Bioinformática BLAST. Blast information guide. Buscas de sequências semelhantes. Search for Homologies BLAST

Save this PDF as:

Size: px
Start display at page:

Download "Bioinformática BLAST. Blast information guide. Buscas de sequências semelhantes. Search for Homologies BLAST"


1 BLAST Bioinformática Search for Homologies BLAST BLAST - Basic Local Alignment Search Tool Blast information guide Buscas de sequências semelhantes Muito usado em bioinformática O objectivo é aprender mais sobre sequências de DNA, RNA e proteínas através da busca de sequências semelhantes com funções conhecidas A busca engloba: Software de busca Bases de dados de sequências anotadas Finalmente pretende-se obter alinhamentos de boa qualidade entre a nossa sequência e a(s) da BD 3 4 1

2 Alinhamentos e termos das buscas Alinhamento: emparelhamento de 2 sequências Termos dos alinhamentos Alinhamento (Match): duas letras idênticas numa mesma posição no alinhamento Alinhamento Global: alinha sequências na sua totalidade Alinhamento Local: procura e alinha as regiões mais semelhantes entre as sequências Falso alinhamento (Mismatch): duas letras diferentes numa mesma posição no alinhamento Intervalos (Gaps) A busca de semelhanças numa BD faz-se pelo alinhamento de uma única sequência query a cada uma das sequências da BD (sequência alvo target ) Se forem encontrados boas semelhanças a procura gera uma lista de HSPs - High-scoring Segment Pairs (alinhamentos locais entre a query e o target) Positivo: uma substituição conservativa numa posição num alinhamento Percent identity: 100 * (number of matches/length of the alignment) 7 Percent positives: 100 * (number of positives/length of the alignment) 8 BLAST - Basic Local Alignment Search Tool BLAST Statistics Altschul et al, 1990 Programa mais intensamente usado Muito rápido pois usa uma heurística para tornar a busca mais rápida, por isso não é garantido que encontre o maior score possível num alinhamento local Possui programas de buscas de alinhamentos locais de HSPs entre a sequência de busca e a base de dados alvo (DNA ou proteína) BLAST uses statistical theory to produce a bit score and expect value (E-value) for each alignment pair (query to hit) BIT SCORE The value S is derived from the raw alignment score S in which the statistical properties of the scoring system used have been taken into account By normalizing a raw score using the formula Quanto maior o valor do score melhor é o alinhamento a bit score S is attained, which has a standard set of units, and where K and lambda are the statistical parameters of the scoring system Because bit scores have been normalized with respect to the scoring system, they can be used to compare alignment scores from different searches

3 BLAST Statistics The E-value gives an indication of the statistical significance of a given pairwise alignment and reflects the size of the database and the scoring system used The lower the E-value, the more significant the hit A sequence alignment that has an E-value of 005 means that this similarity has a 5 in 100 (1 in 20) chance of occurring by chance alone Algoritmos Heurísticos de Alinhamento Parâmetros para avaliar a qualidade do alinhamento Qual a verosimilhança desta similaridade? Será que ocorreu por acaso? Although a statistician might consider this to be significant, it still may not represent a biologically meaningful result, and analysis of the alignments is required to determine biological significance BLOSUM62 Substitution Matrix A família BLAST

4 A família BLAST Sequências de nucleótidos - Que algoritmo usar? Program Selection for Nucleotide Queries Length ¹ Database Purpose Program Explanation Identify the query sequence discontiguous megablast, megablast, or blastn more 20 bp or longer Nucleotide Find sequences similar to query sequence discontiguous megablast or blastn more 28 bp or above for megablast Find similar sequence from the Trace archive Find similar proteins to translated query in a translated database Trace megablast, or more Trace discontiguous megablast Translated BLAST (tblastx) more Peptide Find similar proteins to translated query in a protein database Translated BLAST (blastx) more T translated Estes programas fazem a tradução da sequência de DNA para uma potencial proteína Só depois fazem a comparação das sequências Find primer binding sites or map short 7-20 bp Nucleotide Search for short, nearly exact matches more contiguous motifs NOTE: ¹ The cut-off is only a recommendation For short queries, one is more likely to get matches if the "Search for short, nearly exact matches" page is used Detailed discussion is in the Section 4 below With default setting, the shortest unambiguous query one can use is 11 for blastn and 28 for MEGABLAST MegaBlast Search for short nearly exact matches MEGABLAST é um serviço BLAST que aceita inquéritos múltiplos Search for short nearly exact matches" deve ser usado para procurar primers ou sequências pequenas MEGABLAST descontínuo é melhor para encontrar sequências de nucleótidos semelhantes, mas não idênticas à sua sequência query Sequências com < 20 bp normalmente não dão resultados significativos com um Blastn normal porque as restricções usadas nos cálculos do E-value são muito apertadas Parameter settings for standard blastn and "Search for short and nearly exact matches" Program Word Size DUST Filter Setting Expect Value Standard blastn 11 On 10 Search for short nearly exact matches 7 Off

