Rapid alignment methods: FASTA and BLAST. p The biological problem p Search strategies p FASTA p BLAST
|
|
|
- Alvin Ross
- 9 years ago
- Views:
Transcription
1 Rapid alignment methods: FASTA and BLAST p The biological problem p Search strategies p FASTA p BLAST 257
2 BLAST: Basic Local Alignment Search Tool p BLAST (Altschul et al., 1990) and its variants are some of the most common sequence search tools in use p Roughly, the basic BLAST has three parts: 1. Find segment pairs between the query sequence and a database sequence above score threshold ( seed hits ) 2. Extend seed hits into locally maximal segment pairs 3. Calculate p-values and a rank ordering of the local alignments p Gapped BLAST introduced in 1997 allows for gaps in alignments 258
3 Finding seed hits p First, we generate a set of neighborhood sequences for given k, match score matrix and threshold T p Neighborhood sequences of a k-word w include all strings of length k that, when aligned against w, have the alignment score at least T p For instance, let I = GCATCGGC, J = CCATCGCCATCG and k = 5, match score be 1, mismatch score be 0 and T = 4 259
4 Finding seed hits p I = GCATCGGC, J = CCATCGCCATCG, k = 5, match score 1, mismatch score 0, T = 4 p This allows for one mismatch in each k-word p The neighborhood of the first k-word of I, GCATC, is GCATC and the 15 sequences A A C A A CCATC,G GATC,GC GTC,GCA CC,GCAT G T T T G T 260
5 Finding seed hits p I = GCATCGGC has 4 k-words and thus 4x16 = 64 5-word patterns to locate in J Occurences of patterns in J are called seed hits p Patterns can be found using exact search in time proportional to the sum of pattern lengths + length of J + number of matches (Aho-Corasick algorithm) Methods for pattern matching are developed on course String processing algorithms p Compare this approach to FASTA 261
6 Extending seed hits: original BLAST 262 p Initial seed hits are extended into locally maximal segment pairs or High-scoring Segment Pairs (HSP) p Extensions do not add gaps to the alignment p Sequence is extended until the alignment score drops below the maximum attained score minus a threshold parameter value p All statistically significant HSPs reported Altschul, S.F., Gish, W., Miller, W., Myers, E. W. and Lipman, D. J., J. Mol. Biol., 215, , 1990 Extension AACCGTTCATTA TAGCGATCTTTT Initial seed hit
7 Extending seed hits: gapped BLAST p In a later version of BLAST, two seed hits have to be found on the same diagonal Hits have to be non-overlapping If the hits are closer than A (additional parameter), then they are joined into a HSP p Threshold value T is lowered to achieve comparable sensitivity p If the resulting HSP achieves a score at least S g, a gapped extension is triggered Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, and Lipman DJ, Nucleic Acids Res. 1;25(17), ,
8 Gapped extensions of HSPs p Local alignment is performed starting from the HSP p Dynamic programming matrix filled in forward and backward directions (see figure) p Skip cells where value would bex g below the best alignment score found so far HSP Region searched with score above cutoff parameter Region potentially searched by the alignment algorithm 264
9 Estimating the significance of results p In general, we have a score S(D, X) = s for a sequence X found in database D p BLAST rank-orders the sequences found by p- values p The p-value for this hit is P(S(D, Y) s) where Y is a random sequence Measures the amount of surprise of finding sequence X p A smaller p-value indicates more significant hit A p-value of 0.1 means that one-tenth of random sequences would have as large score as our result 265
10 Estimating the significance of results p In BLAST, p-values are computed roughly as follows p There are nm places to begin an optimal alignment in the n x m alignment matrix p Optimal alignment is preceded by a mismatch and has t matching (identical) letters (Assume match score 1 and mismatch/indel score - ) p Let p = P(two random letters are equal) p The probability of having a mismatch and then t matches is (1-p)p t 266
