Interaktionen von RNAs und Proteinen

Size: px
Start display at page:

Download "Interaktionen von RNAs und Proteinen"

Transcription

1 Sonja Prohaska Computational EvoDevo Universitaet Leipzig June 9, 2015

2 Studying RNA-protein interactions Given: target protein known to bind to RNA problem: find binding partners and binding sites experimental high-throughput techniques based on immunoprecipitation (IP) use antibodies against target protein RIP-seq: full RNAs associated with protein iclip and HITS-CLIP: RNA binding sites of proteins PAR-CLIP: nucleotide resolution RNA-protein interactions

3 Find RNAs bound by target protein RIP = RNA Immuno-Precipitation key feature: no crosslinking problem: may yield indirect interactions

4 Analysis of RIP-seq data what we want: full sequences of the protein-bound RNAs (all!) what we get: reads task for the bioinformatician as in transcriptome sequencing (polish reads: remove adapters and barcodes) map reads to the genome/transcriptome (allow for indels and spliced-reads) cluster reads compare location of clusters to genome annotation identify the bound RNA (if possible) difficulty: alternative transcripts

5 CLIP-seq methods general idea CLIP = Cross-Linking Immuno-Precipitation UV light is used to crosslink RNA and protein in vivo stringent purification: immunoprecipitation, SDS-PAGE, transfer to nitrocellulose proteinase K digests protein but leaves 1-2 amino acids at the UV crosslinked sites reverse transcriptase (RT) makes cdna cdna often truncates at UV crosslinked sites... methods differ here... sequencing bioinformatic analysis

6 CLIP-seq methods general idea Basic principle of all CLIP methods

7 Find RNA binding sites of target protein HITS-CLIP = HIgh-Throughput Sequencing of RNA isolated by Cross-Linking Immuno-Precipitation 254nm UV crosslinking in vivo cell lysis requires 3 - and 5 -ligated adapters (for amplification) revers transcriptase (RT) makes cdna stalling of the RT at UV crosslink sites no amplification (5 -adapter missing) read through at UV crosslink sites induces mutations key feature: crosslink-induced mutation site (CIMS) Problem: high sequencing depths required Problem: destinguish CIMS from technical errors

8 Find RNA binding sites of target protein HITS-CLIP = HIgh-Throughput Sequencing of RNA isolated by Cross-Linking Immuno-Precipitation key feature: crosslink-induced mutation site (CIMS)

9 Find RNA binding sites of target protein iclip = individual-nucleotide resolution CLIP key feature: revers transcription terminates at crosslinks key insight: sites of trancation are sites of crosslinking

10 just another graphics for iclip

11 Single nucleotide contacts of target protein and RNA PAR-CLIP = Photo-Activated RNA CLIP key feature: photo-activatable nucleotides crosslinks key insight: nucleotide transitions indicate crosslinks

12 Single nucleotide contacts of target protein and RNA PAR-CLIP = Photo-Activated RNA CLIP photo-activated nucleotides 4SU and 6SG fed to cells, incorporated in nascent RNA reverse transcriptase inserts G opposite of 4SU = T C transition reverse transcriptase inserts T opposite of 6SG = G A transition bioinformatics: search read clusters with significantly high T > C mismatch frequency RNA U U A G G RNA U U A G G A A T C C A A T C C RNA U 4SU A G G RNA U U A 6SG G A G T C C A A T T C U C A G G U U A A G A G T C C A A T T C

13 CLIP-seq data What do we get? RBP HITS CLIP crosslinking sites errors cdna iclip PAR CLIP HITS-CLIP-seq: nucleotide substitutions around the BS iclip: cdna/read ends at crosslinked nucleotides PAR-CLIP: particular substitutions at crosslinked nucleotides

14 Limitations

15 Protein-Protein Interactions

16 Protein-Protein Interactions stable interactions - oligomers oligomerization, dimerization domains, leucine-zipper covalent-bonds, hydrophobic contacts, salt bridges, disulphid briges, electon sharing transient interactions hydrophobic contacts, Van der Waals forces, hydrogen bonds define interaction interfaces/surfaces rather than specific domains known domains: SH2, SH3, PDZ, SAM

17 Factors regulting Protein-Protein Interactions protein concentrations, which in turn are affected by expression levels and degradation rates presence of other proteins, nucleic acids, and ions electric fields around proteins occurrence of covalent modifications