5 Sequências de aa - Que programa usar? Program Selection for Protein Queries Length ¹ Database Purpose Program Explanation Identify the query sequence or find protein sequences Standard Protein BLAST (blastp) more similar to the query "Search for short nearly exact matches" Está optimizado para encontrar pequenos peptidos Recomendam-se pesquizas com mais de 5 aa Find members of a protein family or build a custom positionspecific score matrix PSI-BLAST more Peptide Find proteins similar to the query around a given pattern PHI-BLAST 15 residues or longer Find conserved domains in the query CD-search (RPS-BLAST) Find conserved domains in the query and identify other Conserved Domain Architecture proteins with similar domain architectures Retrieval Tool (CDART) Nucleotide Find similar proteins in a translated nucleotide database Translated BLAST (tblastn) Search for short, nearly exact Peptide Search for peptide motifs 5-15 residues matches more more more more more Parameter settings for standard blastp and "Search for short and nearly exact matches" Program Word Size SEG Filter Expect Value Score Matrix Standard Protein Blast 3 On 10 BLOSUM62 Search for short and nearly exact matches 2 Off PAM30 Note: ¹ The cut-off is only a recommendation For short queries, one is more likely to get matches if the "Search for short, nearly 19 exact matches" page is used Detailed discussion is in Section 4 below 20 BLASTP Exercícios Blastn & Blastx Attention to the differences between Identities and Positives 23 >1 GTTGCAGCAATGGTAGACTCAACGGTAGCAATAACTGCAGGACCTAGAGGAAAAACAGTAGGGATTAAT AAGCCCTATGGAGCACCAGAAATTACAAAAGATGGTTATAAGGTGATGAAGGGTATCAAGCCTGAAAAA CCATTAAACGCTGCGATAGCAAGCATCTTTGCACAGAGTTGTTCTCAATGTAACGATAAAGTTGGTGATGG TACAACAACGTGCTCAATACTAACTAGCAACATGATAATGGAAGCTTCAAAATCAATTGCTGCTGGAAACG ATCGTGTTGGTATTAAAAACGGAATACAGAAGGCAAAAGATGTAATATTAAAGGAAATTGCGTCAATGTC TCGTACAATTTCTCTAGAGAAAATAGACGAAGTGGCACAAGTTGCAATAATCTCTGCAAATGGTGATAAG GATATAGGTAACAGTATCGCTGATTCCGTGAAAAAAGTTGGAAAAGAGGGTGTAATAACTGTTGAAGAG AGTAAAGGTTCAAAAGAGTTAGAAGTTGAGCTGACTACTGGCATGCAATTTGATCGCGGTTATCTCTCTCC GTATTTTATTACAAATAATGAAAAAATGATCGTGGAGCTTGATAATCCTTATCTATTAATTACAGAGAAAA AATTAAATATTATTCAACCTTTACTTCCTATTCTTGAAGCTATTGTTAAATCTGGTAAACCTTTGGTTATTATT GCAGAGGATATCGAAGGTGAAGCATTAAGCACTTTAGTTATCAATAAATTGCGTGGTGGTTTAAAAGTTG CTGCAGTAAAAGCTCCAGGTTTTGGTGACAGAAGAAAGGAGATGCTCGAAGACATAGCAACTTTAACTGG TGCTAAGTACGTC ATAAAAGATGAACTT >2 GTTGCAGCAATGGTAGACTCAACGGTAGCAATAACTGCAGGACCTAGAGGAAAAACAGTAGGGATTAAT AAGCCCTATGGAGCACCAGAAATTACAAAAGATGGTTATAAGGTGATGAAGGGTATCAAGCCTGAA 24 5


BLAST. Anders Gorm Pedersen & Rasmus Wernersson

BLAST. Anders Gorm Pedersen & Rasmus Wernersson BLAST Anders Gorm Pedersen & Rasmus Wernersson Database searching Using pairwise alignments to search databases for similar sequences Query sequence Database Database searching Most common use of pairwise

More information

Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003

Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Similarity Searches on Sequence Databases: BLAST, FASTA Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Outline Importance of Similarity Heuristic Sequence Alignment:

More information

Pairwise Sequence Alignment

Pairwise Sequence Alignment Pairwise Sequence Alignment SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Protein & DNA Sequence Analysis. Bobbie-Jo Webb-Robertson May 3, 2004

