Next Generation Sequencing: Technology, Mapping, and Analysis
|
|
- Maude Harris
- 8 years ago
- Views:
Transcription
1 Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University
2
3 The Human Genome Project took 10 years and cost roughly $3,000,000,000 by 2001.
4 The Human Genome Project took 10 years and cost roughly $3,000,000,000 by But, we had only one, maybe two, versions of the human genome, therefore, little data for a comprehensive, systematic study of human genetic diversity.
5 The Human Genome Project took 10 years and cost roughly $3,000,000,000 by But, we had only one, maybe two, versions of the human genome, therefore, little data for a comprehensive, systematic study of human genetic diversity. My lab has data from 2 whole human genomes, stored on a hard drive. Each cost roughly $40,000 (in 2010). Today (2013) sequencing a genome costs $5000 $10,000.
6 Outline Next Generation Sequencing Technologies Algorithms for Mapping Reads Detecting Structural Variants Visualization Software
7 Why Sequence DNA? DNA is the molecule of genetic inheritance. Sequencing data provide a fundamental basis for understanding the biology of an organism. The data allow comprehensive comparisons of organisms on a genomic level to find regions of similarity, difference, and functional significance.
8 Why Sequence DNA? The data allow us to understand Human variation on a molecular level, for example, the genetic differences between tumor and normal tissue. This will hopefully lead to more specific medical treatments (personalized medicine).
9 Current Experimental Methods That Use Sequencing RNA Seq Measurement of gene expression in a tissue by counting the number of RNA fragments sequenced from each gene. Also used for alternative splicing detection. ChIP Seq (Chromatin Immunoprecipitation) Identification of protein binding sites on DNA by determining where DNA fragments bound to a specific protein map onto the genome.
10 Current Experimental Methods That Use Sequencing Genome sequencing allows us to detect SNPs (single nucleotide polymorphisms) and structural variations among individuals: within a population, from different populations
11 Next Generation Sequencing Technologies Current Illumina Genome Analyzer Roche 454 Applied Biosystems Solid Future Ion Torrent Pacific Biosciences RS
12 Sanger Sequencing
13 Sanger vs NGS technology Next-generation DNA sequencing by Jay Shendure and Hanlee Ji, Nature Biotechnology 26, (2008), doi: /nbt1486
14 Sanger vs NGS technology $/.50 per kilobase Next-generation DNA sequencing by Jay Shendure and Hanlee Ji, Nature Biotechnology 26, (2008), doi: /nbt1486 $/ 1.50 per megabase
15 Emulsion and bridge amplification Next-generation DNA sequencing by Jay Shendure and Hanlee Ji, Nature Biotechnology 26, (2008), doi: /nbt1486
16 Illumina sequencing technology
17 Illumina sequencing technology
18 Illumina sequencing technology
19 Video of Illumina Sequencing
20 SOLiD and 454 technologies Sequencing technologies the next generation by Michael L. Metzker Nature Reviews Genetics 11, 31-46, doi: /nrg2626
21 Most Common Error Types: 454 vs Illumina Roche/454 Illumina/Solexa Lower overall error
22 Next Generation Sequencing Data These technologies generate millions to billions of short DNA reads sampled from a whole DNA genome, targeted genetic regions, or transcribed RNA. Length: nt (Illumina) nt (454)
23
24 Mapping Reads the Problem Given 100+ million reads from an experiment, for each: 1. find the genomic coordinates, chromosome and first base, where it has the best match in a reference genome, either with the forward or reverse strand. 2. best match means zero or a small number of differences with the reference. 3. differences include mismatches and indels. 4. determine if it has multiple matches or none at all.
25 Algorithms for Read Mapping
26 Structural Variants Structural variants are any rearrangements of the genome relative to a reference. They include: insertions/deletions inversions translocations tandem repeat variations Many can be detected with paired end or mate pair reads.
