Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations
|
|
|
- Abigayle Amelia Cain
- 10 years ago
- Views:
Transcription
1 Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations AlCoB 2014 First International Conference on Algorithms for Computational Biology Thiago da Silva Arruda Institute of Computing University of Campinas Campinas, SP, Brazil Ulisses Dias Institute of Computing University of Campinas Campinas, SP, Brazil Zanoni Dias Institute of Computing University of Campinas Campinas, SP, Brazil Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27
2 Outline Genome Rearrangement Field Length-Weighted Inversions Greedy Randomized Search Procedure Experimental Results Conclusions Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27
3 Part I Genome Rearrangement Field Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27
4 Genome Rearrangement Field Genome Rearrangements Genes are shared by genomes from different species. Given two contemporary genomes, gene order and orientation may differ Yesrsinia pestis Nepal Yesrsinia pestis Angola Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27
5 Genome Rearrangement Field Genome Rearrangements Genomes undergo large scale mutations during the evolutionary process (move DNA-sequence from one place to the other). An inversion occurs when a chromosome breaks at two locations called breakpoints, and the DNA between the breakpoints is reversed. Pseudomonas putida KT Pseudomonas putida F1 Inversion 0... i-1 i... j j+1... n ρ(i,j) 0... i-1 -j... -i j+1... n Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27
6 Genome Rearrangement Field Evolutionary Distance The genetic data available for many organisms allows accurate evolutionary inference. The traditional approach uses nucleotide (or amino acid) comparison to find the edit distance. When mutational events (like inversions) affect very large stretches of DNA sequence? Whole-Genome Distance Measure. Compute the minimum number of lage-scale events needed to transform one genome into the other (parsimony criterion). Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27
7 Genome Rearrangement Field Evolutionary Distance Regarding the computation of parsimonious scenarios when only inversions are considered. A polynomial problem (Hannenhali and Pevzner, 1998). GRIMM is the most used tool for this job. Several studies have shown that inversions are shorter than expected under a neutral model. The sorting by inversion problem do not take into account the length of the reversed sequence. The sequence of operations that most likely happened during the evolution may not involve the movement of many long sequences. Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27
8 Part II Length-Weighted Inversions Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27
9 Length-Weighted Inversions Genome Representation We regard genomes as permutations: π = (π 1 π 2... π n ), for π i Z, 1 π i n and i j π i π j. Same Orientation Different Orientation Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27
10 Length-Weighted Inversions Sorting by Inversions Problem Given the gene order of two contemporary genomes, the task of finding the minimum number of inversions which transform one genome into the other is called Sorting by Inversion Problem Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27
11 Length-Weighted Inversions Sorting by Length-Weighted Inversions Problem cost = cost = 5 cost = 4 cost = 1 cost = 2 Total = 14 Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27
12 Part III Greedy Randomized Search Procedure Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27
13 Greedy Randomized Search Procedure Building Blocks Initial Solution Neighborhood Local Search Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27
14 Greedy Randomized Search Procedure Building Blocks Initial Solution A solution is a sequence of permutations s =< s 0,s 1,...,s m > such that s k differs from s k 1 by one inversion, 1 k m, s 0 = π and s m = ι. s =< ( ),( ),( ),( ),( ) >. We use an optimal solution for the Sorting by Inversions Problem as Initial Solution. Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27
15 Greedy Randomized Search Procedure Building Blocks Neighborhood Let s =< s 0,s 1,...,s m > be the current solution. Another solution s =< s 0,s 1,...,s m > is in the neighborhood of s, namely N f (s), if they differ by a frame that has no more than f elements. j - i +1 = f Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27
16 Greedy Randomized Search Procedure Building Blocks Local Search Our method iteratively improves the current solution. Each step requires a local change. The local change will be restricted to a given frame choosen by random. If a less costly sequence is found, it is made the current solution. Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27
17 Greedy Randomized Search Procedure Local Search - Definitions Let < s i,...,s j > be the frame where the change will be performed. We will call s i = α and s j = β. Breakpoint: pair of elements that are consecutive in α but not consecutive in β. α = ( ) β = ( ) Entropy: How far each element in α is from its position in beta. ent(α,β) = n p(α,i) p(β,i). i=1 Benefit: for any inversion ρ, the benefit δ is given by: δ(α,β,ρ) = ent(π,β) ent(π ρ,β) cost(ρ) Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27