Protein & DNA Sequence Analysis. Bobbie-Jo Webb-Robertson May 3, 2004 Protein & DNA Sequence Analysis Bobbie-Jo Webb-Robertson May 3, 2004 Sequence Analysis Anything connected to identifying higher biological meaning out of raw sequence data. 2 Genomic & Proteomic Data Sequence

More information

Algorithms for Sequence Alignment. Dynamic programming

Algorithms for Sequence Alignment. Dynamic programming Algorithms for Sequence Alignment Previous lectures Global alignment (Needleman-Wunsch algorithm) Local alignment (Smith-Waterman algorithm) Heuristic method BLAST Statistics of BLAST scores Dynamic programming

More information


BIOINFORMATICS TUTORIAL Bio 242 BIOINFORMATICS TUTORIAL Bio 242 α Amylase Lab Sequence Sequence Searches: BLAST Sequence Alignment: Clustal Omega 3d Structure & 3d Alignments DO NOT REMOVE FROM LAB. DO NOT WRITE IN THIS DOCUMENT.

More information

Score, Bit-score, P-value, E-value

Score, Bit-score, P-value, E-value Score, Bit-score, P-value, E-value Score: A number used to assess the biological relevance of a finding. In the context of sequence alignments, a score is a numerical value that describes the overall quality

More information

Database searching with DNA and protein sequences: An introduction Clare Sansom Date received (in revised form): 12th November 1999

Database searching with DNA and protein sequences: An introduction Clare Sansom Date received (in revised form): 12th November 1999 Dr Clare Sansom works part time at Birkbeck College, London, and part time as a freelance computer consultant and science writer At Birkbeck she coordinates an innovative graduate-level Advanced Certificate

More information

A Tutorial in Genetic Sequence Classification Tools and Techniques

A Tutorial in Genetic Sequence Classification Tools and Techniques A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University Sequence Characters IUPAC nucleotide

More information

Algorithms in Bioinformatics I, WS06/07, C.Dieterich 47. This lecture is based on the following, which are all recommended reading:

Algorithms in Bioinformatics I, WS06/07, C.Dieterich 47. This lecture is based on the following, which are all recommended reading: Algorithms in Bioinformatics I, WS06/07, C.Dieterich 47 5 BLAST and FASTA This lecture is based on the following, which are all recommended reading: D.J. Lipman and W.R. Pearson, Rapid and Sensitive Protein

More information



More information

Exercise 11 - Understanding the Output for a blastn Search (excerpted from a document created by Wilson Leung, Washington University)

Exercise 11 - Understanding the Output for a blastn Search (excerpted from a document created by Wilson Leung, Washington University) Exercise 11 - Understanding the Output for a blastn Search (excerpted from a document created by Wilson Leung, Washington University) Read the following tutorial to better understand the BLAST report for

More information

Laboratorio di Bioinformatica

Laboratorio di Bioinformatica Laboratorio di Bioinformatica Lezione #2 Dr. Marco Fondi Contact: tel. 0552288308 di Biologia Evoluzionistica Laboratorio di Evoluzione Microbica e Molecolare,

More information

DNA sequencing. Dideoxy-terminating sequencing or Sanger dideoxy sequencing

DNA sequencing. Dideoxy-terminating sequencing or Sanger dideoxy sequencing DNA sequencing Dideoxy-terminating sequencing or Sanger dideoxy sequencing Tools DNA template (single stranded) Specific primer (usually 17-23 mer, free 3 -OH) dntps DNA polymerase capacity of polymerizing

More information

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

Design Style of BLAST and FASTA and Their Importance in Human Genome.

Design Style of BLAST and FASTA and Their Importance in Human Genome. Design Style of BLAST and FASTA and Their Importance in Human Genome. Saba Khalid 1 and Najam-ul-haq 2 SZABIST Karachi, Pakistan Abstract: This subjected study will discuss the concept of BLAST and FASTA.BLAST

More information

Welcome to the Plant Breeding and Genomics Webinar Series

Welcome to the Plant Breeding and Genomics Webinar Series Welcome to the Plant Breeding and Genomics Webinar Series Today s Presenter: Dr. Candice Hansey Presentation: 60428 Host: Heather Merk Technical Production: John McQueen

More information

A polynucleotide consisting of the nucleotide sequence of SEQ ID NO:2.

