial Species 1: ACGTTAGA Species 2: CGTTGAA score: -15 (gaps = -1, match = 1) Species 1: ACGTTAGA Species 2: - CGTT - GAA score: 3
7 FASTA Format - Input Standard input format for alignment programs >Name1 ASEQUENCE1 >Name2 comments SEQU CE2 Strictly speaking, should not contain gaps
8 FASTA Format - Output Increasingly, multiple alignment returned in FASTAlike format >Name1 ASEQUENCE1 >Name2 comments -SEQU--CE2 etc... - Order of sequences may be different in output to input.
9 Relatedness of residues in same column Making these alignments is EASY... As we know where and which evolutionary events occurred - and must infer it
10 Quiz Which alignment (X, Y or Z) shows only residues related by substitution events in the same column?
11 Types of alignments methods We cannot enummerate all possible alignments. Approaches are: Dot matrix Dynamic Programming Word-based or k-tupel methods (database searches)
12 Dot Matrix Given two
13 In a dot matrix we can identify: Existing alignable parts of sequences Possible indels Duplicated sequences and repeats Self-complementarity Gene-order differences among genomes
14 Dot plots
15 a) A continuous main diagonal shows perfect similarity for symbols with the same indices. b) Parallels to the main diagonal indicate repeated regions in the same reading direction on different parts of the sequences. In this case a region D is found twice in the sequence (D1, D2, so called c) Lines perpendicular to the main diagonal indicate palindromic areas. In this case the sequence is completely palindromic in the displayed area. d) Partially palindromic sequence (For DNA sequences this refers to a perfect match of the normal strand with its reverse complement, which is frequently found for many transposable elements. e) Bold blocks on the main diagonal indicate repetition of the same symbol in both sequences, e.g. (G)50, so called microsatellite repeats f) Parallel lines indicate tandem repeats of a larger motif in both sequences, e.g. (AGCTCTGAC)20, so called minisatellite patterns. The distance between the diagonals equals the distance of the motif. g) When the diagonal is a discontinuous line this indicates that the sequences T1 and T2 share a common source. In literal analyses we may have to deal with plagiarism or in DNA analyses sequences may be homologous because of a common ancestor. The number of interruptions increases with modifications on the text or the time of independent evolution and mutation rate. h) indel sequences this can be often observed for many different types of domains, which got lost or substituted during evolution.
16 Aligning a pair of sequences gap = -15 match = +10, mismatch = 0 Aim: get from one corner to other Moves have a cost Choose cheapest way Fill in table Trace route backwards to find alignment
17 Aligning a pair of sequences (Dynamic Programming) Aim: get from one corner to other Moves have a cost Choose cheapest way Fill in table Trace route backwards to find alignment A G G G A - - G C Aim: get from one corner to other Moves have a cost Choose cheapest way Fill in table Trace route backwards to find alignment A G G G T T T G C
18 Needlemann-Wunsch Algorithm Initialize NxM matrix with the sequences A and B of length N and M Starting at the top left corner set the intermediate scoring value =
19 Substitution matrices Some amino acids are more similar than others Adjust cost according to some similarity matrix E.g. Blosum62 Leu -> Leu: 4 Leu -> Met: 2 Leu -> Pro: etc.
20 Gap panalties Gaps tend to occur together one penalty unrealistic a gap of length three should not cost three times as much Use affine gap cost Make extending an already existing gap cheaper Gap opening (G) / gap extension (E) Total cost for gap length x: G + x E
21 Global vs Local Alignment Global: Find the best overall alignment between sequences. Local: Find short regions of highly conserved sequence.
22 Global vs Local Species 1: SOMEONE Species 2: AWESOME Species 1: SOMEONE Species 2: AWESOME Species 1: SOME Species 2: SOME
23 Smith Watermann Algorithm Instead of looking at each sequence in its entirety this compares segments of all possible lengths (LOCAL alignments) and chooses whichever maximizes the similarity For every cell the algorithm calculates ALL possible paths leading to it. These paths can be of any length and contain insertions and deletions
24 Calculating significance We have calculated the optimal alignment the alignment with the best score related or not call this the maximum segment pair (MSP) How many MSPs do we expect with at least the same score by chance?