18 Greedy Randomized Search Procedure Local Search We start the construction of new frame that will starts with α and ends with β. We select inversions that decrease the number of breakpoints. When no inversion of the kind exists, we execute one step of the algorithm proposed by Bergeron, 2006 for the Sorting by Inversions Problem. Building a Frame α... β Benefit Inversion Inv 1 Inv 2... Inv 5 Inv 6 Inv 7... Five best scored permutations Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27
19 Greedy Randomized Search Procedure Local Search We rank the selected inversions based on the benefit. The inversions ranked as high as fifth qualify to the second phase. We choose one inversion based on a random process called roulette wheel selection mechanism. Each inversion has a selection likelihood proportional to the square of its benefit. Building a Frame α... β Benefit Inversion Inv 1 Inv 2... Inv 5 Inv 6 Inv 7... Five best scored permutations Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27
20 Part IV Experimental Results Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27
21 Experimental Results Parameters Frame Size: < 14,12,10,8,6,4 > Iterations: 900 (150 for each frame size). Instances: we generated 1000 permutations whose sizes range from 10 to 100 in intervals of 5. Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27
22 Experimental Results Number of Improved Initial Solutions 100% 90% 80% 70% 60% 50% 40% 30% 20% 10% 0% Permutation size Percentage of Times our Heuristic Improved the Initial Solution Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27
23 Experimental Results 15% Average Improvement 12% 9% 6% 3% 0% Permutation size Percentage of Improvement on the Initial Solution Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27
24 Experimental Results Average Cost Swidan GRASP 0 GRIMM Permutation Size Comparative Analysis: Average Cost Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27
25 Part V Conclusions Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27
26 Conclusions We presented a new method for the length-weighted inversion problem on signed permutations. We considered the case where the weight function is simply the number of elements in the reversed segment. We were able to improve the initial solution in 94% of the cases. Our solutions cost 12% less than the initial solution, on average. We also show that our method provides solution that are less costly than a previous algorithm. Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27
27 Acknowledgments Thiago da Silva Arruda, Ulisses Dias and Zanoni Dias AlCoB 2014 July 1-3, / 27
Asexual Versus Sexual Reproduction in Genetic Algorithms 1
Asexual Versus Sexual Reproduction in Genetic Algorithms Wendy Ann Deslauriers ([email protected]) Institute of Cognitive Science,Room 22, Dunton Tower Carleton University, 25 Colonel By Drive
Worksheet - COMPARATIVE MAPPING 1
Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that
Pairwise Sequence Alignment
Pairwise Sequence Alignment [email protected] SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What
DNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:
Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How
BASIC STATISTICAL METHODS FOR GENOMIC DATA ANALYSIS
BASIC STATISTICAL METHODS FOR GENOMIC DATA ANALYSIS SEEMA JAGGI Indian Agricultural Statistics Research Institute Library Avenue, New Delhi-110 012 [email protected] Genomics A genome is an organism s
Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS
Period Date REGENTS REVIEW: PROTEIN SYNTHESIS 1. The diagram at the right represents a portion of a type of organic molecule present in the cells of organisms. What will most likely happen if there is
Hidden Markov Models
8.47 Introduction to omputational Molecular Biology Lecture 7: November 4, 2004 Scribe: Han-Pang hiu Lecturer: Ross Lippert Editor: Russ ox Hidden Markov Models The G island phenomenon The nucleotide frequencies
Genetic Algorithm. Based on Darwinian Paradigm. Intrinsically a robust search and optimization mechanism. Conceptual Algorithm
24 Genetic Algorithm Based on Darwinian Paradigm Reproduction Competition Survive Selection Intrinsically a robust search and optimization mechanism Slide -47 - Conceptual Algorithm Slide -48 - 25 Genetic
Genetic Algorithms commonly used selection, replacement, and variation operators Fernando Lobo University of Algarve
Genetic Algorithms commonly used selection, replacement, and variation operators Fernando Lobo University of Algarve Outline Selection methods Replacement methods Variation operators Selection Methods
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
Human-Mouse Synteny in Functional Genomics Experiment
Human-Mouse Synteny in Functional Genomics Experiment Ksenia Krasheninnikova University of the Russian Academy of Sciences, JetBrains [email protected] September 18, 2012 Ksenia Krasheninnikova
Bio-Informatics Lectures. A Short Introduction
Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively
Master's projects at ITMO University. Daniil Chivilikhin PhD Student @ ITMO University
Master's projects at ITMO University Daniil Chivilikhin PhD Student @ ITMO University General information Guidance from our lab's researchers Publishable results 2 Research areas Research at ITMO Evolutionary
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Genome Explorer For Comparative Genome Analysis
