Interaktionen von RNAs und Proteinen
|
|
- Virgil Preston
- 8 years ago
- Views:
Transcription
1 Sonja Prohaska Computational EvoDevo Universitaet Leipzig June 9, 2015
2 Studying RNA-protein interactions Given: target protein known to bind to RNA problem: find binding partners and binding sites experimental high-throughput techniques based on immunoprecipitation (IP) use antibodies against target protein RIP-seq: full RNAs associated with protein iclip and HITS-CLIP: RNA binding sites of proteins PAR-CLIP: nucleotide resolution RNA-protein interactions
3 Find RNAs bound by target protein RIP = RNA Immuno-Precipitation key feature: no crosslinking problem: may yield indirect interactions
4 Analysis of RIP-seq data what we want: full sequences of the protein-bound RNAs (all!) what we get: reads task for the bioinformatician as in transcriptome sequencing (polish reads: remove adapters and barcodes) map reads to the genome/transcriptome (allow for indels and spliced-reads) cluster reads compare location of clusters to genome annotation identify the bound RNA (if possible) difficulty: alternative transcripts
5 CLIP-seq methods general idea CLIP = Cross-Linking Immuno-Precipitation UV light is used to crosslink RNA and protein in vivo stringent purification: immunoprecipitation, SDS-PAGE, transfer to nitrocellulose proteinase K digests protein but leaves 1-2 amino acids at the UV crosslinked sites reverse transcriptase (RT) makes cdna cdna often truncates at UV crosslinked sites... methods differ here... sequencing bioinformatic analysis
6 CLIP-seq methods general idea Basic principle of all CLIP methods
7 Find RNA binding sites of target protein HITS-CLIP = HIgh-Throughput Sequencing of RNA isolated by Cross-Linking Immuno-Precipitation 254nm UV crosslinking in vivo cell lysis requires 3 - and 5 -ligated adapters (for amplification) revers transcriptase (RT) makes cdna stalling of the RT at UV crosslink sites no amplification (5 -adapter missing) read through at UV crosslink sites induces mutations key feature: crosslink-induced mutation site (CIMS) Problem: high sequencing depths required Problem: destinguish CIMS from technical errors
8 Find RNA binding sites of target protein HITS-CLIP = HIgh-Throughput Sequencing of RNA isolated by Cross-Linking Immuno-Precipitation key feature: crosslink-induced mutation site (CIMS)
9 Find RNA binding sites of target protein iclip = individual-nucleotide resolution CLIP key feature: revers transcription terminates at crosslinks key insight: sites of trancation are sites of crosslinking
10 just another graphics for iclip
11 Single nucleotide contacts of target protein and RNA PAR-CLIP = Photo-Activated RNA CLIP key feature: photo-activatable nucleotides crosslinks key insight: nucleotide transitions indicate crosslinks
12 Single nucleotide contacts of target protein and RNA PAR-CLIP = Photo-Activated RNA CLIP photo-activated nucleotides 4SU and 6SG fed to cells, incorporated in nascent RNA reverse transcriptase inserts G opposite of 4SU = T C transition reverse transcriptase inserts T opposite of 6SG = G A transition bioinformatics: search read clusters with significantly high T > C mismatch frequency RNA U U A G G RNA U U A G G A A T C C A A T C C RNA U 4SU A G G RNA U U A 6SG G A G T C C A A T T C U C A G G U U A A G A G T C C A A T T C
13 CLIP-seq data What do we get? RBP HITS CLIP crosslinking sites errors cdna iclip PAR CLIP HITS-CLIP-seq: nucleotide substitutions around the BS iclip: cdna/read ends at crosslinked nucleotides PAR-CLIP: particular substitutions at crosslinked nucleotides
14 Limitations
15 Protein-Protein Interactions
16 Protein-Protein Interactions stable interactions - oligomers oligomerization, dimerization domains, leucine-zipper covalent-bonds, hydrophobic contacts, salt bridges, disulphid briges, electon sharing transient interactions hydrophobic contacts, Van der Waals forces, hydrogen bonds define interaction interfaces/surfaces rather than specific domains known domains: SH2, SH3, PDZ, SAM
17 Factors regulting Protein-Protein Interactions protein concentrations, which in turn are affected by expression levels and degradation rates presence of other proteins, nucleic acids, and ions electric fields around proteins occurrence of covalent modifications
18 SH2 domain Src Homology 2 2 α-helices and 7 β strands known to identify a sequence of 3-6 aa high affinity to phosphorylated tyrosine function signaling about 100 human proteins
19 SAM domain Sterile Alpha Motif around 70 aa small five-helix bundle seems to possess the ability to bind RNA two large interfaces, form dimers small group of genes
20 PDZ domain aa 5 beta-sheets, helices binds to C-terminus of binding partner adding a β-strand to the β-sheet often multiple PDZ per protein increasing specificity 260 PDZ in 180 human genes
21 Example: Histones of Archaea left: archeal histone dimer, aa in DNA contact (blue), aa in tetramer-formation (orange); right: archeal histone tetramer with DNA; H3 cyan; H4 red; histone fold: helix-loop-helix-loop-helix Archaeal histones can form homo- and heterodimers. Eukaryotic histones can only form hetero-dimers.