25 Calculating significance We make use of the extreme value distribution (EVD) to calculate the number of alignments between random sequences that we expect given our score or better This is known as the e-value E(S) = Kmn K and = scaling parameters calculated based on the search space (K) and scoring scheme ( ) m, n = size of the search space The probability of finding at least one match with our score(the p value) 1-e -E(S) As both the e value and the p value decrease, the biological significance increases
26 BLAST Basic Local Alignment Search Tool: Used to find local sequence alignments between protein and nucleotide sequences (Altschul et al., 1990, cited over 43,000 times) Heuristic so it is an approximate best match (SW is a guarantee) calculate the high scoring matches instead of the maximum scoring matches (HSP instead of MSP)
27 BLAST 28, we will look at 4) GTTCACATCATCCTGC GTTC TTCA TCAC CACA ACAT CATC ATCA...
28 BLAST on scoring matrices) you could call this the neighborhood GTTCACATCATCCTGC GTTC: CTTC,GTTC,GATC... TTCA: TTCT,TTGA,TTGT... TCAC: AGAC,CCAC,TCTG... CACA:... ACAT:... CATC:... ATCA:......
29 BLAST calculate E values expectation that you would get that alignment by change given the database of sequences return significant results we already talked about these e-values and p-values with Smith-Waterman significance
30 BLAST Types: Nucleotide vs. Nucleotide: blastn Protein vs Protein: blastp Translated Nucleotide vs Protein: blastx Protein vs Translated Nucleotide: tblastn Translated Nucleotide vs translated database: tblastx
31 DNA vs protein Should you use blastn or blastp? There are four potential nucleotides A,C,GT and therefore four potential states There are 22 standard amino acids and therefore 22 potential states blastp should be more sensitive because of the lower chance of a random hit than blastn because of the state space If there is the possibility of highly similar sequences, DNA works well intergenic spacers RNA genes
32 Things to consider nothing is 90% homologous there may be a degree of your belief in homology statistical significance depends on the size of the alignments and the database e-value increases as database gets bigger more chance for a random hit e-value decreases as alignments get longer more significant the longer the alignment
33 Therefore sequence similarity can suggest homology a significant alignment over the length of both sequences strongly suggests homology homologous sequences do not always produce significant alignments! regions with low complexity (but that are not cleaned out by initial steps in BLAST) can produce significant alignments with no homology
34 Rules There are no hard and fast rules Nucleotides it has been suggested that sequence identity of more than 70% suggests homology e-values of 10^-6 or less too bad Proteins 25% or more sequence identity e-values of 10^-3 or less nope you have to verify somehow, and if you are high throughput, there will be errors
35 Next We will go over some examples in lab Needleman-Wunsch BLAST
BLAST. Anders Gorm Pedersen & Rasmus Wernersson
BLAST Anders Gorm Pedersen & Rasmus Wernersson Database searching Using pairwise alignments to search databases for similar sequences Query sequence Database Database searching Most common use of pairwise
More informationRETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
More informationSimilarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003
Similarity Searches on Sequence Databases: BLAST, FASTA Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Outline Importance of Similarity Heuristic Sequence Alignment:
More informationProtein & DNA Sequence Analysis. Bobbie-Jo Webb-Robertson May 3, 2004
Protein & DNA Sequence Analysis Bobbie-Jo Webb-Robertson May 3, 2004 Sequence Analysis Anything connected to identifying higher biological meaning out of raw sequence data. 2 Genomic & Proteomic Data Sequence
More informationBio-Informatics Lectures. A Short Introduction
Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively
More informationPROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org
BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,
More informationBioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
More informationRapid alignment methods: FASTA and BLAST. p The biological problem p Search strategies p FASTA p BLAST
Rapid alignment methods: FASTA and BLAST p The biological problem p Search strategies p FASTA p BLAST 257 BLAST: Basic Local Alignment Search Tool p BLAST (Altschul et al., 1990) and its variants are some
More informationNetwork Protocol Analysis using Bioinformatics Algorithms
Network Protocol Analysis using Bioinformatics Algorithms Marshall A. Beddoe Marshall_Beddoe@McAfee.com ABSTRACT Network protocol analysis is currently performed by hand using only intuition and a protocol
More informationIntroduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
More informationClone Manager. Getting Started
Clone Manager for Windows Professional Edition Volume 2 Alignment, Primer Operations Version 9.5 Getting Started Copyright 1994-2015 Scientific & Educational Software. All rights reserved. The software
More informationAmino Acids and Their Properties
Amino Acids and Their Properties Recap: ss-rrna and mutations Ribosomal RNA (rrna) evolves very slowly Much slower than proteins ss-rrna is typically used So by aligning ss-rrna of one organism with that
More informationBIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:
More informationBIOINFORMATICS TUTORIAL
Bio 242 BIOINFORMATICS TUTORIAL Bio 242 α Amylase Lab Sequence Sequence Searches: BLAST Sequence Alignment: Clustal Omega 3d Structure & 3d Alignments DO NOT REMOVE FROM LAB. DO NOT WRITE IN THIS DOCUMENT.