Genome Explorer For Comparative Genome Analysis Jenn Conn 1, Jo L. Dicks 1 and Ian N. Roberts 2 Abstract Genome Explorer brings together the tools required to build and compare phylogenies from both sequence
GA as a Data Optimization Tool for Predictive Analytics
GA as a Data Optimization Tool for Predictive Analytics Chandra.J 1, Dr.Nachamai.M 2,Dr.Anitha.S.Pillai 3 1Assistant Professor, Department of computer Science, Christ University, Bangalore,India, [email protected]
Alpha Cut based Novel Selection for Genetic Algorithm
Alpha Cut based Novel for Genetic Algorithm Rakesh Kumar Professor Girdhar Gopal Research Scholar Rajesh Kumar Assistant Professor ABSTRACT Genetic algorithm (GA) has several genetic operators that can
Biological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
6 Creating the Animation
6 Creating the Animation Now that the animation can be represented, stored, and played back, all that is left to do is understand how it is created. This is where we will use genetic algorithms, and this
Protein Protein Interaction Networks
Functional Pattern Mining from Genome Scale Protein Protein Interaction Networks Young-Rae Cho, Ph.D. Assistant Professor Department of Computer Science Baylor University it My Definition of Bioinformatics
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
MUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
Algorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want
1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very
Introduction To Genetic Algorithms
1 Introduction To Genetic Algorithms Dr. Rajib Kumar Bhattacharjya Department of Civil Engineering IIT Guwahati Email: [email protected] References 2 D. E. Goldberg, Genetic Algorithm In Search, Optimization
Genetic Algorithm Performance with Different Selection Strategies in Solving TSP
Proceedings of the World Congress on Engineering Vol II WCE, July 6-8,, London, U.K. Genetic Algorithm Performance with Different Selection Strategies in Solving TSP Noraini Mohd Razali, John Geraghty
Hybrid Genetic Algorithm for DNA Sequencing with Errors
Journal of Heuristics, 8: 495 502, 2002 c 2002 Kluwer Academic Publishers. Manufactured in The Netherlands. Hybrid Genetic Algorithm for DNA Sequencing with Errors JACEK B LAŻEWICZ AND MARTA KASPRZAK Institute
College of information technology Department of software
University of Babylon Undergraduate: third class College of information technology Department of software Subj.: Application of AI lecture notes/2011-2012 ***************************************************************************
CPO Science and the NGSS
CPO Science and the NGSS It is no coincidence that the performance expectations in the Next Generation Science Standards (NGSS) are all action-based. The NGSS champion the idea that science content cannot
MAKING AN EVOLUTIONARY TREE
Student manual MAKING AN EVOLUTIONARY TREE THEORY The relationship between different species can be derived from different information sources. The connection between species may turn out by similarities
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur
A Non-Linear Schema Theorem for Genetic Algorithms
A Non-Linear Schema Theorem for Genetic Algorithms William A Greene Computer Science Department University of New Orleans New Orleans, LA 70148 bill@csunoedu 504-280-6755 Abstract We generalize Holland
Focusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
Integrating DNA Motif Discovery and Genome-Wide Expression Analysis. Erin M. Conlon
Integrating DNA Motif Discovery and Genome-Wide Expression Analysis Department of Mathematics and Statistics University of Massachusetts Amherst Statistics in Functional Genomics Workshop Ascona, Switzerland
Volume 3, Issue 2, February 2015 International Journal of Advance Research in Computer Science and Management Studies
Volume 3, Issue 2, February 2015 International Journal of Advance Research in Computer Science and Management Studies Research Article / Survey Paper / Case Study Available online at: www.ijarcsms.com
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
Comparative Study: ACO and EC for TSP
Comparative Study: ACO and EC for TSP Urszula Boryczka 1 and Rafa l Skinderowicz 1 and Damian Świstowski1 1 University of Silesia, Institute of Computer Science, Sosnowiec, Poland, e-mail: [email protected]
GenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
Integer Programming: Algorithms - 3
Week 9 Integer Programming: Algorithms - 3 OPR 992 Applied Mathematical Programming OPR 992 - Applied Mathematical Programming - p. 1/12 Dantzig-Wolfe Reformulation Example Strength of the Linear Programming
Next Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University [email protected] http://tandem.bu.edu/ The Human Genome Project took
Genetomic Promototypes
Genetomic Promototypes Mirkó Palla and Dana Pe er Department of Mechanical Engineering Clarkson University Potsdam, New York and Department of Genetics Harvard Medical School 77 Avenue Louis Pasteur Boston,
2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
Evolutionary SAT Solver (ESS)
Ninth LACCEI Latin American and Caribbean Conference (LACCEI 2011), Engineering for a Smart Planet, Innovation, Information Technology and Computational Tools for Sustainable Development, August 3-5, 2011,
DnaSP, DNA polymorphism analyses by the coalescent and other methods.