27 Paired-Ends and Mate-Pairs Accurate whole human genome sequencing using reversible terminator chemistry, David Bentley et al., Nature 456, 53-59, doi: /nature07517
28 Mate-pairs vs paired-ends Detection of large indels requires large insert sizes. Current Illumina technology allows for paired-end insert sizes very close to 250 bp, which, depending on coverage, allows for detection of small and medium-size indels only. Mate-pair libraries allow for generation of large inserts at the expense of more insert-size variability.
29 Normally Mapped Reads 1 2 paired reads sequenced fragment (insert) Subject A B C Reference 1 2 A B C mapped reads Apparent insert size in the normally expected range.
30 Deletion 1 2 paired reads sequenced fragment (insert) Subject A C Reference 1 2 A B C mapped reads
31 Deletion 1 2 Subject A C 1 2 Reference A B C Apparent insert size longer than expected indicating deletion of B.
32 Insertion 1 2 Subject A B C 1 2 Reference A C
33 Insertion 1 2 Subject A B C 1 2 Reference A C Apparent insert size shorter than expected indicating insertion of B.
34 Distribution to determine unusually long or short apparent insert length Insertions Deletions
35 Singletons A singleton is a read which maps, but whose pair does not map. Possible causes: 1. Split read 2. Novel insertion
36 Singleton Split Read 1 2 Subject A C Reference A B C Parts of read 2 map to two locations. It is split. Some mapping programs cannot detect the split mapping.
37 Singleton Split Read 1 2 Subject A C 1 Reference A B C Only one read mapped Parts of read 2 map to two locations. It is split. Some mapping programs cannot detect the split mapping.
38 Homozygous deletion Bentley, et al, Nature 456, (6 November 2008) doi: /nature07517 ;
39 Bentley, et al, Nature 456, (6 November 2008) doi: /nature07517 ; Gap Heterozygous deletion No gap
40 Inversion 1 3 prime 5 prime Reference A B C D E F G H 5 prime 3 prime
41 Inversion 2 B C D E F G 3 prime 5 prime Reference A H 5 prime 3 prime
42 Inversion 3 B C D E F G 3 prime 5 prime Reference A H 5 prime 3 prime
43 Inversion 4 3 prime B C D E F G 5 prime Reference A H 5 prime 3 prime
44 Inversion 5 B C D E F G 3 prime 5 prime Reference A H 5 prime 3 prime
45 Inversion 6 G F E D C B 3 prime 5 prime Reference A H 5 prime 3 prime
46 Inversion 7 Subject 3 prime A G F E D C B 5 prime H 5 prime 3 prime
47 Inversion Subject A G F E D C B H Reference A B C D E F G H
48 Inversion Subject A G F E D C B H Reference A B C D E F G H Paired reads map in the same direction and are farther apart than expected
49 Inversion Subject A G F E D C B H Reference A B C D E F G H Paired reads map in the same direction and are farther apart than expected
50 Inversion Subject A G F E D C B H Reference A B C D E F G H A split read will generally go undetected.
51 Inversion Subject A G F E D C B H 2 1 Reference A B C D E F G H An insert entirely contained in the inversion will look normal, although the positions are swapped.
52 Bentley, et al, Nature 456, (6 November 2008) doi: /nature07517 ; Homozygous inversion Red is pair mapped in the same direction
53 Breakpoints of an Inversion No normally mapped reads span the breakpoints.
54 Tandem Repeat Variants or VNTRs (Variable Number of Tandem Repeats)
55 Tandem Repeat tcgctggtcata cgt cgt cgt cgt cgt tacaaacgtcttccgt
56 Tandem Repeat tcgctggtcata cgt cgt cgt cgt cgt tacaaacgtcttccgt left flank sequence tandem array of copies right flank sequence
57 Tandem Repeat left flank sequence tandem array of copies right flank sequence consensus sequence multiple alignment
58
59 Tandem Repeat Variants Tandem Repeat polymorphisms occur as differences in: copy number individual copy motifs (SNPs/indels) order of motifs in the tandem array
60 Why are Tandem Repeat Variants Important? They are associated with human disease: Triple repeat diseases Fragile X mental retardation Myotonic dystrophy Huntington s disease Friedreich s ataxia Epilepsy Diabetes Ovarian cancer They co occur with transcription factor binding sites and so may be involved in gene regulation.