More informationWelcome to the Plant Breeding and Genomics Webinar Series
Welcome to the Plant Breeding and Genomics Webinar Series Today s Presenter: Dr. Candice Hansey Presentation: http://www.extension.org/pages/ 60428 Host: Heather Merk Technical Production: John McQueen
More informationA Tutorial in Genetic Sequence Classification Tools and Techniques
A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University jakemdrew@gmail.com www.jakemdrew.com Sequence Characters IUPAC nucleotide
More informationMolecular Databases and Tools
NWeHealth, The University of Manchester Molecular Databases and Tools Afternoon Session: NCBI/EBI resources, pairwise alignment, BLAST, multiple sequence alignment and primer finding. Dr. Georgina Moulton
More informationDatabase searching with DNA and protein sequences: An introduction Clare Sansom Date received (in revised form): 12th November 1999
Dr Clare Sansom works part time at Birkbeck College, London, and part time as a freelance computer consultant and science writer At Birkbeck she coordinates an innovative graduate-level Advanced Certificate
More informationDNA Printer - A Brief Course in sequence Analysis
Last modified August 19, 2015 Brian Golding, Dick Morton and Wilfried Haerty Department of Biology McMaster University Hamilton, Ontario L8S 4K1 ii These notes are in Adobe Acrobat format (they are available
More informationFocusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
More informationAlgorithms in Bioinformatics I, WS06/07, C.Dieterich 47. This lecture is based on the following, which are all recommended reading:
Algorithms in Bioinformatics I, WS06/07, C.Dieterich 47 5 BLAST and FASTA This lecture is based on the following, which are all recommended reading: D.J. Lipman and W.R. Pearson, Rapid and Sensitive Protein
More informationCD-HIT User s Guide. Last updated: April 5, 2010. http://cd-hit.org http://bioinformatics.org/cd-hit/
CD-HIT User s Guide Last updated: April 5, 2010 http://cd-hit.org http://bioinformatics.org/cd-hit/ Program developed by Weizhong Li s lab at UCSD http://weizhong-lab.ucsd.edu liwz@sdsc.edu 1. Introduction
More informationSequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment
Sequence Analysis 15: lecture 5 Substitution matrices Multiple sequence alignment A teacher's dilemma To understand... Multiple sequence alignment Substitution matrices Phylogenetic trees You first need
More informationDNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
More informationDesign Style of BLAST and FASTA and Their Importance in Human Genome.
Design Style of BLAST and FASTA and Their Importance in Human Genome. Saba Khalid 1 and Najam-ul-haq 2 SZABIST Karachi, Pakistan Abstract: This subjected study will discuss the concept of BLAST and FASTA.BLAST
More informationMORPHEUS. http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix.