DnaSP, DNA polymorphism analyses by the coalescent and other methods. Author affiliation: Julio Rozas 1, *, Juan C. Sánchez-DelBarrio 2,3, Xavier Messeguer 2 and Ricardo Rozas 1 1 Departament de Genètica,
ISSN: 2319-5967 ISO 9001:2008 Certified International Journal of Engineering Science and Innovative Technology (IJESIT) Volume 2, Issue 3, May 2013
Transistor Level Fault Finding in VLSI Circuits using Genetic Algorithm Lalit A. Patel, Sarman K. Hadia CSPIT, CHARUSAT, Changa., CSPIT, CHARUSAT, Changa Abstract This paper presents, genetic based algorithm
PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: [email protected]
BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,
Management Science Letters
Management Science Letters 4 (2014) 905 912 Contents lists available at GrowingScience Management Science Letters homepage: www.growingscience.com/msl Measuring customer loyalty using an extended RFM and
14.10.2014. Overview. Swarms in nature. Fish, birds, ants, termites, Introduction to swarm intelligence principles Particle Swarm Optimization (PSO)
Overview Kyrre Glette kyrrehg@ifi INF3490 Swarm Intelligence Particle Swarm Optimization Introduction to swarm intelligence principles Particle Swarm Optimization (PSO) 3 Swarms in nature Fish, birds,
Lecture 19: Proteins, Primary Struture
CPS260/BGT204.1 Algorithms in Computational Biology November 04, 2003 Lecture 19: Proteins, Primary Struture Lecturer: Pankaj K. Agarwal Scribe: Qiuhua Liu 19.1 The Building Blocks of Protein [1] Proteins
Modified Version of Roulette Selection for Evolution Algorithms - the Fan Selection
Modified Version of Roulette Selection for Evolution Algorithms - the Fan Selection Adam S lowik, Micha l Bia lko Department of Electronic, Technical University of Koszalin, ul. Śniadeckich 2, 75-453 Koszalin,
Comparative genomic hybridization Because arrays are more than just a tool for expression analysis
Microarray Data Analysis Workshop MedVetNet Workshop, DTU 2008 Comparative genomic hybridization Because arrays are more than just a tool for expression analysis Carsten Friis ( with several slides from
New Modifications of Selection Operator in Genetic Algorithms for the Traveling Salesman Problem
New Modifications of Selection Operator in Genetic Algorithms for the Traveling Salesman Problem Radovic, Marija; and Milutinovic, Veljko Abstract One of the algorithms used for solving Traveling Salesman
Effect of Using Neural Networks in GA-Based School Timetabling
Effect of Using Neural Networks in GA-Based School Timetabling JANIS ZUTERS Department of Computer Science University of Latvia Raina bulv. 19, Riga, LV-1050 LATVIA [email protected] Abstract: - The school
Principles of Evolution - Origin of Species
Theories of Organic Evolution X Multiple Centers of Creation (de Buffon) developed the concept of "centers of creation throughout the world organisms had arisen, which other species had evolved from X
Evolutionary Detection of Rules for Text Categorization. Application to Spam Filtering
Advances in Intelligent Systems and Technologies Proceedings ECIT2004 - Third European Conference on Intelligent Systems and Technologies Iasi, Romania, July 21-23, 2004 Evolutionary Detection of Rules
A Review And Evaluations Of Shortest Path Algorithms
A Review And Evaluations Of Shortest Path Algorithms Kairanbay Magzhan, Hajar Mat Jani Abstract: Nowadays, in computer networks, the routing is based on the shortest path problem. This will help in minimizing
A Framework for Genetic Algorithms in Games
A Framework for Genetic Algorithms in Games Vinícius Godoy de Mendonça Cesar Tadeu Pozzer Roberto Tadeu Raiitz 1 Universidade Positivo, Departamento de Informática 2 Universidade Federal de Santa Maria,
Randomized Sorting as a Big Data Search Algorithm