11 Estimating the significance of results p We model this event by a Poisson distribution (why?) with mean = nm(1-p)p t p P(there is local alignment t or longer) 1 P(no such event) = 1 e - = 1 exp(-nm(1-p)p t ) p An equation of the same form is used in Blast: p E-value = P(S(D, Y) s) 1 exp(-nm t ) where > 0 and 0 < < 1 p Parameters and are estimated from data 267
12 Scoring amino acid alignments p We need a way to compute the score S(D, X) for aligning the sequence X against database D p Scoring DNA alignments was discussed previously p Constructing a scoring model for amino acids is more challenging 20 different amino acids vs. 4 bases p Figure shows the molecular structures of the 20 amino acids 268
13 Scoring amino acid alignments p Substitutions between chemically similar amino acids are more frequent than between dissimilar amino acids p We can check our scoring model against this 269
14 Score matrices p Scores s = S(D, X) are obtained from score matrices p Let A = A 1 a 2 a n and B = b 1 b 2 b n be sequences of equal length (no gaps allowed to simplify things) p To obtain a score for alignment of A and B, where a i is aligned against b i, we take the ratio of two probabilities The probability of having A and B where the characters match (match model M) The probability that A and B were chosen randomly (random model R) 270
15 Score matrices: random model p Under the random model, the probability of having X and Y is where q xi is the probability of occurence of amino acid type x i p Position where an amino acid occurs does not affect its type 271
16 Score matrices: match model p Letp ab be the probability of having amino acids of type a and b aligned against each other given they have evolved from the same ancestor c p The probability is 272
17 Score matrices: log-odds ratio score p We obtain the score S by taking the ratio of these two probabilities and taking a logarithm of the ratio 273
18 Score matrices: log-odds ratio score p The score S is obtained by summing over character pair-specific scores: p The probabilities q a and p ab are extracted from data 274
19 Calculating score matrices for amino acids p Probabilities q a are in principle easy to obtain: Count relative frequencies of every amino acid in a sequence database 275
20 Calculating score matrices for amino acids p To calculate p ab we can use a known pool of aligned sequences p BLOCKS is a database of highly conserved regions for proteins p It lists multiply aligned, ungapped and conserved protein segments p Example from BLOCKS shows genes related to human gene associated with DNA-repair defect xeroderma pigmentosum Block PR00851A ID XRODRMPGMNTB; BLOCK AC PR00851A; distance from previous block=(52,131) DE Xeroderma pigmentosum group B protein signature BL adapted; width=21; seqs=8; 99.5%=985; strength=1287 XPB_HUMAN P19447 ( 74) RPLWVAPDGHIFLEAFSPVYK 54 XPB_MOUSE P49135 ( 74) RPLWVAPDGHIFLEAFSPVYK 54 P91579 ( 80) RPLYLAPDGHIFLESFSPVYK 67 XPB_DROME Q02870 ( 84) RPLWVAPNGHVFLESFSPVYK 79 RA25_YEAST Q00578 ( 131) PLWISPSDGRIILESFSPLAE 100 Q38861 ( 52) RPLWACADGRIFLETFSPLYK 71 O13768 ( 90) PLWINPIDGRIILEAFSPLAE 100 O00835 ( 79) RPIWVCPDGHIFLETFSAIYK
21 BLOSUM matrix p BLOSUM is a score matrix for amino acid sequences derived from BLOCKS data p First, count pairwise matches f x,y for every amino acid type pair (x, y) p For example, for column 3 and amino acids L and W, we find 8 pairwise matches: f L,W = f W,L = 8 RPLWVAPD RPLWVAPR RPLWVAPN PLWISPSD RPLWACAD PLWINPID RPIWVCPD 277
22 Creating a BLOSUM matrix p Probability p ab is obtained by dividing f ab with the total number of pairs (note difference with course book): p We get probabilities q a by RPLWVAPD RPLWVAPR RPLWVAPN PLWISPSD RPLWACAD PLWINPID RPIWVCPD 278