MORPHEUS http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix. Reference: MORPHEUS, a Webtool for Transcripton Factor Binding Analysis Using
More informationIntroduction to Bioinformatics AS 250.265 Laboratory Assignment 6
Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6 In the last lab, you learned how to perform basic multiple sequence alignments. While useful in themselves for determining conserved residues
More informationOrdered Index Seed Algorithm for Intensive DNA Sequence Comparison
Ordered Index Seed Algorithm for Intensive DNA Sequence Comparison Dominique Lavenier IRISA / CNRS Campus de Beaulieu 35042 Rennes, France lavenier@irisa.fr Abstract This paper presents a seed-based algorithm
More informationBioinformática BLAST. Blast information guide. Buscas de sequências semelhantes. Search for Homologies BLAST
BLAST Bioinformática Search for Homologies BLAST BLAST - Basic Local Alignment Search Tool http://blastncbinlmnihgov/blastcgi 1 2 Blast information guide Buscas de sequências semelhantes http://blastncbinlmnihgov/blastcgi?cmd=web&page_type=blastdocs
More informationHeuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations
Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations AlCoB 2014 First International Conference on Algorithms for Computational Biology Thiago da Silva Arruda Institute
More informationA COMPARISON OF COMPUTATION TECHNIQUES FOR DNA SEQUENCE COMPARISON
International Journal of Research in Computer Science eissn 2249-8265 Volume 2 Issue 3 (2012) pp. 1-6 White Globe Publications A COMPARISON OF COMPUTATION TECHNIQUES FOR DNA SEQUENCE COMPARISON Harshita
More informationCore Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1
Core Bioinformatics 2014/2015 Code: 42397 ECTS Credits: 12 Degree Type Year Semester 4313473 Bioinformàtica/Bioinformatics OB 0 1 Contact Name: Sònia Casillas Viladerrams Email: Sonia.Casillas@uab.cat
More informationLinear Sequence Analysis. 3-D Structure Analysis
Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical properties Molecular weight (MW), isoelectric point (pi), amino acid content, hydropathy (hydrophilic
More informationBioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
More informationComputational searches of biological sequences
UNAM, México, Enero 78 Computational searches of biological sequences Special thanks to all the scientis that made public available their presentations throughout the web from where many slides were taken
More information3. About R2oDNA Designer
3. About R2oDNA Designer Please read these publications for more details: Casini A, Christodoulou G, Freemont PS, Baldwin GS, Ellis T, MacDonald JT. R2oDNA Designer: Computational design of biologically-neutral
More informationSGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD
White Paper SGI High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems Haruna Cofer*, PhD January, 2012 Abstract The SGI High Throughput Computing (HTC) Wrapper
More informationGenome Explorer For Comparative Genome Analysis
Genome Explorer For Comparative Genome Analysis Jenn Conn 1, Jo L. Dicks 1 and Ian N. Roberts 2 Abstract Genome Explorer brings together the tools required to build and compare phylogenies from both sequence
More informationBiological Databases and Protein Sequence Analysis
Biological Databases and Protein Sequence Analysis Introduction M. Madan Babu, Center for Biotechnology, Anna University, Chennai 25, India Bioinformatics is the application of Information technology to
More informationBiological Sequence Data Formats
Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA
More informationSeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications
Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each
More informationSequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011
Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear
More informationUsing MATLAB: Bioinformatics Toolbox for Life Sciences
Using MATLAB: Bioinformatics Toolbox for Life Sciences MR. SARAWUT WONGPHAYAK BIOINFORMATICS PROGRAM, SCHOOL OF BIORESOURCES AND TECHNOLOGY, AND SCHOOL OF INFORMATION TECHNOLOGY, KING MONGKUT S UNIVERSITY
More informationModule 1. Sequence Formats and Retrieval. Charles Steward
The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.
More informationA greedy algorithm for the DNA sequencing by hybridization with positive and negative errors and information about repetitions
BULLETIN OF THE POLISH ACADEMY OF SCIENCES TECHNICAL SCIENCES, Vol. 59, No. 1, 2011 DOI: 10.2478/v10175-011-0015-0 Varia A greedy algorithm for the DNA sequencing by hybridization with positive and negative
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
More informationPREDA S4-classes. Francesco Ferrari October 13, 2015
PREDA S4-classes Francesco Ferrari October 13, 2015 Abstract This document provides a description of custom S4 classes used to manage data structures for PREDA: an R package for Position RElated Data Analysis.