18 SH2 domain Src Homology 2 2 α-helices and 7 β strands known to identify a sequence of 3-6 aa high affinity to phosphorylated tyrosine function signaling about 100 human proteins

19 SAM domain Sterile Alpha Motif around 70 aa small five-helix bundle seems to possess the ability to bind RNA two large interfaces, form dimers small group of genes

20 PDZ domain aa 5 beta-sheets, helices binds to C-terminus of binding partner adding a β-strand to the β-sheet often multiple PDZ per protein increasing specificity 260 PDZ in 180 human genes

21 Example: Histones of Archaea left: archeal histone dimer, aa in DNA contact (blue), aa in tetramer-formation (orange); right: archeal histone tetramer with DNA; H3 cyan; H4 red; histone fold: helix-loop-helix-loop-helix Archaeal histones can form homo- and heterodimers. Eukaryotic histones can only form hetero-dimers.

22 Protein Complex Graph

23 Yeast two-hybrid (Y2H)

Interaktionen von Nukleinsäuren und Proteinen

Interaktionen von Nukleinsäuren und Proteinen Sonja Prohaska Computational EvoDevo Universitaet Leipzig June 9, 2015 DNA is never naked in a cell DNA is usually in association with proteins. In all domains of life there are small, basic chromosomal

More information

Built from 20 kinds of amino acids

Built from 20 kinds of amino acids Built from 20 kinds of amino acids Each Protein has a three dimensional structure. Majority of proteins are compact. Highly convoluted molecules. Proteins are folded polypeptides. There are four levels

More information

Profiling of non-coding RNA classes Gunter Meister

Profiling of non-coding RNA classes Gunter Meister Profiling of non-coding RNA classes Gunter Meister RNA Biology Regensburg University Universitätsstrasse 31 93053 Regensburg Overview Classes of non-coding RNAs Profiling strategies Validation Protein-RNA

More information

2007 7.013 Problem Set 1 KEY

2007 7.013 Problem Set 1 KEY 2007 7.013 Problem Set 1 KEY Due before 5 PM on FRIDAY, February 16, 2007. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Where in a eukaryotic cell do you

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu

Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu Expression and Purification of Recombinant Protein in bacteria and Yeast Presented By: Puspa pandey, Mohit sachdeva & Ming yu DNA Vectors Molecular carriers which carry fragments of DNA into host cell.

More information

Papers listed: Cell2. This weeks papers. Chapt 4. Protein structure and function

Papers listed: Cell2. This weeks papers. Chapt 4. Protein structure and function Papers listed: Cell2 During the semester I will speak of information from several papers. For many of them you will not be required to read these papers, however, you can do so for the fun of it (and it

More information

Nafith Abu Tarboush DDS, MSc, PhD natarboush@ju.edu.jo www.facebook.com/natarboush

Nafith Abu Tarboush DDS, MSc, PhD natarboush@ju.edu.jo www.facebook.com/natarboush Nafith Abu Tarboush DDS, MSc, PhD natarboush@ju.edu.jo www.facebook.com/natarboush α-keratins, bundles of α- helices Contain polypeptide chains organized approximately parallel along a single axis: Consist

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

Functional Architecture of RNA Polymerase I

Functional Architecture of RNA Polymerase I Cell, Volume 131 Supplemental Data Functional Architecture of RNA Polymerase I Claus-D. Kuhn, Sebastian R. Geiger, Sonja Baumli, Marco Gartmann, Jochen Gerber, Stefan Jennebach, Thorsten Mielke, Herbert

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

Myoglobin and Hemoglobin

Myoglobin and Hemoglobin Myoglobin and Hemoglobin Myoglobin and hemoglobin are hemeproteins whose physiological importance is principally related to their ability to bind molecular oxygen. Myoglobin (Mb) The oxygen storage protein

More information

The immune response Antibodies Antigens Epitopes (antigenic determinants) the part of a protein antigen recognized by an antibody Haptens small

The immune response Antibodies Antigens Epitopes (antigenic determinants) the part of a protein antigen recognized by an antibody Haptens small The immune response Antibodies Antigens Epitopes (antigenic determinants) the part of a protein antigen recognized by an antibody Haptens small molecules that can elicit an immune response when linked

More information

AP BIOLOGY 2008 SCORING GUIDELINES

AP BIOLOGY 2008 SCORING GUIDELINES AP BIOLOGY 2008 SCORING GUIDELINES Question 1 1. The physical structure of a protein often reflects and affects its function. (a) Describe THREE types of chemical bonds/interactions found in proteins.