23 Creating a BLOSUM matrix p The probabilities p ab and q a can now be plugged into to get a 20 x 20 matrix of scores s(a, b). p Next slide presents the BLOSUM62 matrix Values scaled by factor of 2 and rounded to integers Additional step required to take into account expected evolutionary distance Described in Deonier s book in more detail 279
24 BLOSUM A R N D C Q E G H I L K M F P S T W Y V B Z X * A R N D C Q E G H I L K M F P S T W Y V B Z X *
25 Using BLOSUM62 matrix MQLEANADTSV LQEQAEAQGEM = = 7 281
26 Demonstration of BLAST at NCBI p 282
Pairwise Sequence Alignment
Pairwise Sequence Alignment [email protected] SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What
BLAST. Anders Gorm Pedersen & Rasmus Wernersson
BLAST Anders Gorm Pedersen & Rasmus Wernersson Database searching Using pairwise alignments to search databases for similar sequences Query sequence Database Database searching Most common use of pairwise
Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003
Similarity Searches on Sequence Databases: BLAST, FASTA Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Outline Importance of Similarity Heuristic Sequence Alignment:
Algorithms in Bioinformatics I, WS06/07, C.Dieterich 47. This lecture is based on the following, which are all recommended reading:
Algorithms in Bioinformatics I, WS06/07, C.Dieterich 47 5 BLAST and FASTA This lecture is based on the following, which are all recommended reading: D.J. Lipman and W.R. Pearson, Rapid and Sensitive Protein
Amino Acids and Their Properties
Amino Acids and Their Properties Recap: ss-rrna and mutations Ribosomal RNA (rrna) evolves very slowly Much slower than proteins ss-rrna is typically used So by aligning ss-rrna of one organism with that
Sequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment
Sequence Analysis 15: lecture 5 Substitution matrices Multiple sequence alignment A teacher's dilemma To understand... Multiple sequence alignment Substitution matrices Phylogenetic trees You first need
Bio-Informatics Lectures. A Short Introduction
Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively
PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: [email protected]
BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
THREE DIMENSIONAL REPRESENTATION OF AMINO ACID CHARAC- TERISTICS
THREE DIMENSIONAL REPRESENTATION OF AMINO ACID CHARAC- TERISTICS O.U. Sezerman 1, R. Islamaj 2, E. Alpaydin 2 1 Laborotory of Computational Biology, Sabancı University, Istanbul, Turkey. 2 Computer Engineering
Network Protocol Analysis using Bioinformatics Algorithms
Network Protocol Analysis using Bioinformatics Algorithms Marshall A. Beddoe [email protected] ABSTRACT Network protocol analysis is currently performed by hand using only intuition and a protocol
Biological Sequence Data Formats
Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA
Efficient Parallel Execution of Sequence Similarity Analysis Via Dynamic Load Balancing
Efficient Parallel Execution of Sequence Similarity Analysis Via Dynamic Load Balancing James D. Jackson Philip J. Hatcher Department of Computer Science Kingsbury Hall University of New Hampshire Durham,
MATCH Commun. Math. Comput. Chem. 61 (2009) 781-788
MATCH Communications in Mathematical and in Computer Chemistry MATCH Commun. Math. Comput. Chem. 61 (2009) 781-788 ISSN 0340-6253 Three distances for rapid similarity analysis of DNA sequences Wei Chen,
Module 1. Sequence Formats and Retrieval. Charles Steward
The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.
Design Style of BLAST and FASTA and Their Importance in Human Genome.
Design Style of BLAST and FASTA and Their Importance in Human Genome. Saba Khalid 1 and Najam-ul-haq 2 SZABIST Karachi, Pakistan Abstract: This subjected study will discuss the concept of BLAST and FASTA.BLAST
BIOINFORMATICS TUTORIAL
Bio 242 BIOINFORMATICS TUTORIAL Bio 242 α Amylase Lab Sequence Sequence Searches: BLAST Sequence Alignment: Clustal Omega 3d Structure & 3d Alignments DO NOT REMOVE FROM LAB. DO NOT WRITE IN THIS DOCUMENT.