A polynucleotide consisting of the nucleotide sequence of SEQ ID NO:2. Case A A polynucleotide consisting of the nucleotide sequence of SEQ ID NO:1 nucleotide sequence of SEQ ID NO:1 is one of the sequences which were analyzed using an automated DNA sequencer The sequences

More information

03 infra TI RAID. MTBF; RAID Protection; Mirroring and Parity; RAID levels; write penalty

03 infra TI RAID. MTBF; RAID Protection; Mirroring and Parity; RAID levels; write penalty 03 infra TI RAID MTBF; RAID Protection; Mirroring and Parity; RAID levels; write penalty Por que RAID? Redundant Array Inexpensive Disks x Redudant Array Independent Disks Performance limitation of disk

More information

Seu servidor deverá estar com a versão 3.24 ou superior do Mikrotik RouterOS e no mínimo 4 (quatro) placas de rede.

Seu servidor deverá estar com a versão 3.24 ou superior do Mikrotik RouterOS e no mínimo 4 (quatro) placas de rede. Provedor de Internet e Serviços - (41) 3673-5879 Balance PCC para 3 links adsl com modem em bridge (2 links de 8mb, 1 link de 2mb). Seu servidor deverá estar com a versão 3.24 ou superior do Mikrotik RouterOS

More information

Rapid alignment methods: FASTA and BLAST. p The biological problem p Search strategies p FASTA p BLAST

Rapid alignment methods: FASTA and BLAST. p The biological problem p Search strategies p FASTA p BLAST Rapid alignment methods: FASTA and BLAST p The biological problem p Search strategies p FASTA p BLAST 257 BLAST: Basic Local Alignment Search Tool p BLAST (Altschul et al., 1990) and its variants are some

More information

NSilico Life Science Introductory Bioinformatics Course

NSilico Life Science Introductory Bioinformatics Course NSilico Life Science Introductory Bioinformatics Course INTRODUCTORY BIOINFORMATICS COURSE A public course delivered over three days on the fundamentals of bioinformatics and illustrated with lectures,

More information

Accelerated BLAST Performance with Tera-BLAST : a comparison of FPGA versus GPU and CPU BLAST implementations

Accelerated BLAST Performance with Tera-BLAST : a comparison of FPGA versus GPU and CPU BLAST implementations Technical Note Accelerated BLAST Performance with : a comparison of FPGA versus GPU and CPU BLAST implementations TimeLogic Division, Active Motif Inc, 1914 Palomar Oaks Way, Suite 150, Carlsbad, CA 92008

More information

Clone Manager. Getting Started

Clone Manager. Getting Started Clone Manager for Windows Professional Edition Volume 2 Alignment, Primer Operations Version 9.5 Getting Started Copyright 1994-2015 Scientific & Educational Software. All rights reserved. The software

More information

Module 1. Sequence Formats and Retrieval. Charles Steward

Module 1. Sequence Formats and Retrieval. Charles Steward The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.

More information

GenBank, Entrez, & FASTA

GenBank, Entrez, & FASTA GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,

More information



More information

Profissionais que pretendam desempenhar funções de Administrador de software como serviço (SaaS) ou de aplicações cloud.

Profissionais que pretendam desempenhar funções de Administrador de software como serviço (SaaS) ou de aplicações cloud. MCSA Office 365 [Ativar Portugal] Microsoft - Percursos Com certificação Nível: Avançado Duração: 41h Sobre o curso A GALILEU integrou na sua oferta formativa o Percurso de Formação e Certificação MCSA

More information

CD-HIT User s Guide. Last updated: April 5, 2010.

CD-HIT User s Guide. Last updated: April 5, 2010. CD-HIT User s Guide Last updated: April 5, 2010 Program developed by Weizhong Li s lab at UCSD 1. Introduction

More information

Inovando sistemas com arquiteturas elásticas

Inovando sistemas com arquiteturas elásticas Inovando sistemas com arquiteturas elásticas Renato Bognar Principal System Engineer 1 Agenda Quais são os desafios de construir ua aplicação? Quais os pontos de atenção? Vai construir Apps móveis? Desfazendo

More information

What is a Gene? HC70AL Spring An Introduction to Bioinformatics -- Part I. What are the 4 Nucleotides By in DNA?