Int'l Conf. on Advances in Big Data Analytics ABDA' 7 Randomized Sorting as a Big Data Search Algorithm I. Avramovic and D. S. Richards Department of Computer Science, George Mason University, Fairfax,
Year 10: The transmission of heritable characteristics from one generation to the next involves DNA
1 Overview In this activity, students identify an unknown code (Activity 1) and then apply it to identify the message in an unknown text (Activity 2). Discussion questions consolidate the learning,and
Evolution (18%) 11 Items Sample Test Prep Questions
Evolution (18%) 11 Items Sample Test Prep Questions Grade 7 (Evolution) 3.a Students know both genetic variation and environmental factors are causes of evolution and diversity of organisms. (pg. 109 Science
Bob Jesberg. Boston, MA April 3, 2014
DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double
TOWARD BIG DATA ANALYSIS WORKSHOP
TOWARD BIG DATA ANALYSIS WORKSHOP 邁 向 巨 量 資 料 分 析 研 討 會 摘 要 集 2015.06.05-06 巨 量 資 料 之 矩 陣 視 覺 化 陳 君 厚 中 央 研 究 院 統 計 科 學 研 究 所 摘 要 視 覺 化 (Visualization) 與 探 索 式 資 料 分 析 (Exploratory Data Analysis, EDA)
Introduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]
Practical Applications of Evolutionary Computation to Financial Engineering
Hitoshi Iba and Claus C. Aranha Practical Applications of Evolutionary Computation to Financial Engineering Robust Techniques for Forecasting, Trading and Hedging 4Q Springer Contents 1 Introduction to
LECTURE 6 Gene Mutation (Chapter 16.1-16.2)
LECTURE 6 Gene Mutation (Chapter 16.1-16.2) 1 Mutation: A permanent change in the genetic material that can be passed from parent to offspring. Mutant (genotype): An organism whose DNA differs from the
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
RNA Structure and folding
RNA Structure and folding Overview: The main functional biomolecules in cells are polymers DNA, RNA and proteins For RNA and Proteins, the specific sequence of the polymer dictates its final structure
Offline sorting buffers on Line
Offline sorting buffers on Line Rohit Khandekar 1 and Vinayaka Pandit 2 1 University of Waterloo, ON, Canada. email: [email protected] 2 IBM India Research Lab, New Delhi. email: [email protected]
Terms: The following terms are presented in this lesson (shown in bold italics and on PowerPoint Slides 2 and 3):
Unit B: Understanding Animal Reproduction Lesson 4: Understanding Genetics Student Learning Objectives: Instruction in this lesson should result in students achieving the following objectives: 1. Explain
Replication Study Guide
Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
A greedy algorithm for the DNA sequencing by hybridization with positive and negative errors and information about repetitions
BULLETIN OF THE POLISH ACADEMY OF SCIENCES TECHNICAL SCIENCES, Vol. 59, No. 1, 2011 DOI: 10.2478/v10175-011-0015-0 Varia A greedy algorithm for the DNA sequencing by hybridization with positive and negative
An ACO/VNS Hybrid Approach for a Large-Scale Energy Management Problem
An ACO/VNS Hybrid Approach for a Large-Scale Energy Management Problem Challenge ROADEF/EURO 2010 Roman Steiner, Sandro Pirkwieser, Matthias Prandtstetter Vienna University of Technology, Austria Institute
Comparison of Major Domination Schemes for Diploid Binary Genetic Algorithms in Dynamic Environments
Comparison of Maor Domination Schemes for Diploid Binary Genetic Algorithms in Dynamic Environments A. Sima UYAR and A. Emre HARMANCI Istanbul Technical University Computer Engineering Department Maslak
Memory Allocation Technique for Segregated Free List Based on Genetic Algorithm
Journal of Al-Nahrain University Vol.15 (2), June, 2012, pp.161-168 Science Memory Allocation Technique for Segregated Free List Based on Genetic Algorithm Manal F. Younis Computer Department, College
Network Protocol Analysis using Bioinformatics Algorithms