ProteinPilot Report for ProteinPilot Software
ProteinPilot Report for ProteinPilot Software Detailed Analysis of Protein Identification / Quantitation Results Automatically Sean L Seymour, Christie Hunter SCIEX, USA Pow erful mass spectrometers like
Protein & DNA Sequence Analysis. Bobbie-Jo Webb-Robertson May 3, 2004
Protein & DNA Sequence Analysis Bobbie-Jo Webb-Robertson May 3, 2004 Sequence Analysis Anything connected to identifying higher biological meaning out of raw sequence data. 2 Genomic & Proteomic Data Sequence
Choices, choices, choices... Which sequence database? Which modifications? What mass tolerance?
Optimization 1 Choices, choices, choices... Which sequence database? Which modifications? What mass tolerance? Where to begin? 2 Sequence Databases Swiss-prot MSDB, NCBI nr dbest Species specific ORFS
A Tutorial in Genetic Sequence Classification Tools and Techniques
A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University [email protected] www.jakemdrew.com Sequence Characters IUPAC nucleotide
DNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
CALCULATIONS & STATISTICS
CALCULATIONS & STATISTICS CALCULATION OF SCORES Conversion of 1-5 scale to 0-100 scores When you look at your report, you will notice that the scores are reported on a 0-100 scale, even though respondents
SGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD
White Paper SGI High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems Haruna Cofer*, PhD January, 2012 Abstract The SGI High Throughput Computing (HTC) Wrapper
CD-HIT User s Guide. Last updated: April 5, 2010. http://cd-hit.org http://bioinformatics.org/cd-hit/
CD-HIT User s Guide Last updated: April 5, 2010 http://cd-hit.org http://bioinformatics.org/cd-hit/ Program developed by Weizhong Li s lab at UCSD http://weizhong-lab.ucsd.edu [email protected] 1. Introduction
3. About R2oDNA Designer
3. About R2oDNA Designer Please read these publications for more details: Casini A, Christodoulou G, Freemont PS, Baldwin GS, Ellis T, MacDonald JT. R2oDNA Designer: Computational design of biologically-neutral
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
Bioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
Question 2: How do you solve a matrix equation using the matrix inverse?
Question : How do you solve a matrix equation using the matrix inverse? In the previous question, we wrote systems of equations as a matrix equation AX B. In this format, the matrix A contains the coefficients
Web Data Extraction: 1 o Semestre 2007/2008
Web Data : Given Slides baseados nos slides oficiais do livro Web Data Mining c Bing Liu, Springer, December, 2006. Departamento de Engenharia Informática Instituto Superior Técnico 1 o Semestre 2007/2008
Minería de Datos ANALISIS DE UN SET DE DATOS.! Visualization Techniques! Combined Graph! Charts and Pies! Search for specific functions
Minería de Datos ANALISIS DE UN SET DE DATOS! Visualization Techniques! Combined Graph! Charts and Pies! Search for specific functions Data Mining on the DAG ü When working with large datasets, annotation
When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want
1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very
Activity IT S ALL RELATIVES The Role of DNA Evidence in Forensic Investigations
Activity IT S ALL RELATIVES The Role of DNA Evidence in Forensic Investigations SCENARIO You have responded, as a result of a call from the police to the Coroner s Office, to the scene of the death of
Frequently Asked Questions Next Generation Sequencing
Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided
Math 202-0 Quizzes Winter 2009
Quiz : Basic Probability Ten Scrabble tiles are placed in a bag Four of the tiles have the letter printed on them, and there are two tiles each with the letters B, C and D on them (a) Suppose one tile
Dynamic Programming. Lecture 11. 11.1 Overview. 11.2 Introduction
Lecture 11 Dynamic Programming 11.1 Overview Dynamic Programming is a powerful technique that allows one to solve many different types of problems in time O(n 2 ) or O(n 3 ) for which a naive approach
7 Gaussian Elimination and LU Factorization
7 Gaussian Elimination and LU Factorization In this final section on matrix factorization methods for solving Ax = b we want to take a closer look at Gaussian elimination (probably the best known method
Fibonacci Numbers and Greatest Common Divisors. The Finonacci numbers are the numbers in the sequence 1, 1, 2, 3, 5, 8, 13, 21, 34, 55, 89, 144,...