More informationPhylogenetic Trees Made Easy
Phylogenetic Trees Made Easy A How-To Manual Fourth Edition Barry G. Hall University of Rochester, Emeritus and Bellingham Research Institute Sinauer Associates, Inc. Publishers Sunderland, Massachusetts
More informationPhylogenetic Analysis using MapReduce Programming Model
2015 IEEE International Parallel and Distributed Processing Symposium Workshops Phylogenetic Analysis using MapReduce Programming Model Siddesh G M, K G Srinivasa*, Ishank Mishra, Abhinav Anurag, Eklavya
More informationChapter 6 DNA Replication
Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore
More informationGuide for Bioinformatics Project Module 3
Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first
More informationWhen you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want
1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very
More informationInnovations in Molecular Epidemiology
Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether
More informationApply PERL to BioInformatics (II)
Apply PERL to BioInformatics (II) Lecture Note for Computational Biology 1 (LSM 5191) Jiren Wang http://www.bii.a-star.edu.sg/~jiren BioInformatics Institute Singapore Outline Some examples for manipulating
More informationAnalyzing A DNA Sequence Chromatogram
LESSON 9 HANDOUT Analyzing A DNA Sequence Chromatogram Student Researcher Background: DNA Analysis and FinchTV DNA sequence data can be used to answer many types of questions. Because DNA sequences differ
More informationBIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16
Course Director: Dr. Barry Grant (DCM&B, bjgrant@med.umich.edu) Description: This is a three module course covering (1) Foundations of Bioinformatics, (2) Statistics in Bioinformatics, and (3) Systems
More informationModule 10: Bioinformatics
Module 10: Bioinformatics 1.) Goal: To understand the general approaches for basic in silico (computer) analysis of DNA- and protein sequences. We are going to discuss sequence formatting required prior
More informationThe sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:
Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How
More informationDNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
More informationNext Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took
More informationHIV NOMOGRAM USING BIG DATA ANALYTICS
HIV NOMOGRAM USING BIG DATA ANALYTICS S.Avudaiselvi and P.Tamizhchelvi Student Of Ayya Nadar Janaki Ammal College (Sivakasi) Head Of The Department Of Computer Science, Ayya Nadar Janaki Ammal College
More informationBiological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
More informationEfficient Parallel Execution of Sequence Similarity Analysis Via Dynamic Load Balancing
Efficient Parallel Execution of Sequence Similarity Analysis Via Dynamic Load Balancing James D. Jackson Philip J. Hatcher Department of Computer Science Kingsbury Hall University of New Hampshire Durham,
More informationDeveloping an interactive webbased learning. environment for bioinformatics. Master thesis. Daniel Løkken Rustad UNIVERSITY OF OSLO
UNIVERSITY OF OSLO Department of Informatics Developing an interactive webbased learning environment for bioinformatics Master thesis Daniel Løkken Rustad 27th July 2005 Preface Preface This thesis is
More informationGeospiza s Finch-Server: A Complete Data Management System for DNA Sequencing
KOO10 5/31/04 12:17 PM Page 131 10 Geospiza s Finch-Server: A Complete Data Management System for DNA Sequencing Sandra Porter, Joe Slagel, and Todd Smith Geospiza, Inc., Seattle, WA Introduction The increased
More informationMultiple Sequence Alignment. Hot Topic 5/24/06 Kim Walker
Multiple Sequence Alignment Hot Topic 5/24/06 Kim Walker Outline Why are Multiple Sequence Alignments useful? What Tools are Available? Brief Introduction to ClustalX Tools to Edit and Add Features to
More informationFinal Project Report
CPSC545 by Introduction to Data Mining Prof. Martin Schultz & Prof. Mark Gerstein Student Name: Yu Kor Hugo Lam Student ID : 904907866 Due Date : May 7, 2007 Introduction Final Project Report Pseudogenes
More informationIntroduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
More informationHidden Markov Models
8.47 Introduction to omputational Molecular Biology Lecture 7: November 4, 2004 Scribe: Han-Pang hiu Lecturer: Ross Lippert Editor: Russ ox Hidden Markov Models The G island phenomenon The nucleotide frequencies
More informationThe Central Dogma of Molecular Biology
Vierstraete Andy (version 1.01) 1/02/2000 -Page 1 - The Central Dogma of Molecular Biology Figure 1 : The Central Dogma of molecular biology. DNA contains the complete genetic information that defines
More informationData for phylogenetic analysis
Data for phylogenetic analysis The data that are used to estimate the phylogeny of a set of tips are the characteristics of those tips. Therefore the success of phylogenetic inference depends in large
More informationAlgorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
More informationInteraktionen von RNAs und Proteinen
Sonja Prohaska Computational EvoDevo Universitaet Leipzig June 9, 2015 Studying RNA-protein interactions Given: target protein known to bind to RNA problem: find binding partners and binding sites experimental
More informationName Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
More informationProtein Sequence Analysis - Overview -