What is a Gene? HC70AL Spring An Introduction to Bioinformatics -- Part I. What are the 4 Nucleotides By in DNA? APPENDIX 2 - BIOINFORMATICS (PARTS I AND II) What is a Gene? HC70AL Spring 2004 An ordered sequence of nucleotides An Introduction to Bioinformatics -- Part I What are the 4 Nucleotides By in DNA? Brandon

More information

Molecular Databases and Tools

Molecular Databases and Tools NWeHealth, The University of Manchester Molecular Databases and Tools Afternoon Session: NCBI/EBI resources, pairwise alignment, BLAST, multiple sequence alignment and primer finding. Dr. Georgina Moulton

More information

Classe AGI - PHP 5.x

Classe AGI - PHP 5.x Classe AGI - PHP 5.x Contents Package AGI Procedural Elements 2 agi_lib_v5x.php 2 Package AGI Classes 3 Class AGI 3 Constructor construct 3 Method exec_command 4 Method getagi_env 4 Method getdebug 4 Method

More information

Apply PERL to BioInformatics (II)

Apply PERL to BioInformatics (II) Apply PERL to BioInformatics (II) Lecture Note for Computational Biology 1 (LSM 5191) Jiren Wang BioInformatics Institute Singapore Outline Some examples for manipulating

More information

(PT) Identidade visual Euro Football 7-a-Side - Maia 2014 Versão - Logótipo Principal

(PT) Identidade visual Euro Football 7-a-Side - Maia 2014 Versão - Logótipo Principal Versão - Logótipo Principal Version - Main Logo Conceito de logomarca: A figura humana, com esta forma, pretende representar a figura dos jogadores como indistintos dos outros jogadores de futebol e a

More information


INGLÊS. Aula 13 DIRECT AND INDIRECT SPEECH INGLÊS Aula 13 DIRECT AND INDIRECT SPEECH Direct(Quoted) And Indirect(Reported) Speech Você pode responder esta pergunta: "What did he/she say?" de duas maneiras: - Repetindo as palavras ditas (direct

More information

Slides for Chapter 9: Name Services

Slides for Chapter 9: Name Services Slides for Chapter 9: Name Services From Coulouris, Dollimore and Kindberg Distributed Systems: Concepts and Design Edition 4, Pearson Education 2005 Figure 9.1 Composed naming domains used to access a

More information

Computational searches of biological sequences

Computational searches of biological sequences UNAM, México, Enero 78 Computational searches of biological sequences Special thanks to all the scientis that made public available their presentations throughout the web from where many slides were taken

More information

Sequencing the Human Genome

Sequencing the Human Genome Revised and Updated Edvo-Kit #339 Sequencing the Human Genome 339 Experiment Objective: In this experiment, students will read DNA sequences obtained from automated DNA sequencing techniques. The data

More information

Bioinformatics Grid - Enabled Tools For Biologists.

Bioinformatics Grid - Enabled Tools For Biologists. Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis

More information

Bio-Informatics Lectures. A Short Introduction

Bio-Informatics Lectures. A Short Introduction Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively

More information

GenBank: A Database of Genetic Sequence Data

GenBank: A Database of Genetic Sequence Data GenBank: A Database of Genetic Sequence Data Computer Science 105 Boston University David G. Sullivan, Ph.D. An Explosion of Scientific Data Scientists are generating ever increasing amounts of data. Relevant

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708

More information

An Introduction to Sequence Similarity ( Homology ) Searching

An Introduction to Sequence Similarity ( Homology ) Searching An Introduction to Sequence Similarity ( Homology ) Searching Gary D. Stormo 1 UNIT 3.1 1 Washington University, School of Medicine, St. Louis, Missouri ABSTRACT Homologous sequences usually have the same,

More information

Geospiza s Finch-Server: A Complete Data Management System for DNA Sequencing

Geospiza s Finch-Server: A Complete Data Management System for DNA Sequencing KOO10 5/31/04 12:17 PM Page 131 10 Geospiza s Finch-Server: A Complete Data Management System for DNA Sequencing Sandra Porter, Joe Slagel, and Todd Smith Geospiza, Inc., Seattle, WA Introduction The increased

More information

O que é WinRDBI O WinRDBI (Windows Relational DataBase Interpreter) é uma ferramenta educacional utilizada pela Universidade do Estado do Arizona, e que fornece uma abordagem ativa para entender as capacidades

More information

Linear Sequence Analysis. 3-D Structure Analysis

Linear Sequence Analysis. 3-D Structure Analysis Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical properties Molecular weight (MW), isoelectric point (pi), amino acid content, hydropathy (hydrophilic

More information

HCAHPS Quality Assurance Guidelines V9.0 Technical Corrections and Clarifications Revised August 2014

HCAHPS Quality Assurance Guidelines V9.0 Technical Corrections and Clarifications Revised August 2014 Subsequent to the release of the HCAHPS Quality Assurance Guidelines V9.0 (QAG V9.0), it has been determined that there are specific content items that require correction, addition and/or further clarification.