Fibonacci Numbers and Greatest Common Divisors The Finonacci numbers are the numbers in the sequence 1, 1, 2, 3, 5, 8, 13, 21, 34, 55, 89, 144,.... After starting with two 1s, we get each Fibonacci number
Lecture 4: Exact string searching algorithms. Exact string search algorithms. Definitions. Exact string searching or matching
COSC 348: Computing for Bioinformatics Definitions A pattern (keyword) is an ordered sequence of symbols. Lecture 4: Exact string searching algorithms Lubica Benuskova http://www.cs.otago.ac.nz/cosc348/
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:
Analysing Questionnaires using Minitab (for SPSS queries contact -) [email protected]
Analysing Questionnaires using Minitab (for SPSS queries contact -) [email protected] Structure As a starting point it is useful to consider a basic questionnaire as containing three main sections:
Solving Systems of Linear Equations Using Matrices
Solving Systems of Linear Equations Using Matrices What is a Matrix? A matrix is a compact grid or array of numbers. It can be created from a system of equations and used to solve the system of equations.
Current Motif Discovery Tools and their Limitations
Current Motif Discovery Tools and their Limitations Philipp Bucher SIB / CIG Workshop 3 October 2006 Trendy Concepts and Hypotheses Transcription regulatory elements act in a context-dependent manner.
Chapter 3 RANDOM VARIATE GENERATION
Chapter 3 RANDOM VARIATE GENERATION In order to do a Monte Carlo simulation either by hand or by computer, techniques must be developed for generating values of random variables having known distributions.
Webserver: bioinfo.bio.wzw.tum.de Mail: [email protected]
Webserver: bioinfo.bio.wzw.tum.de Mail: [email protected] About me H. Werner Mewes, Lehrstuhl f. Bioinformatik, WZW C.V.: Studium der Chemie in Marburg Uni Heidelberg (Med. Fakultät, Bioenergetik)
6.4 Normal Distribution
Contents 6.4 Normal Distribution....................... 381 6.4.1 Characteristics of the Normal Distribution....... 381 6.4.2 The Standardized Normal Distribution......... 385 6.4.3 Meaning of Areas under
Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011
Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear
Molecular Databases and Tools
NWeHealth, The University of Manchester Molecular Databases and Tools Afternoon Session: NCBI/EBI resources, pairwise alignment, BLAST, multiple sequence alignment and primer finding. Dr. Georgina Moulton
Clone Manager. Getting Started
Clone Manager for Windows Professional Edition Volume 2 Alignment, Primer Operations Version 9.5 Getting Started Copyright 1994-2015 Scientific & Educational Software. All rights reserved. The software
Genome Explorer For Comparative Genome Analysis
Genome Explorer For Comparative Genome Analysis Jenn Conn 1, Jo L. Dicks 1 and Ian N. Roberts 2 Abstract Genome Explorer brings together the tools required to build and compare phylogenies from both sequence
Solving Rational Equations
Lesson M Lesson : Student Outcomes Students solve rational equations, monitoring for the creation of extraneous solutions. Lesson Notes In the preceding lessons, students learned to add, subtract, multiply,
T cell Epitope Prediction
Institute for Immunology and Informatics T cell Epitope Prediction EpiMatrix Eric Gustafson January 6, 2011 Overview Gathering raw data Popular sources Data Management Conservation Analysis Multiple Alignments
Tutorial for Proteomics Data Submission. Katalin F. Medzihradszky Robert J. Chalkley UCSF
Tutorial for Proteomics Data Submission Katalin F. Medzihradszky Robert J. Chalkley UCSF Why Have Guidelines? Large-scale proteomics studies create huge amounts of data. It is impossible/impractical to
Protein Sequence Analysis - Overview -