61 Why is detecting variants difficult? Read mapping in the presence of large indels (copy number difference) is computationally costly.
62 Why is detecting variants difficult? Read mapping in the presence of large indels (copy number difference) is computationally costly. Motif differences (indels and SNPs) and motif order differences are additional complications for both seed indexing and BWT/Suffix Array matching approaches.
63 Why is detecting variants difficult? Read mapping in the presence of large indels (copy number difference) is computationally costly. Motif differences (indels and SNPs) and motif order differences are additional complications for both seed indexing and BWT/Suffix Array matching approaches. Mapping and indel detection is typically oblivious to sequence annotation.
64 Outline of Strategy 1. Detect repeats in the subject and in the human reference using TRF software. 2. Map read TRs to reference TRs using: indexing of reference patterns fast bit wise edit distance with threshold profile alignment of TR arrays flanking sequence alignment (bit wise) 3. Compare copy number of reference TRs with those of mapped read TRs and identify variants
65 Subject data comes from the Watson genome. 454 technology: 74 million reads, avg. length 261 nt. avg. coverage ~6
66 Reference tandem repeats come from the Tandem Repeats Database (TRDB).
67 Reference tandem repeats come from the Tandem Repeats Database (TRDB) ,671
68 VNTR 1 copy shorter (heterozygous?)
69 VNTR 2 copies shorter
70 VNTR 1 copy longer
71 VNTR 2 alleles observed
72 VNTR 2 copies shorter
73 VNTR and SNP alleles
74 VNTR internal motif duplicated and flanking SNPs
75 VNTR Results Watson Genome
76 Khoisan Genome African Hunter Gatherer Culture nominal 12.3 coverage
77 Acknowledgments Yevgeniy Gelfand Yozen Hernandez Joshua Loving
78 Thank you!
New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova
New generation sequencing: current limits and future perspectives Giorgio Valle CRIBI Università di Padova Around 2004 the Race for the 1000$ Genome started A few questions... When? How? Why? Standard
More informationNext Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
More informationIntroduction to NGS data analysis
Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High
More informationGo where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe
Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. To published results faster With proven scalability To the forefront of discovery To limitless applications
More informationShouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center
Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing
More informationComputational Genomics. Next generation sequencing (NGS)
Computational Genomics Next generation sequencing (NGS) Sequencing technology defies Moore s law Nature Methods 2011 Log 10 (price) Sequencing the Human Genome 2001: Human Genome Project 2.7G$, 11 years
More informationAn example of bioinformatics application on plant breeding projects in Rijk Zwaan
An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on
More informationNazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office
2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation
More informationRETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
More informationFocusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
More informationNext generation DNA sequencing technologies. theory & prac-ce
Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing
More informationLectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling
Lectures 1 and 8 15 February 7, 2013 This is a review of the material from lectures 1 and 8 14. Note that the material from lecture 15 is not relevant for the final exam. Today we will go over the material
More informationIntroduction to next-generation sequencing data
Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS
More informationData Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
More informationHow many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
More informationDNA Sequencing & The Human Genome Project
DNA Sequencing & The Human Genome Project An Endeavor Revolutionizing Modern Biology Jutta Marzillier, Ph.D Lehigh University Biological Sciences November 13 th, 2013 Guess, who turned 60 earlier this
More informationGene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
More informationSeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications
Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each
More informationG E N OM I C S S E RV I C ES
GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E
More informationSchool of Nursing. Presented by Yvette Conley, PhD
Presented by Yvette Conley, PhD What we will cover during this webcast: Briefly discuss the approaches introduced in the paper: Genome Sequencing Genome Wide Association Studies Epigenomics Gene Expression
More informationTutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment
Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249
More informationmygenomatix - secure cloud for NGS analysis
mygenomatix Speed. Quality. Results. mygenomatix - secure cloud for NGS analysis background information & contents 2011 Genomatix Software GmbH Bayerstr. 85a 80335 Munich Germany info@genomatix.de www.genomatix.de
More informationAssuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice. Supplementary Guidelines
Assuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice Next-generation Sequencing: Standardization of Clinical Testing (Nex-StoCT) Workgroup Principles and Guidelines Supplementary
More informationGenetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
More information14.3 Studying the Human Genome
14.3 Studying the Human Genome Lesson Objectives Summarize the methods of DNA analysis. State the goals of the Human Genome Project and explain what we have learned so far. Lesson Summary Manipulating
More informationTargeted. sequencing solutions. Accurate, scalable, fast TARGETED
Targeted TARGETED Sequencing sequencing solutions Accurate, scalable, fast Sequencing for every lab, every budget, every application Ion Torrent semiconductor sequencing Ion Torrent technology has pioneered
More informationGenomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
More informationOrganization and analysis of NGS variations. Alireza Hadj Khodabakhshi Research Investigator
Organization and analysis of NGS variations. Alireza Hadj Khodabakhshi Research Investigator Why is the NGS data processing a big challenge? Computation cannot keep up with the Biology. Source: illumina
More informationAppendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
More informationPersonal Genome Sequencing with Complete Genomics Technology. Maido Remm
Personal Genome Sequencing with Complete Genomics Technology Maido Remm 11 th Oct 2010 Three related papers 1. Describing the Complete Genomics technology Drmanac et al., Science 1 January 2010: Vol. 327.
More informationCore Facility Genomics
Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray
More informationTowards Integrating the Detection of Genetic Variants into an In-Memory Database
Towards Integrating the Detection of Genetic Variants into an 2nd International Workshop on Big Data in Bioinformatics and Healthcare Oct 27, 2014 Motivation Genome Data Analysis Process DNA Sample Base
More informationForensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
More informationGenetic diagnostics the gateway to personalized medicine
Micronova 20.11.2012 Genetic diagnostics the gateway to personalized medicine Kristiina Assoc. professor, Director of Genetic Department HUSLAB, Helsinki University Central Hospital The Human Genome Packed
More informationAnalysis of gene expression data. Ulf Leser and Philippe Thomas
Analysis of gene expression data Ulf Leser and Philippe Thomas This Lecture Protein synthesis Microarray Idea Technologies Applications Problems Quality control Normalization Analysis next week! Ulf Leser:
More informationescience and Post-Genome Biomedical Research
escience and Post-Genome Biomedical Research Thomas L. Casavant, Adam P. DeLuca Departments of Biomedical Engineering, Electrical Engineering and Ophthalmology Coordinated Laboratory for Computational
More informationAutomated DNA sequencing 20/12/2009. Next Generation Sequencing
DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing
More informationBiological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
More informationLecture 3: Mutations
Lecture 3: Mutations Recall that the flow of information within a cell involves the transcription of DNA to mrna and the translation of mrna to protein. Recall also, that the flow of information between
More informationIntroduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
More informationSingle-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples
DATA Sheet Single-Cell DNA Sequencing with the C 1 Single-Cell Auto Prep System Reveal hidden populations and genetic diversity within complex samples Single-cell sensitivity Discover and detect SNPs,
More informationInnovations in Molecular Epidemiology
Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether
More informationLecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur
More informationDNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
More informationMUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
More informationNext generation sequencing (NGS)
Next generation sequencing (NGS) Vijayachitra Modhukur BIIT modhukur@ut.ee 1 Bioinformatics course 11/13/12 Sequencing 2 Bioinformatics course 11/13/12 Microarrays vs NGS Sequences do not need to be known
More informationLifeScope Genomic Analysis Software 2.5
USER GUIDE LifeScope Genomic Analysis Software 2.5 Graphical User Interface DATA ANALYSIS METHODS AND INTERPRETATION Publication Part Number 4471877 Rev. A Revision Date November 2011 For Research Use
More informationUsing Illumina BaseSpace Apps to Analyze RNA Sequencing Data
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data The Illumina TopHat Alignment and Cufflinks Assembly and Differential Expression apps make RNA data analysis accessible to any user, regardless
More informationSimplifying Data Interpretation with Nexus Copy Number
Simplifying Data Interpretation with Nexus Copy Number A WHITE PAPER FROM BIODISCOVERY, INC. Rapid technological advancements, such as high-density acgh and SNP arrays as well as next-generation sequencing
More informationChapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
More informationHuman Genome Organization: An Update. Genome Organization: An Update
Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion
More informationBRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls?
BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? Giovanni Luca Scaglione, PhD ------------------------ Laboratory of Clinical Molecular Diagnostics and Personalized Medicine, Institute
More informationSICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE
AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,
More informationSequencing and microarrays for genome analysis: complementary rather than competing?
Sequencing and microarrays for genome analysis: complementary rather than competing? Simon Hughes, Richard Capper, Sandra Lam and Nicole Sparkes Introduction The human genome is comprised of more than
More informationThe Human Genome Project
The Human Genome Project Brief History of the Human Genome Project Physical Chromosome Maps Genetic (or Linkage) Maps DNA Markers Sequencing and Annotating Genomic DNA What Have We learned from the HGP?
More informationChallenges associated with analysis and storage of NGS data
Challenges associated with analysis and storage of NGS data Gabriella Rustici Research and training coordinator Functional Genomics Group gabry@ebi.ac.uk Next-generation sequencing Next-generation sequencing
More informationIntro to Bioinformatics
Intro to Bioinformatics Marylyn D Ritchie, PhD Professor, Biochemistry and Molecular Biology Director, Center for Systems Genomics The Pennsylvania State University Sarah A Pendergrass, PhD Research Associate
More informationBio-Informatics Lectures. A Short Introduction
Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively
More informationModule 1. Sequence Formats and Retrieval. Charles Steward
The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.
More informationAnalysis of NGS Data
Analysis of NGS Data Introduction and Basics Folie: 1 Overview of Analysis Workflow Images Basecalling Sequences denovo - Sequencing Assembly Annotation Resequencing Alignments Comparison to reference
More informationSNP Essentials The same SNP story
HOW SNPS HELP RESEARCHERS FIND THE GENETIC CAUSES OF DISEASE SNP Essentials One of the findings of the Human Genome Project is that the DNA of any two people, all 3.1 billion molecules of it, is more than
More informationAn Overview of DNA Sequencing
An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure
More informationData Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms
Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).
More informationAdvances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage
Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application
More information1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
More information8/7/2012. Experimental Design & Intro to NGS Data Analysis. Examples. Agenda. Shoe Example. Breast Cancer Example. Rat Example (Experimental Design)
Experimental Design & Intro to NGS Data Analysis Ryan Peters Field Application Specialist Partek, Incorporated Agenda Experimental Design Examples ANOVA What assays are possible? NGS Analytical Process
More informationMolecular typing of VTEC: from PFGE to NGS-based phylogeny
Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing
More informationVersion 5.0 Release Notes
Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com
More informationIntroduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
More informationSingle Nucleotide Polymorphisms (SNPs)
Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded
More informationTECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298
DIAGNOSTICS BUSINESS ANALYSIS SERIES: TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298 By ADAMS BUSINESS ASSOCIATES MAY 2014. May 2014 ABA 298 1 Technologies, Products & Services
More informationRNAseq / ChipSeq / Methylseq and personalized genomics
RNAseq / ChipSeq / Methylseq and personalized genomics 7711 Lecture Subhajyo) De, PhD Division of Biomedical Informa)cs and Personalized Biomedicine, Department of Medicine University of Colorado School
More informationHow-To: SNP and INDEL detection
How-To: SNP and INDEL detection April 23, 2014 Lumenogix NGS SNP and INDEL detection Mutation Analysis Identifying known, and discovering novel genomic mutations, has been one of the most popular applications
More informationWhen you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want
1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very
More informationHistory of DNA Sequencing & Current Applications
History of DNA Sequencing & Current Applications Christopher McLeod President & CEO, 454 Life Sciences, A Roche Company IMPORTANT NOTICE Intended Use Unless explicitly stated otherwise, all Roche Applied
More informationUmm AL Qura University MUTATIONS. Dr Neda M Bogari
Umm AL Qura University MUTATIONS Dr Neda M Bogari CONTACTS www.bogari.net http://web.me.com/bogari/bogari.net/ From DNA to Mutations MUTATION Definition: Permanent change in nucleotide sequence. It can
More informationBioBoot Camp Genetics
BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before
More informationBiology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA
Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns
More informationA Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
More informationCancer Genomics: What Does It Mean for You?