22 Protein Complex Graph
23 Yeast two-hybrid (Y2H)
Interaktionen von Nukleinsäuren und Proteinen
Sonja Prohaska Computational EvoDevo Universitaet Leipzig June 9, 2015 DNA is never naked in a cell DNA is usually in association with proteins. In all domains of life there are small, basic chromosomal
More informationBuilt from 20 kinds of amino acids
Built from 20 kinds of amino acids Each Protein has a three dimensional structure. Majority of proteins are compact. Highly convoluted molecules. Proteins are folded polypeptides. There are four levels
More informationProfiling of non-coding RNA classes Gunter Meister
Profiling of non-coding RNA classes Gunter Meister RNA Biology Regensburg University Universitätsstrasse 31 93053 Regensburg Overview Classes of non-coding RNAs Profiling strategies Validation Protein-RNA
More information2007 7.013 Problem Set 1 KEY
2007 7.013 Problem Set 1 KEY Due before 5 PM on FRIDAY, February 16, 2007. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Where in a eukaryotic cell do you
More informationFrom DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
More informationRETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
More informationExpression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu
Expression and Purification of Recombinant Protein in bacteria and Yeast Presented By: Puspa pandey, Mohit sachdeva & Ming yu DNA Vectors Molecular carriers which carry fragments of DNA into host cell.
More informationPapers listed: Cell2. This weeks papers. Chapt 4. Protein structure and function
Papers listed: Cell2 During the semester I will speak of information from several papers. For many of them you will not be required to read these papers, however, you can do so for the fun of it (and it
More informationNafith Abu Tarboush DDS, MSc, PhD natarboush@ju.edu.jo www.facebook.com/natarboush
Nafith Abu Tarboush DDS, MSc, PhD natarboush@ju.edu.jo www.facebook.com/natarboush α-keratins, bundles of α- helices Contain polypeptide chains organized approximately parallel along a single axis: Consist
More informationHow many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
More informationFunctional Architecture of RNA Polymerase I
Cell, Volume 131 Supplemental Data Functional Architecture of RNA Polymerase I Claus-D. Kuhn, Sebastian R. Geiger, Sonja Baumli, Marco Gartmann, Jochen Gerber, Stefan Jennebach, Thorsten Mielke, Herbert
More informationControl of Gene Expression
Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure
More informationRecombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
More informationName Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
More informationStructure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
More informationSystematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh
More informationTranslation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
More informationMyoglobin and Hemoglobin
Myoglobin and Hemoglobin Myoglobin and hemoglobin are hemeproteins whose physiological importance is principally related to their ability to bind molecular oxygen. Myoglobin (Mb) The oxygen storage protein
More informationThe immune response Antibodies Antigens Epitopes (antigenic determinants) the part of a protein antigen recognized by an antibody Haptens small
The immune response Antibodies Antigens Epitopes (antigenic determinants) the part of a protein antigen recognized by an antibody Haptens small molecules that can elicit an immune response when linked
More informationAP BIOLOGY 2008 SCORING GUIDELINES
AP BIOLOGY 2008 SCORING GUIDELINES Question 1 1. The physical structure of a protein often reflects and affects its function. (a) Describe THREE types of chemical bonds/interactions found in proteins.