Protein Sequence Analysis - Overview - UDEL Workshop Raja Mazumder Research Associate Professor, Department of Biochemistry and Molecular Biology Georgetown University Medical Center Topics Why do protein
14.10.2014. Overview. Swarms in nature. Fish, birds, ants, termites, Introduction to swarm intelligence principles Particle Swarm Optimization (PSO)
Overview Kyrre Glette kyrrehg@ifi INF3490 Swarm Intelligence Particle Swarm Optimization Introduction to swarm intelligence principles Particle Swarm Optimization (PSO) 3 Swarms in nature Fish, birds,
Investigating the genetic basis for intelligence
Investigating the genetic basis for intelligence Steve Hsu University of Oregon and BGI www.cog-genomics.org Outline: a multidisciplinary subject 1. What is intelligence? Psychometrics 2. g and GWAS: a
IV. ALGEBRAIC CONCEPTS
IV. ALGEBRAIC CONCEPTS Algebra is the language of mathematics. Much of the observable world can be characterized as having patterned regularity where a change in one quantity results in changes in other
Performance Metrics for Graph Mining Tasks
Performance Metrics for Graph Mining Tasks 1 Outline Introduction to Performance Metrics Supervised Learning Performance Metrics Unsupervised Learning Performance Metrics Optimizing Metrics Statistical
Operation Count; Numerical Linear Algebra
10 Operation Count; Numerical Linear Algebra 10.1 Introduction Many computations are limited simply by the sheer number of required additions, multiplications, or function evaluations. If floating-point
MATRIX ALGEBRA AND SYSTEMS OF EQUATIONS
MATRIX ALGEBRA AND SYSTEMS OF EQUATIONS Systems of Equations and Matrices Representation of a linear system The general system of m equations in n unknowns can be written a x + a 2 x 2 + + a n x n b a
Gene Expression Analysis
Gene Expression Analysis Jie Peng Department of Statistics University of California, Davis May 2012 RNA expression technologies High-throughput technologies to measure the expression levels of thousands
IB Maths SL Sequence and Series Practice Problems Mr. W Name
IB Maths SL Sequence and Series Practice Problems Mr. W Name Remember to show all necessary reasoning! Separate paper is probably best. 3b 3d is optional! 1. In an arithmetic sequence, u 1 = and u 3 =
BUDAPEST: Bioinformatics Utility for Data Analysis of Proteomics using ESTs
BUDAPEST: Bioinformatics Utility for Data Analysis of Proteomics using ESTs Richard J. Edwards 2008. Contents 1. Introduction... 2 1.1. Version...2 1.2. Using this Manual...2 1.3. Why use BUDAPEST?...2
Guide for Bioinformatics Project Module 3
Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first
Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6
Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6 In the last lab, you learned how to perform basic multiple sequence alignments. While useful in themselves for determining conserved residues
MATRIX ALGEBRA AND SYSTEMS OF EQUATIONS. + + x 2. x n. a 11 a 12 a 1n b 1 a 21 a 22 a 2n b 2 a 31 a 32 a 3n b 3. a m1 a m2 a mn b m
MATRIX ALGEBRA AND SYSTEMS OF EQUATIONS 1. SYSTEMS OF EQUATIONS AND MATRICES 1.1. Representation of a linear system. The general system of m equations in n unknowns can be written a 11 x 1 + a 12 x 2 +
Math 115 Spring 2011 Written Homework 5 Solutions
. Evaluate each series. a) 4 7 0... 55 Math 5 Spring 0 Written Homework 5 Solutions Solution: We note that the associated sequence, 4, 7, 0,..., 55 appears to be an arithmetic sequence. If the sequence
A Non-Linear Schema Theorem for Genetic Algorithms
A Non-Linear Schema Theorem for Genetic Algorithms William A Greene Computer Science Department University of New Orleans New Orleans, LA 70148 bill@csunoedu 504-280-6755 Abstract We generalize Holland
MORPHEUS. http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix.