More information

IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon. V. Polypeptides and Proteins

IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon. V. Polypeptides and Proteins IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon A. Acid/Base properties 1. carboxyl group is proton donor! weak acid 2. amino group is proton acceptor! weak base 3. At physiological ph: H

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression (Learning Objectives) Explain the role of gene expression is differentiation of function of cells which leads to the emergence of different tissues, organs, and organ systems

More information

The world of non-coding RNA. Espen Enerly

The world of non-coding RNA. Espen Enerly The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

Sickle cell anemia: Altered beta chain Single AA change (#6 Glu to Val) Consequence: Protein polymerizes Change in RBC shape ---> phenotypes

Sickle cell anemia: Altered beta chain Single AA change (#6 Glu to Val) Consequence: Protein polymerizes Change in RBC shape ---> phenotypes Protein Structure Polypeptide: Protein: Therefore: Example: Single chain of amino acids 1 or more polypeptide chains All polypeptides are proteins Some proteins contain >1 polypeptide Hemoglobin (O 2 binding

More information

Concluding lesson. Student manual. What kind of protein are you? (Basic)

Concluding lesson. Student manual. What kind of protein are you? (Basic) Concluding lesson Student manual What kind of protein are you? (Basic) Part 1 The hereditary material of an organism is stored in a coded way on the DNA. This code consists of four different nucleotides:

More information

MUTATION, DNA REPAIR AND CANCER

MUTATION, DNA REPAIR AND CANCER MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful

More information

NO CALCULATORS OR CELL PHONES ALLOWED

NO CALCULATORS OR CELL PHONES ALLOWED Biol 205 Exam 1 TEST FORM A Spring 2008 NAME Fill out both sides of the Scantron Sheet. On Side 2 be sure to indicate that you have TEST FORM A The answers to Part I should be placed on the SCANTRON SHEET.

More information

Lecture 8. Protein Trafficking/Targeting. Protein targeting is necessary for proteins that are destined to work outside the cytoplasm.

Lecture 8. Protein Trafficking/Targeting. Protein targeting is necessary for proteins that are destined to work outside the cytoplasm. Protein Trafficking/Targeting (8.1) Lecture 8 Protein Trafficking/Targeting Protein targeting is necessary for proteins that are destined to work outside the cytoplasm. Protein targeting is more complex

More information

DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH)

DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH) DNA, RNA, replication, translation, and transcription Overview Recall the central dogma of biology: DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) DNA structure

More information

Amino Acids. Amino acids are the building blocks of proteins. All AA s have the same basic structure: Side Chain. Alpha Carbon. Carboxyl. Group.

Amino Acids. Amino acids are the building blocks of proteins. All AA s have the same basic structure: Side Chain. Alpha Carbon. Carboxyl. Group. Protein Structure Amino Acids Amino acids are the building blocks of proteins. All AA s have the same basic structure: Side Chain Alpha Carbon Amino Group Carboxyl Group Amino Acid Properties There are

More information

Basic Concepts of DNA, Proteins, Genes and Genomes

Basic Concepts of DNA, Proteins, Genes and Genomes Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

Preliminary MFM Quiz

Preliminary MFM Quiz Preliminary MFM Quiz 1. The major carrier of chemical energy in all cells is: A) adenosine monophosphate B) adenosine diphosphate C) adenosine trisphosphate D) guanosine trisphosphate E) carbamoyl phosphate

More information

European Medicines Agency

European Medicines Agency European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein

More information

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed

More information

Carbohydrates, proteins and lipids

Carbohydrates, proteins and lipids Carbohydrates, proteins and lipids Chapter 3 MACROMOLECULES Macromolecules: polymers with molecular weights >1,000 Functional groups THE FOUR MACROMOLECULES IN LIFE Molecules in living organisms: proteins,

More information

AP BIOLOGY 2009 SCORING GUIDELINES

AP BIOLOGY 2009 SCORING GUIDELINES AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following

More information

GENE REGULATION. Teacher Packet

GENE REGULATION. Teacher Packet AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures

More information

LabGenius. Technical design notes. The world s most advanced synthetic DNA libraries. hi@labgeni.us V1.5 NOV 15

LabGenius. Technical design notes. The world s most advanced synthetic DNA libraries. hi@labgeni.us V1.5 NOV 15 LabGenius The world s most advanced synthetic DNA libraries Technical design notes hi@labgeni.us V1.5 NOV 15 Introduction OUR APPROACH LabGenius is a gene synthesis company focussed on the design and manufacture

More information

Activity 7.21 Transcription factors

Activity 7.21 Transcription factors Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation

More information

http://faculty.sau.edu.sa/h.alshehri

http://faculty.sau.edu.sa/h.alshehri http://faculty.sau.edu.sa/h.alshehri Definition: Proteins are macromolecules with a backbone formed by polymerization of amino acids. Proteins carry out a number of functions in living organisms: - They

More information

BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS

BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS 1. The Technology Strategy sets out six areas where technological developments are required to push the frontiers of knowledge

More information

Core Facility Genomics

Core Facility Genomics Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray

More information

The peptide bond is rigid and planar

The peptide bond is rigid and planar Level Description Bonds Primary Sequence of amino acids in proteins Covalent (peptide bonds) Secondary Structural motifs in proteins: α- helix and β-sheet Hydrogen bonds (between NH and CO groups in backbone)

More information

Helices From Readily in Biological Structures

Helices From Readily in Biological Structures The α Helix and the β Sheet Are Common Folding Patterns Although the overall conformation each protein is unique, there are only two different folding patterns are present in all proteins, which are α

More information

Hydrogen Bonds The electrostatic nature of hydrogen bonds

Hydrogen Bonds The electrostatic nature of hydrogen bonds Hydrogen Bonds Hydrogen bonds have played an incredibly important role in the history of structural biology. Both the structure of DNA and of protein a-helices and b-sheets were predicted based largely

More information

Chapter 3. Protein Structure and Function

Chapter 3. Protein Structure and Function Chapter 3 Protein Structure and Function Broad functional classes So Proteins have structure and function... Fine! -Why do we care to know more???? Understanding functional architechture gives us POWER

More information

Control of Gene Expression

Control of Gene Expression Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took

More information

HENIPAVIRUS ANTIBODY ESCAPE SEQUENCING REPORT

HENIPAVIRUS ANTIBODY ESCAPE SEQUENCING REPORT HENIPAVIRUS ANTIBODY ESCAPE SEQUENCING REPORT Kimberly Bishop Lilly 1,2, Truong Luu 1,2, Regina Cer 1,2, and LT Vishwesh Mokashi 1 1 Naval Medical Research Center, NMRC Frederick, 8400 Research Plaza,

More information

Protein Expression. A Practical Approach J. HIGGIN S

Protein Expression. A Practical Approach J. HIGGIN S Protein Expression A Practical Approach S. J. HIGGIN S B. D. HAMES List of contributors Abbreviations xv Xvi i 1. Protein expression in mammalian cell s Marlies Otter-Nilsson and Tommy Nilsso n 1. Introduction

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/339/ra80/dc1 Supplementary Materials for Manipulation of receptor oligomerization as a strategy to inhibit signaling by TNF superfamily members Julia T. Warren,

More information

Chapter 18 Regulation of Gene Expression

Chapter 18 Regulation of Gene Expression Chapter 18 Regulation of Gene Expression 18.1. Gene Regulation Is Necessary By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection

More information

Integrated Protein Services

Integrated Protein Services Integrated Protein Services Custom protein expression & purification Version DC04-0012 Expression strategy The first step in the recombinant protein generation process is to design an appropriate expression

More information

Lecture Outline. Introduction to Databases. Introduction. Data Formats Sample databases How to text search databases. Shifra Ben-Dor Irit Orr

Lecture Outline. Introduction to Databases. Introduction. Data Formats Sample databases How to text search databases. Shifra Ben-Dor Irit Orr Introduction to Databases Shifra Ben-Dor Irit Orr Lecture Outline Introduction Data and Database types Database components Data Formats Sample databases How to text search databases What units of information

More information

Pairwise Sequence Alignment

Pairwise Sequence Alignment Pairwise Sequence Alignment carolin.kosiol@vetmeduni.ac.at SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What

More information

Disulfide Bonds at the Hair Salon

Disulfide Bonds at the Hair Salon Disulfide Bonds at the Hair Salon Three Alpha Helices Stabilized By Disulfide Bonds! In order for hair to grow 6 inches in one year, 9 1/2 turns of α helix must be produced every second!!! In some proteins,

More information

Some terms: An antigen is a molecule or pathogen capable of eliciting an immune response

Some terms: An antigen is a molecule or pathogen capable of eliciting an immune response Overview of the immune system We continue our discussion of protein structure by considering the structure of antibodies. All organisms are continually subject to attack by microorganisms and viruses.