More informationIV. -Amino Acids: carboxyl and amino groups bonded to -Carbon. V. Polypeptides and Proteins
IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon A. Acid/Base properties 1. carboxyl group is proton donor! weak acid 2. amino group is proton acceptor! weak base 3. At physiological ph: H
More informationControl of Gene Expression
Control of Gene Expression (Learning Objectives) Explain the role of gene expression is differentiation of function of cells which leads to the emergence of different tissues, organs, and organ systems
More informationThe world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
More informationINTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
More informationThe Steps. 1. Transcription. 2. Transferal. 3. Translation
Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order
More informationSickle cell anemia: Altered beta chain Single AA change (#6 Glu to Val) Consequence: Protein polymerizes Change in RBC shape ---> phenotypes
Protein Structure Polypeptide: Protein: Therefore: Example: Single chain of amino acids 1 or more polypeptide chains All polypeptides are proteins Some proteins contain >1 polypeptide Hemoglobin (O 2 binding
More informationConcluding lesson. Student manual. What kind of protein are you? (Basic)
Concluding lesson Student manual What kind of protein are you? (Basic) Part 1 The hereditary material of an organism is stored in a coded way on the DNA. This code consists of four different nucleotides:
More informationMUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
More informationNO CALCULATORS OR CELL PHONES ALLOWED
Biol 205 Exam 1 TEST FORM A Spring 2008 NAME Fill out both sides of the Scantron Sheet. On Side 2 be sure to indicate that you have TEST FORM A The answers to Part I should be placed on the SCANTRON SHEET.
More informationLecture 8. Protein Trafficking/Targeting. Protein targeting is necessary for proteins that are destined to work outside the cytoplasm.
Protein Trafficking/Targeting (8.1) Lecture 8 Protein Trafficking/Targeting Protein targeting is necessary for proteins that are destined to work outside the cytoplasm. Protein targeting is more complex
More informationDNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH)
DNA, RNA, replication, translation, and transcription Overview Recall the central dogma of biology: DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) DNA structure
More informationAmino Acids. Amino acids are the building blocks of proteins. All AA s have the same basic structure: Side Chain. Alpha Carbon. Carboxyl. Group.
Protein Structure Amino Acids Amino acids are the building blocks of proteins. All AA s have the same basic structure: Side Chain Alpha Carbon Amino Group Carboxyl Group Amino Acid Properties There are
More informationBasic Concepts of DNA, Proteins, Genes and Genomes
Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate
More informationGenetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
More informationDNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
More informationPreliminary MFM Quiz
Preliminary MFM Quiz 1. The major carrier of chemical energy in all cells is: A) adenosine monophosphate B) adenosine diphosphate C) adenosine trisphosphate D) guanosine trisphosphate E) carbamoyl phosphate
More informationEuropean Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
More informationLecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
More informationCarbohydrates, proteins and lipids
Carbohydrates, proteins and lipids Chapter 3 MACROMOLECULES Macromolecules: polymers with molecular weights >1,000 Functional groups THE FOUR MACROMOLECULES IN LIFE Molecules in living organisms: proteins,
More informationAP BIOLOGY 2009 SCORING GUIDELINES
AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following
More informationGENE REGULATION. Teacher Packet
AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures
More informationLabGenius. Technical design notes. The world s most advanced synthetic DNA libraries. hi@labgeni.us V1.5 NOV 15
LabGenius The world s most advanced synthetic DNA libraries Technical design notes hi@labgeni.us V1.5 NOV 15 Introduction OUR APPROACH LabGenius is a gene synthesis company focussed on the design and manufacture
More informationActivity 7.21 Transcription factors
Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation
More informationhttp://faculty.sau.edu.sa/h.alshehri
http://faculty.sau.edu.sa/h.alshehri Definition: Proteins are macromolecules with a backbone formed by polymerization of amino acids. Proteins carry out a number of functions in living organisms: - They
More informationBBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS
BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS 1. The Technology Strategy sets out six areas where technological developments are required to push the frontiers of knowledge
More informationCore Facility Genomics
Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray
More informationThe peptide bond is rigid and planar
Level Description Bonds Primary Sequence of amino acids in proteins Covalent (peptide bonds) Secondary Structural motifs in proteins: α- helix and β-sheet Hydrogen bonds (between NH and CO groups in backbone)
More informationHelices From Readily in Biological Structures
The α Helix and the β Sheet Are Common Folding Patterns Although the overall conformation each protein is unique, there are only two different folding patterns are present in all proteins, which are α