MORPHEUS http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix. Reference: MORPHEUS, a Webtool for Transcripton Factor Binding Analysis Using
3.1 Solving Systems Using Tables and Graphs
Algebra 2 Chapter 3 3.1 Solve Systems Using Tables & Graphs 3.1 Solving Systems Using Tables and Graphs A solution to a system of linear equations is an that makes all of the equations. To solve a system
Package hoarder. June 30, 2015
Type Package Title Information Retrieval for Genetic Datasets Version 0.1 Date 2015-06-29 Author [aut, cre], Anu Sironen [aut] Package hoarder June 30, 2015 Maintainer Depends
MATH 140 Lab 4: Probability and the Standard Normal Distribution
MATH 140 Lab 4: Probability and the Standard Normal Distribution Problem 1. Flipping a Coin Problem In this problem, we want to simualte the process of flipping a fair coin 1000 times. Note that the outcomes
Integrating DNA Motif Discovery and Genome-Wide Expression Analysis. Erin M. Conlon
Integrating DNA Motif Discovery and Genome-Wide Expression Analysis Department of Mathematics and Statistics University of Massachusetts Amherst Statistics in Functional Genomics Workshop Ascona, Switzerland
OD-seq: outlier detection in multiple sequence alignments
Jehl et al. BMC Bioinformatics (2015) 16:269 DOI 10.1186/s12859-015-0702-1 RESEARCH ARTICLE Open Access OD-seq: outlier detection in multiple sequence alignments Peter Jehl, Fabian Sievers * and Desmond
Module 10: Bioinformatics
Module 10: Bioinformatics 1.) Goal: To understand the general approaches for basic in silico (computer) analysis of DNA- and protein sequences. We are going to discuss sequence formatting required prior
15.062 Data Mining: Algorithms and Applications Matrix Math Review
.6 Data Mining: Algorithms and Applications Matrix Math Review The purpose of this document is to give a brief review of selected linear algebra concepts that will be useful for the course and to develop
Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS
Lab 2/Phylogenetics/September 16, 2002 1 Read: Tudge Chapter 2 PHYLOGENETICS Objective of the Lab: To understand how DNA and protein sequence information can be used to make comparisons and assess evolutionary
Constructing and Interpreting Confidence Intervals
Constructing and Interpreting Confidence Intervals Confidence Intervals In this power point, you will learn: Why confidence intervals are important in evaluation research How to interpret a confidence
GenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
FUZZY CLUSTERING ANALYSIS OF DATA MINING: APPLICATION TO AN ACCIDENT MINING SYSTEM
International Journal of Innovative Computing, Information and Control ICIC International c 0 ISSN 34-48 Volume 8, Number 8, August 0 pp. 4 FUZZY CLUSTERING ANALYSIS OF DATA MINING: APPLICATION TO AN ACCIDENT
Introduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]
Data Analysis Tools. Tools for Summarizing Data
Data Analysis Tools This section of the notes is meant to introduce you to many of the tools that are provided by Excel under the Tools/Data Analysis menu item. If your computer does not have that tool
How to do AHP analysis in Excel
How to do AHP analysis in Excel Khwanruthai BUNRUAMKAEW (D) Division of Spatial Information Science Graduate School of Life and Environmental Sciences University of Tsukuba ( March 1 st, 01) The Analytical
Unit 1 Number Sense. In this unit, students will study repeating decimals, percents, fractions, decimals, and proportions.
Unit 1 Number Sense In this unit, students will study repeating decimals, percents, fractions, decimals, and proportions. BLM Three Types of Percent Problems (p L-34) is a summary BLM for the material
Ready, Set, Go! Math Games for Serious Minds
Math Games with Cards and Dice presented at NAGC November, 2013 Ready, Set, Go! Math Games for Serious Minds Rande McCreight Lincoln Public Schools Lincoln, Nebraska Math Games with Cards Close to 20 -
WinBioinfTools: Bioinformatics Tools for Windows Cluster. Done By: Hisham Adel Mohamed
WinBioinfTools: Bioinformatics Tools for Windows Cluster Done By: Hisham Adel Mohamed Objective Implement and Modify Bioinformatics Tools To run under Windows Cluster Project : Research Project between