More information

EU project to bridge digital divide in Latin America

EU project to bridge digital divide in Latin America Publication: Cordis Date: 05 06 07 EU project to bridge digital divide in Latin America As information and communication technologies bring many benefits to societies, an EU funded project is aiming to

More information

Biological Databases and Protein Sequence Analysis

Biological Databases and Protein Sequence Analysis Biological Databases and Protein Sequence Analysis Introduction M. Madan Babu, Center for Biotechnology, Anna University, Chennai 25, India Bioinformatics is the application of Information technology to

More information

CRM: customer relationship management: o revolucionário marketing de relacionamento com o cliente P

CRM: customer relationship management: o revolucionário marketing de relacionamento com o cliente P CRM: customer relationship management: o revolucionário marketing de relacionamento com o cliente Download: CRM: customer relationship management: o revolucionário marketing de relacionamento com o cliente

More information

ISSN 0103-9741. Monografias em Ciência da Computação n 27/09

ISSN 0103-9741. Monografias em Ciência da Computação n 27/09 PUC ISSN 0103-9741 Monografias em Ciência da Computação n 27/09 A Conceptual Data Model Involving Protein Sets from Complete Genomes: a biological point of view Cristian Tristão Antonio Basílio de Miranda

More information

Having a BLAST: Analyzing Gene Sequence Data with BlastQuest

Having a BLAST: Analyzing Gene Sequence Data with BlastQuest Having a BLAST: Analyzing Gene Sequence Data with BlastQuest William G. Farmerie 1, Joachim Hammer 2, Li Liu 1, and Markus Schneider 2 University of Florida Gainesville, FL 32611, U.S.A. Abstract An essential

More information

Gerando Rotas BGP. Tutorial BGP - GTER

Gerando Rotas BGP. Tutorial BGP - GTER Gerando Rotas BGP 1 BGP Gerando rotas internas BGP Injetar agregado mexico OSPF AS 65000 chile PONTO DE OBSERVAÇÃO

More information

SYNTHETIC BIOLOGY PRACTICAL. Biological Databases and tools for handling DNA sequences

SYNTHETIC BIOLOGY PRACTICAL. Biological Databases and tools for handling DNA sequences SYNTHETIC BIOLOGY PRACTICAL Biological Databases and tools for handling DNA sequences BACKGROUND Your boss has asked you to express the gene meca in E. coli so that you can characterize the protein and

More information

MCSD Azure Solutions Architect [Ativar Portugal] Sobre o curso. Metodologia. Microsoft - Percursos. Com certificação. Nível: Avançado Duração: 78h

MCSD Azure Solutions Architect [Ativar Portugal] Sobre o curso. Metodologia. Microsoft - Percursos. Com certificação. Nível: Avançado Duração: 78h MCSD Azure Solutions Architect [Ativar Portugal] Microsoft - Percursos Com certificação Nível: Avançado Duração: 78h Sobre o curso A GALILEU integrou na sua oferta formativa, o Percurso de Formação e Certificação

More information



More information

3. About R2oDNA Designer

3. About R2oDNA Designer 3. About R2oDNA Designer Please read these publications for more details: Casini A, Christodoulou G, Freemont PS, Baldwin GS, Ellis T, MacDonald JT. R2oDNA Designer: Computational design of biologically-neutral

More information

Amino Acids and Their Properties

Amino Acids and Their Properties Amino Acids and Their Properties Recap: ss-rrna and mutations Ribosomal RNA (rrna) evolves very slowly Much slower than proteins ss-rrna is typically used So by aligning ss-rrna of one organism with that

More information

What next? Computational Biology and Bioinformatics. Finding homologs 2. Finding homologs. 4. Searching for homologs with BLAST

What next? Computational Biology and Bioinformatics. Finding homologs 2. Finding homologs. 4. Searching for homologs with BLAST Computational Biology and Bioinformatics 4. Searching for homologs with BLAST What next? Comparing sequences and searching for homologs Sequence alignment and substitution matrices Searching for sequences

More information

Sequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment

Sequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment Sequence Analysis 15: lecture 5 Substitution matrices Multiple sequence alignment A teacher's dilemma To understand... Multiple sequence alignment Substitution matrices Phylogenetic trees You first need

More information

EuroRec Repository. Translation Manual. January 2012

EuroRec Repository. Translation Manual. January 2012 EuroRec Repository Translation Manual January 2012 Added to Deliverable D6.3 for the EHR-Q TN project EuroRec Repository Translations Manual January 2012 1/21 Table of Content 1 Property of the document...