More information

Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION

Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Susan Carson Heather B. Miller D.Scott Witherow ELSEVIER AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN

More information

A disaccharide is formed when a dehydration reaction joins two monosaccharides. This covalent bond is called a glycosidic linkage.

A disaccharide is formed when a dehydration reaction joins two monosaccharides. This covalent bond is called a glycosidic linkage. CH 5 Structure & Function of Large Molecules: Macromolecules Molecules of Life All living things are made up of four classes of large biological molecules: carbohydrates, lipids, proteins, and nucleic

More information

Current Motif Discovery Tools and their Limitations

Current Motif Discovery Tools and their Limitations Current Motif Discovery Tools and their Limitations Philipp Bucher SIB / CIG Workshop 3 October 2006 Trendy Concepts and Hypotheses Transcription regulatory elements act in a context-dependent manner.

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

Gene mutation and molecular medicine Chapter 15

Gene mutation and molecular medicine Chapter 15 Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to

More information

Identifying microrna targets: computational and biochemical approaches

Identifying microrna targets: computational and biochemical approaches Identifying microrna targets: computational and biochemical approaches Iddo Ben-Dov Nephrology and Hypertension Hadassah Hebrew University Medical Center T. Tuschl A Short History of a Short RNA The intellectual

More information

Bioinformatics Grid - Enabled Tools For Biologists.

Bioinformatics Grid - Enabled Tools For Biologists. Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium

More information

Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling

Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling Lectures 1 and 8 15 February 7, 2013 This is a review of the material from lectures 1 and 8 14. Note that the material from lecture 15 is not relevant for the final exam. Today we will go over the material

More information

RNA & Protein Synthesis

RNA & Protein Synthesis RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis

More information

Recap. Lecture 2. Protein conformation. Proteins. 8 types of protein function 10/21/10. Proteins.. > 50% dry weight of a cell

Recap. Lecture 2. Protein conformation. Proteins. 8 types of protein function 10/21/10. Proteins.. > 50% dry weight of a cell Lecture 2 Protein conformation ecap Proteins.. > 50% dry weight of a cell ell s building blocks and molecular tools. More important than genes A large variety of functions http://www.tcd.ie/biochemistry/courses/jf_lectures.php

More information

What is the difference between basal and activated transcription?

What is the difference between basal and activated transcription? What is the difference between basal and activated transcription? Regulation of Transcription I. Basal vs. activated transcription for mrna genes A. General transcription factor (TF) vs. promoterspecific

More information

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional

More information

Integrated Protein Services

Integrated Protein Services Integrated Protein Services Custom protein expression & purification Last date of revision June 2015 Version DC04-0013 www.iba-lifesciences.com Expression strategy The first step in the recombinant protein

More information

Complex multicellular organisms are produced by cells that switch genes on and off during development.

Complex multicellular organisms are produced by cells that switch genes on and off during development. Home Control of Gene Expression Gene Regulation Is Necessary? By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring

More information

Ms. Campbell Protein Synthesis Practice Questions Regents L.E.

Ms. Campbell Protein Synthesis Practice Questions Regents L.E. Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide

More information

How To Understand The Chemistry Of Organic Molecules

How To Understand The Chemistry Of Organic Molecules CHAPTER 3 THE CHEMISTRY OF ORGANIC MOLECULES 3.1 Organic Molecules The chemistry of carbon accounts for the diversity of organic molecules found in living things. Carbon has six electrons, four of which

More information

Transcription in prokaryotes. Elongation and termination

Transcription in prokaryotes. Elongation and termination Transcription in prokaryotes Elongation and termination After initiation the σ factor leaves the scene. Core polymerase is conducting the elongation of the chain. The core polymerase contains main nucleotide

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Faculty of Medicine. Settore disciplinare: BIO/10. functional domains. Monica Soldi. IFOM-IEO Campus, Milan. Matricola n. R08407

Faculty of Medicine. Settore disciplinare: BIO/10. functional domains. Monica Soldi. IFOM-IEO Campus, Milan. Matricola n. R08407 PhD degree in Molecular Medicine European School of Molecular Medicine (SEMM), University of Milan and University of Naples Federico II Faculty of Medicine Settore disciplinare: BIO/10 Establishment and

More information

First Strand cdna Synthesis

First Strand cdna Synthesis 380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences

More information

Gene Models & Bed format: What they represent.