Network Protocol Analysis using Bioinformatics Algorithms Marshall A. Beddoe [email protected] ABSTRACT Network protocol analysis is currently performed by hand using only intuition and a protocol
A Genetic Algorithm Processor Based on Redundant Binary Numbers (GAPBRBN)
ISSN: 2278 1323 All Rights Reserved 2014 IJARCET 3910 A Genetic Algorithm Processor Based on Redundant Binary Numbers (GAPBRBN) Miss: KIRTI JOSHI Abstract A Genetic Algorithm (GA) is an intelligent search
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
Sequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment
Sequence Analysis 15: lecture 5 Substitution matrices Multiple sequence alignment A teacher's dilemma To understand... Multiple sequence alignment Substitution matrices Phylogenetic trees You first need
A Service Revenue-oriented Task Scheduling Model of Cloud Computing
Journal of Information & Computational Science 10:10 (2013) 3153 3161 July 1, 2013 Available at http://www.joics.com A Service Revenue-oriented Task Scheduling Model of Cloud Computing Jianguang Deng a,b,,
HYBRID GENETIC ALGORITHM PARAMETER EFFECTS FOR OPTIMIZATION OF CONSTRUCTION RESOURCE ALLOCATION PROBLEM. Jin-Lee KIM 1, M. ASCE
1560 HYBRID GENETIC ALGORITHM PARAMETER EFFECTS FOR OPTIMIZATION OF CONSTRUCTION RESOURCE ALLOCATION PROBLEM Jin-Lee KIM 1, M. ASCE 1 Assistant Professor, Department of Civil Engineering and Construction
Fact Sheet 14 EPIGENETICS
This fact sheet describes epigenetics which refers to factors that can influence the way our genes are expressed in the cells of our body. In summary Epigenetics is a phenomenon that affects the way cells
Original Article Efficient Genetic Algorithm on Linear Programming Problem for Fittest Chromosomes
International Archive of Applied Sciences and Technology Volume 3 [2] June 2012: 47-57 ISSN: 0976-4828 Society of Education, India Website: www.soeagra.com/iaast/iaast.htm Original Article Efficient Genetic
New binary representation in Genetic Algorithms for solving TSP by mapping permutations to a list of ordered numbers
Proceedings of the 5th WSEAS Int Conf on COMPUTATIONAL INTELLIGENCE, MAN-MACHINE SYSTEMS AND CYBERNETICS, Venice, Italy, November 0-, 006 363 New binary representation in Genetic Algorithms for solving
Soft-Computing Models for Building Applications - A Feasibility Study (EPSRC Ref: GR/L84513)
Soft-Computing Models for Building Applications - A Feasibility Study (EPSRC Ref: GR/L84513) G S Virk, D Azzi, K I Alkadhimi and B P Haynes Department of Electrical and Electronic Engineering, University
Lab 4: 26 th March 2012. Exercise 1: Evolutionary algorithms
Lab 4: 26 th March 2012 Exercise 1: Evolutionary algorithms 1. Found a problem where EAs would certainly perform very poorly compared to alternative approaches. Explain why. Suppose that we want to find
Chapter 6 DNA Replication
Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore
SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications
Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each
The Applications of Genetic Algorithms in Stock Market Data Mining Optimisation
The Applications of Genetic Algorithms in Stock Market Data Mining Optimisation Li Lin, Longbing Cao, Jiaqi Wang, Chengqi Zhang Faculty of Information Technology, University of Technology, Sydney, NSW
AP Biology Essential Knowledge Student Diagnostic
AP Biology Essential Knowledge Student Diagnostic Background The Essential Knowledge statements provided in the AP Biology Curriculum Framework are scientific claims describing phenomenon occurring in
What mathematical optimization can, and cannot, do for biologists. Steven Kelk Department of Knowledge Engineering (DKE) Maastricht University, NL
What mathematical optimization can, and cannot, do for biologists Steven Kelk Department of Knowledge Engineering (DKE) Maastricht University, NL Introduction There is no shortage of literature about the