More information

Error Tolerant Searching of Uninterpreted MS/MS Data

Error Tolerant Searching of Uninterpreted MS/MS Data Error Tolerant Searching of Uninterpreted MS/MS Data 1 In any search of a large LC-MS/MS dataset 2 There are always a number of spectra which get poor scores, or even no match at all. 3 Sometimes, this

More information

Searching Nucleotide Databases

Searching Nucleotide Databases Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames

More information

TRANSACÇÕES. PARTE I (Extraído de SQL Server Books Online )

TRANSACÇÕES. PARTE I (Extraído de SQL Server Books Online ) Transactions Architecture TRANSACÇÕES PARTE I (Extraído de SQL Server Books Online ) Microsoft SQL Server 2000 maintains the consistency and integrity of each database despite errors that occur in the

More information

Biological Sequence Data Formats

Biological Sequence Data Formats Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA

More information Um negócio bem SERTANEJo Um negócio bem SERTANEJo Um negócio bem SERTANEJo Compra e venda fácil! O site é a opção justa, para o agronegócio, porque não cobra nada para publicar seus produtos. Faça seu cadastro e comece hoje mesmo

More information


TRANSFERÊNCIAS BANCÁRIAS INTERNACIONAIS Os clientes podem reforçar a sua conta por transferência através de vários bancos à volta do mundo. Veja a lista abaixo para mais detalhes: TRANSFERÊNCIAS BANCÁRIAS INTERNACIONAIS ROYAL BANK

More information

Introdução às Bases de Dados

Introdução às Bases de Dados Introdução às Bases de Dados 2011/12 Joaquim Silva ( The Bases de Dados subject Objective: To provide the basis for the modeling, implementation, analysis

More information

Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011

Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011 Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear

More information

ArcHC_3D research case studies (FCT:PTDC/AUR/66476/2006) Casos de estudo do projecto ArcHC_3D (FCT:PTDC/AUR/66476/2006)

ArcHC_3D research case studies (FCT:PTDC/AUR/66476/2006) Casos de estudo do projecto ArcHC_3D (FCT:PTDC/AUR/66476/2006) ArcHC_3D research case studies (FCT:PTDC/AUR/66476/2006) Casos de estudo do projecto ArcHC_3D (FCT:PTDC/AUR/66476/2006) 1 Casa de Valflores - Loures 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Capela de S. Frutuoso

More information

Android Bootcamp. Elaborado (com adaptações) a partir dos tutoriais:

Android Bootcamp. Elaborado (com adaptações) a partir dos tutoriais: Android Bootcamp Elaborado (com adaptações) a partir dos tutoriais: Bootcamp

More information

Prova escrita de conhecimentos específicos de Inglês

Prova escrita de conhecimentos específicos de Inglês Provas Especialmente Adequadas Destinadas a Avaliar a Capacidade para a Frequência dos Cursos Superiores do Instituto Politécnico de Leiria dos Maiores de 23 Anos - 2012 Instruções gerais Prova escrita

More information

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want 1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very

More information

Tutorial. Getting started with Ensembl Module 1 Introduction

Tutorial. Getting started with Ensembl  Module 1 Introduction Tutorial Getting started with Ensembl Ensembl provides genes and other annotation such as regulatory regions, conserved base pairs across species, and mrna protein mappings to the genome.

More information


QUESTÕES QUE COBRAM O CONHECIMENTO DOS CONECTIVOS: QUESTÕES QUE COBRAM O CONHECIMENTO DOS CONECTIVOS: 1 UFPR 77 - Which alternative can replace thus (line 5) in the text without changing the meaning? -) nevertheless -) though -) consequently -) despite

More information

ProGenViZ: a novel interactive tool for prokaryotic genome visualization and comparison

ProGenViZ: a novel interactive tool for prokaryotic genome visualization and comparison UNIVERSIDADE DE LISBOA FACULDADE DE CIÊNCIAS DEPARTAMENTO DE INFORMÁTICA ProGenViZ: a novel interactive tool for prokaryotic genome visualization and comparison Bruno Filipe Ribeiro Gonçalves DISSERTAÇÃO

More information

MURIQUI (Brachyteles arachnoides) Population and Habitat Viability Assessment Belo Horizonte, Brazil 23-26 May 1998

MURIQUI (Brachyteles arachnoides) Population and Habitat Viability Assessment Belo Horizonte, Brazil 23-26 May 1998 MURIQUI (Brachyteles arachnoides) Population and Habitat Viability Assessment Belo Horizonte, Brazil 23-26 May 1998 Executive Summary and Recommendations The muriqui is one of the world s greatest country-specific

More information

Online Products. Maximize your participation with the. The World s Leading Events Organizer

Online Products. Maximize your participation with the. The World s Leading Events Organizer The World s Leading Events Organizer Wherever in the world you want to do business...... our events deliver contacts, content and communities with the power to transform your business Maximize your participation