Protein Sequence Analysis - Overview - UDEL Workshop Raja Mazumder Research Associate Professor, Department of Biochemistry and Molecular Biology Georgetown University Medical Center Topics Why do protein
More informationUsability in bioinformatics mobile applications
Usability in bioinformatics mobile applications what we are working on Noura Chelbah, Sergio Díaz, Óscar Torreño, and myself Juan Falgueras App name Performs Advantajes Dissatvantajes Link The problem
More informationBASIC STATISTICAL METHODS FOR GENOMIC DATA ANALYSIS
BASIC STATISTICAL METHODS FOR GENOMIC DATA ANALYSIS SEEMA JAGGI Indian Agricultural Statistics Research Institute Library Avenue, New Delhi-110 012 seema@iasri.res.in Genomics A genome is an organism s
More informationEMBOSS A data analysis package
EMBOSS A data analysis package Adapted from course developed by Lisa Mullin (EMBL-EBI) and David Judge Cambridge University EMBOSS is a free Open Source software analysis package specially developed for
More informationHidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006
Hidden Markov Models in Bioinformatics By Máthé Zoltán Kőrösi Zoltán 2006 Outline Markov Chain HMM (Hidden Markov Model) Hidden Markov Models in Bioinformatics Gene Finding Gene Finding Model Viterbi algorithm
More informationFrom DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
More informationMUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
More informationLab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS
Lab 2/Phylogenetics/September 16, 2002 1 Read: Tudge Chapter 2 PHYLOGENETICS Objective of the Lab: To understand how DNA and protein sequence information can be used to make comparisons and assess evolutionary
More informationLecture 4: Exact string searching algorithms. Exact string search algorithms. Definitions. Exact string searching or matching
COSC 348: Computing for Bioinformatics Definitions A pattern (keyword) is an ordered sequence of symbols. Lecture 4: Exact string searching algorithms Lubica Benuskova http://www.cs.otago.ac.nz/cosc348/
More informationGene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
More informationMASCOT Search Results Interpretation
The Mascot protein identification program (Matrix Science, Ltd.) uses statistical methods to assess the validity of a match. MS/MS data is not ideal. That is, there are unassignable peaks (noise) and usually
More informationSequencing of DNA modifications
Sequencing of DNA modifications part of High-Throughput Analyzes of Genome Sequenzes Bioinformatics University of Leipzig Leipzig, WS 2014/15 Chemical modifications DNA modifications: 5-Methylcytosine
More informationGene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
More information1. INTRODUCTION TABLE OF CONTENTS INTRODUCTION 1-3. How This Guide Is Organized 1-3 Additional Documentation 1-4 Conventions Used in This Guide 1-4
1. INTRODUCTION TABLE OF CONTENTS The Introduction to the HUSAR/GCG User s Guide describes basic information you need to get started with the HUSAR/GCG Sequence Analysis Software Package. INTRODUCTION
More informationGenetomic Promototypes
Genetomic Promototypes Mirkó Palla and Dana Pe er Department of Mechanical Engineering Clarkson University Potsdam, New York and Department of Genetics Harvard Medical School 77 Avenue Louis Pasteur Boston,
More informationChoices, choices, choices... Which sequence database? Which modifications? What mass tolerance?
Optimization 1 Choices, choices, choices... Which sequence database? Which modifications? What mass tolerance? Where to begin? 2 Sequence Databases Swiss-prot MSDB, NCBI nr dbest Species specific ORFS
More informationHuman-Mouse Synteny in Functional Genomics Experiment
Human-Mouse Synteny in Functional Genomics Experiment Ksenia Krasheninnikova University of the Russian Academy of Sciences, JetBrains krasheninnikova@gmail.com September 18, 2012 Ksenia Krasheninnikova
More informationAn FPGA Acceleration of Short Read Human Genome Mapping
An FPGA Acceleration of Short Read Human Genome Mapping Corey Bruce Olson A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science in Electrical Engineering University
More informationChapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
More informationDynamic Programming. Lecture 11. 11.1 Overview. 11.2 Introduction
Lecture 11 Dynamic Programming 11.1 Overview Dynamic Programming is a powerful technique that allows one to solve many different types of problems in time O(n 2 ) or O(n 3 ) for which a naive approach
More informationActivity 7.21 Transcription factors
Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation
More informationOkami Study Guide: Chapter 3 1
Okami Study Guide: Chapter 3 1 Chapter in Review 1. Heredity is the tendency of offspring to resemble their parents in various ways. Genes are units of heredity. They are functional strands of DNA grouped
More informationBUDAPEST: Bioinformatics Utility for Data Analysis of Proteomics using ESTs
BUDAPEST: Bioinformatics Utility for Data Analysis of Proteomics using ESTs Richard J. Edwards 2008. Contents 1. Introduction... 2 1.1. Version...2 1.2. Using this Manual...2 1.3. Why use BUDAPEST?...2
More informationGenomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
More informationCurrent Motif Discovery Tools and their Limitations
Current Motif Discovery Tools and their Limitations Philipp Bucher SIB / CIG Workshop 3 October 2006 Trendy Concepts and Hypotheses Transcription regulatory elements act in a context-dependent manner.
More information