More informationHydrogen Bonds The electrostatic nature of hydrogen bonds
Hydrogen Bonds Hydrogen bonds have played an incredibly important role in the history of structural biology. Both the structure of DNA and of protein a-helices and b-sheets were predicted based largely
More informationChapter 3. Protein Structure and Function
Chapter 3 Protein Structure and Function Broad functional classes So Proteins have structure and function... Fine! -Why do we care to know more???? Understanding functional architechture gives us POWER
More informationControl of Gene Expression
Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
More informationNext Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took
More informationHENIPAVIRUS ANTIBODY ESCAPE SEQUENCING REPORT
HENIPAVIRUS ANTIBODY ESCAPE SEQUENCING REPORT Kimberly Bishop Lilly 1,2, Truong Luu 1,2, Regina Cer 1,2, and LT Vishwesh Mokashi 1 1 Naval Medical Research Center, NMRC Frederick, 8400 Research Plaza,
More informationProtein Expression. A Practical Approach J. HIGGIN S
Protein Expression A Practical Approach S. J. HIGGIN S B. D. HAMES List of contributors Abbreviations xv Xvi i 1. Protein expression in mammalian cell s Marlies Otter-Nilsson and Tommy Nilsso n 1. Introduction
More informationMolecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
More informationBiotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
More informationTranscription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/339/ra80/dc1 Supplementary Materials for Manipulation of receptor oligomerization as a strategy to inhibit signaling by TNF superfamily members Julia T. Warren,
More informationChapter 18 Regulation of Gene Expression
Chapter 18 Regulation of Gene Expression 18.1. Gene Regulation Is Necessary By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection
More informationIntegrated Protein Services
Integrated Protein Services Custom protein expression & purification Version DC04-0012 Expression strategy The first step in the recombinant protein generation process is to design an appropriate expression
More informationLecture Outline. Introduction to Databases. Introduction. Data Formats Sample databases How to text search databases. Shifra Ben-Dor Irit Orr
Introduction to Databases Shifra Ben-Dor Irit Orr Lecture Outline Introduction Data and Database types Database components Data Formats Sample databases How to text search databases What units of information
More informationPairwise Sequence Alignment
Pairwise Sequence Alignment carolin.kosiol@vetmeduni.ac.at SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What
More informationDisulfide Bonds at the Hair Salon
Disulfide Bonds at the Hair Salon Three Alpha Helices Stabilized By Disulfide Bonds! In order for hair to grow 6 inches in one year, 9 1/2 turns of α helix must be produced every second!!! In some proteins,
More informationSome terms: An antigen is a molecule or pathogen capable of eliciting an immune response
Overview of the immune system We continue our discussion of protein structure by considering the structure of antibodies. All organisms are continually subject to attack by microorganisms and viruses.
More informationMolecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Susan Carson Heather B. Miller D.Scott Witherow ELSEVIER AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN
More informationA disaccharide is formed when a dehydration reaction joins two monosaccharides. This covalent bond is called a glycosidic linkage.
CH 5 Structure & Function of Large Molecules: Macromolecules Molecules of Life All living things are made up of four classes of large biological molecules: carbohydrates, lipids, proteins, and nucleic
More informationCurrent Motif Discovery Tools and their Limitations
Current Motif Discovery Tools and their Limitations Philipp Bucher SIB / CIG Workshop 3 October 2006 Trendy Concepts and Hypotheses Transcription regulatory elements act in a context-dependent manner.
More information2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
More informationGene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
More informationIdentifying microrna targets: computational and biochemical approaches
Identifying microrna targets: computational and biochemical approaches Iddo Ben-Dov Nephrology and Hypertension Hadassah Hebrew University Medical Center T. Tuschl A Short History of a Short RNA The intellectual
More informationBioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
More informationRecombinant DNA Technology
Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium
More informationLectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling
Lectures 1 and 8 15 February 7, 2013 This is a review of the material from lectures 1 and 8 14. Note that the material from lecture 15 is not relevant for the final exam. Today we will go over the material
More informationRNA & Protein Synthesis
RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis
More informationRecap. Lecture 2. Protein conformation. Proteins. 8 types of protein function 10/21/10. Proteins.. > 50% dry weight of a cell
Lecture 2 Protein conformation ecap Proteins.. > 50% dry weight of a cell ell s building blocks and molecular tools. More important than genes A large variety of functions http://www.tcd.ie/biochemistry/courses/jf_lectures.php
More informationWhat is the difference between basal and activated transcription?