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

13 melhores extensões Magento melhorar o SEO da sua loja

13 melhores extensões Magento melhorar o SEO da sua loja Lojas Online ou Lojas Virtuais Seleção das melhores lojas para comprar online em Portugal. Loja virtual designa uma página na Internet com um software de gerenciamento de pedidos (carrinho de compras)

More information

Prova Escrita de Inglês

Prova Escrita de Inglês EXAME FINAL NACIONAL DO ENSINO SECUNDÁRIO Prova Escrita de Inglês 11.º Ano de Escolaridade Continuação bienal Decreto-Lei n.º 139/2012, de 5 de julho Prova 550/1.ª Fase 8 Páginas Duração da Prova: 120

More information

Ordered Index Seed Algorithm for Intensive DNA Sequence Comparison

Ordered Index Seed Algorithm for Intensive DNA Sequence Comparison Ordered Index Seed Algorithm for Intensive DNA Sequence Comparison Dominique Lavenier IRISA / CNRS Campus de Beaulieu 35042 Rennes, France Abstract This paper presents a seed-based algorithm

More information



More information

SGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD

SGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD White Paper SGI High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems Haruna Cofer*, PhD January, 2012 Abstract The SGI High Throughput Computing (HTC) Wrapper

More information

Gene Models & Bed format: What they represent.

Gene Models & Bed format: What they represent. GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,

More information

Databases indexation

Databases indexation Databases indexation Laurent Falquet, Basel October, 2006 Swiss Institute of Bioinformatics Swiss EMBnet node Overview Data access concept sequential direct Indexing EMBOSS Fetch Other BLAST Why indexing?

More information

PDBeFold (SSM: Secondary Structure Matching)

PDBeFold (SSM: Secondary Structure Matching) PDBeFold (SSM: Secondary Structure Matching) This PDBe tutorial introduces the PDBeFold service, an interactive service for comparing protein structures in 3D. This service provides:

More information

Next Generation Sequencing for Invertebrate Virus Discovery

Next Generation Sequencing for Invertebrate Virus Discovery Next Generation Sequencing for Invertebrate Virus Discovery -a practical approach Sijun Liu & Bryony C. Bonning Iowa State University, USA 8-14-2013 SIP Pittsburgh Outline Introduction: Why use NGS? Traditional

More information

Prova Escrita de Inglês

Prova Escrita de Inglês EXAME NACIONAL DO ENSINO SECUNDÁRIO Decreto-Lei n.º 74/2004, de 26 de março Prova Escrita de Inglês 10.º e 11.º Anos de Escolaridade Continuação bienal Prova 550/2.ª Fase 8 Páginas Duração da Prova: 120

More information



More information

CDD: a curated Entrez database of conserved domain alignments

CDD: a curated Entrez database of conserved domain alignments # 2003 Oxford University Press Nucleic Acids Research, 2003, Vol. 31, No. 1 383 387 DOI: 10.1093/nar/gkg087 CDD: a curated Entrez database of conserved domain alignments Aron Marchler-Bauer*, John B. Anderson,

More information

NADABAS. Report from a short term mission to the National Statistical Institute of Mozambique, Maputo Mozambique. 16-27 April 2012

NADABAS. Report from a short term mission to the National Statistical Institute of Mozambique, Maputo Mozambique. 16-27 April 2012 MZ:2012:04r NADABAS Report from a short term mission to the National Statistical Institute of Mozambique, Maputo Mozambique 16-27 April 2012 within the frame work of the AGREEMENT ON CONSULTING ON INSTITUTIONAL

More information



More information



More information

EARNINGS 1Q15 Conference Call May 8, 2015

EARNINGS 1Q15 Conference Call May 8, 2015 EARNINGS 1Q15 Conference Call May 8, 2015 SAFE-HARBOR STATEMENT We make forward-looking statements that are subject to risks and uncertainties. These statements are based on the beliefs and assumptions

More information

Integration of data management and analysis for genome research

Integration of data management and analysis for genome research Integration of data management and analysis for genome research Volker Brendel Deparment of Zoology & Genetics and Department of Statistics Iowa State University 2112 Molecular Biology Building Ames, Iowa

More information

BUDAPEST: Bioinformatics Utility for Data Analysis of Proteomics using ESTs

BUDAPEST: Bioinformatics Utility for Data Analysis of Proteomics using ESTs BUDAPEST: Bioinformatics Utility for Data Analysis of Proteomics using ESTs Richard J. Edwards 2008. Contents 1. Introduction... 2 1.1. Version...2 1.2. Using this Manual...2 1.3. Why use BUDAPEST?...2

More information



More information