Cancer Genomics: What Does It Mean for You? The Connection Between Cancer and DNA One person dies from cancer each minute in the United States. That s 1,500 deaths each day. As the population ages, this
More informationThe Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics
The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long
More informationGenomeStudio Data Analysis Software
GenomeStudio Data Analysis Software Illumina has created a comprehensive suite of data analysis tools to support a wide range of genetic analysis assays. This single software package provides data visualization
More informationTitle: Surveying Genome to Identify Origins of DNA Replication In Silico
Title: Surveying Genome to Identify Origins of DNA Replication In Silico Abstract: DNA replication origins are the bases to realize the process of chromosome replication and analyze the progress of cell
More informationSEQUENCING. From Sample to Sequence-Ready
SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major
More informationNext Generation Sequencing: Adjusting to Big Data. Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013
Next Generation Sequencing: Adjusting to Big Data Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013 Outline Human Genome Project Next-Generation Sequencing Personalized Medicine
More informationINTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE E15
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE DEFINITIONS FOR GENOMIC BIOMARKERS, PHARMACOGENOMICS,
More informationGenomeStudio Data Analysis Software
GenomeStudio Analysis Software Illumina has created a comprehensive suite of data analysis tools to support a wide range of genetic analysis assays. This single software package provides data visualization
More informationBIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis
BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis By the end of this lab students should be able to: Describe the uses for each line of the DNA subway program (Red/Yellow/Blue/Green) Describe
More informationAlgorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
More information2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
More informationCurrent Motif Discovery Tools and their Limitations
Current Motif Discovery Tools and their Limitations Philipp Bucher SIB / CIG Workshop 3 October 2006 Trendy Concepts and Hypotheses Transcription regulatory elements act in a context-dependent manner.
More informationWelcome to the Plant Breeding and Genomics Webinar Series
Welcome to the Plant Breeding and Genomics Webinar Series Today s Presenter: Dr. Candice Hansey Presentation: http://www.extension.org/pages/ 60428 Host: Heather Merk Technical Production: John McQueen
More informationNew Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.
New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System
More informationNECC History. Karl V. Steiner 2011 Annual NECC Meeting, Orono, Maine March 15, 2011
NECC History Karl V. Steiner 2011 Annual NECC Meeting, Orono, Maine March 15, 2011 EPSCoR Cyberinfrastructure Workshop First regional NENI (now NECC) Workshop held in Vermont in August 2007 Workshop heldinkentucky
More informationRecombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
More informationBioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing
STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAAC GTGCAC GTGAAC Wouter Coppieters Head of the genomics core facility GIGA center, University of Liège Bioruptor NGS: Unbiased DNA
More informationISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes
ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination
More informationNext Generation Sequencing
Next Generation Sequencing DNA sequence represents a single format onto which a broad range of biological phenomena can be projected for high-throughput data collection Over the past three years, massively
More informationSNPbrowser Software v3.5
Product Bulletin SNP Genotyping SNPbrowser Software v3.5 A Free Software Tool for the Knowledge-Driven Selection of SNP Genotyping Assays Easily visualize SNPs integrated with a physical map, linkage disequilibrium
More information