Gene Models & Bed format: What they represent. GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,

More information

Protein Synthesis How Genes Become Constituent Molecules

Protein Synthesis How Genes Become Constituent Molecules Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein

More information

BCHM 32200 Analytical Biochemistry Syllabus Spring, 2013

BCHM 32200 Analytical Biochemistry Syllabus Spring, 2013 INSTRUCTOR: Dr. Mark Hall office: BCHM 214 TEL: 494-0714 e-mail: mchall@purdue.edu DEPARTMENT OF BIOCHEMISTRY BCHM 32200 Analytical Biochemistry Syllabus Spring, 2013 Office hours: By appointment only

More information

Arabidopsis. A Practical Approach. Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham

Arabidopsis. A Practical Approach. Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham Arabidopsis A Practical Approach Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham OXPORD UNIVERSITY PRESS List of Contributors Abbreviations xv xvu

More information

Unraveling protein networks with Power Graph Analysis

Unraveling protein networks with Power Graph Analysis Unraveling protein networks with Power Graph Analysis PLoS Computational Biology, 2008 Loic Royer Matthias Reimann Bill Andreopoulos Michael Schroeder Schroeder Group Bioinformatics 1 Complex Networks

More information

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3 DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can

More information

(c) How would your answers to problem (a) change if the molecular weight of the protein was 100,000 Dalton?

(c) How would your answers to problem (a) change if the molecular weight of the protein was 100,000 Dalton? Problem 1. (12 points total, 4 points each) The molecular weight of an unspecified protein, at physiological conditions, is 70,000 Dalton, as determined by sedimentation equilibrium measurements and by

More information

PIPE-CLIP: a comprehensive online tool for CLIP-seq data analysis

PIPE-CLIP: a comprehensive online tool for CLIP-seq data analysis Chen et al. Genome Biology 2014, 15:R18 SOFTWARE PIPE-CLIP: a comprehensive online tool for CLIP-seq data analysis Beibei Chen 1, Jonghyun Yun 1, Min Soo Kim 1,2, Joshua T Mendell 2,3 and Yang Xie 1,2*

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

PRODUCTION AND QUALITY CONTROL OF MEDICINAL PRODUCTS DERIVED BY RECOMBINANT DNA TECHNOLOGY

PRODUCTION AND QUALITY CONTROL OF MEDICINAL PRODUCTS DERIVED BY RECOMBINANT DNA TECHNOLOGY PRODUCTION AND QUALITY CONTROL OF MEDICINAL PRODUCTS DERIVED BY RECOMBINANT DNA TECHNOLOGY Guideline Title Production and Quality Control of Medicinal Products derived by recombinant DNA Technology Legislative

More information

Introduction to Genome Annotation

Introduction to Genome Annotation Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT

More information

Dicer Substrate RNAi Design

Dicer Substrate RNAi Design INTEGRATED DNA TECHNOLOGIES, INC. Dicer Substrate RNAi Design How to design and order 27-mer Dicer-substrate Duplex RNAs for use as RNA interference reagents The following document provides a summary of

More information

Gene Switches Teacher Information

Gene Switches Teacher Information STO-143 Gene Switches Teacher Information Summary Kit contains How do bacteria turn on and turn off genes? Students model the action of the lac operon that regulates the expression of genes essential for

More information

Proteins. Proteins. Amino Acids. Most diverse and most important molecule in. Functions: Functions (cont d)

Proteins. Proteins. Amino Acids. Most diverse and most important molecule in. Functions: Functions (cont d) Proteins Proteins Most diverse and most important molecule in living i organisms Functions: 1. Structural (keratin in hair, collagen in ligaments) 2. Storage (casein in mother s milk) 3. Transport (HAEMOGLOBIN!)

More information