What is the difference between basal and activated transcription? Regulation of Transcription I. Basal vs. activated transcription for mrna genes A. General transcription factor (TF) vs. promoterspecific
More informationCentral Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription
Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional
More informationIntegrated Protein Services
Integrated Protein Services Custom protein expression & purification Last date of revision June 2015 Version DC04-0013 www.iba-lifesciences.com Expression strategy The first step in the recombinant protein
More informationComplex multicellular organisms are produced by cells that switch genes on and off during development.
Home Control of Gene Expression Gene Regulation Is Necessary? By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
More informationMs. Campbell Protein Synthesis Practice Questions Regents L.E.
Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide
More informationHow To Understand The Chemistry Of Organic Molecules
CHAPTER 3 THE CHEMISTRY OF ORGANIC MOLECULES 3.1 Organic Molecules The chemistry of carbon accounts for the diversity of organic molecules found in living things. Carbon has six electrons, four of which
More informationTranscription in prokaryotes. Elongation and termination
Transcription in prokaryotes Elongation and termination After initiation the σ factor leaves the scene. Core polymerase is conducting the elongation of the chain. The core polymerase contains main nucleotide
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationFaculty of Medicine. Settore disciplinare: BIO/10. functional domains. Monica Soldi. IFOM-IEO Campus, Milan. Matricola n. R08407
PhD degree in Molecular Medicine European School of Molecular Medicine (SEMM), University of Milan and University of Naples Federico II Faculty of Medicine Settore disciplinare: BIO/10 Establishment and
More informationFirst Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
More informationGene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
More informationProtein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
More informationBCHM 32200 Analytical Biochemistry Syllabus Spring, 2013
INSTRUCTOR: Dr. Mark Hall office: BCHM 214 TEL: 494-0714 e-mail: mchall@purdue.edu DEPARTMENT OF BIOCHEMISTRY BCHM 32200 Analytical Biochemistry Syllabus Spring, 2013 Office hours: By appointment only
More informationArabidopsis. A Practical Approach. Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham
Arabidopsis A Practical Approach Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham OXPORD UNIVERSITY PRESS List of Contributors Abbreviations xv xvu
More informationUnraveling protein networks with Power Graph Analysis
Unraveling protein networks with Power Graph Analysis PLoS Computational Biology, 2008 Loic Royer Matthias Reimann Bill Andreopoulos Michael Schroeder Schroeder Group Bioinformatics 1 Complex Networks
More informationDNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3
DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can
More information(c) How would your answers to problem (a) change if the molecular weight of the protein was 100,000 Dalton?
Problem 1. (12 points total, 4 points each) The molecular weight of an unspecified protein, at physiological conditions, is 70,000 Dalton, as determined by sedimentation equilibrium measurements and by
More informationPIPE-CLIP: a comprehensive online tool for CLIP-seq data analysis
Chen et al. Genome Biology 2014, 15:R18 SOFTWARE PIPE-CLIP: a comprehensive online tool for CLIP-seq data analysis Beibei Chen 1, Jonghyun Yun 1, Min Soo Kim 1,2, Joshua T Mendell 2,3 and Yang Xie 1,2*
More informationName Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
More informationPRODUCTION AND QUALITY CONTROL OF MEDICINAL PRODUCTS DERIVED BY RECOMBINANT DNA TECHNOLOGY
PRODUCTION AND QUALITY CONTROL OF MEDICINAL PRODUCTS DERIVED BY RECOMBINANT DNA TECHNOLOGY Guideline Title Production and Quality Control of Medicinal Products derived by recombinant DNA Technology Legislative
More informationIntroduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
More informationDicer Substrate RNAi Design
INTEGRATED DNA TECHNOLOGIES, INC. Dicer Substrate RNAi Design How to design and order 27-mer Dicer-substrate Duplex RNAs for use as RNA interference reagents The following document provides a summary of
More informationGene Switches Teacher Information
STO-143 Gene Switches Teacher Information Summary Kit contains How do bacteria turn on and turn off genes? Students model the action of the lac operon that regulates the expression of genes essential for
More informationProteins. Proteins. Amino Acids. Most diverse and most important molecule in. Functions: Functions (cont d)
Proteins Proteins Most diverse and most important molecule in living i organisms Functions: 1. Structural (keratin in hair, collagen in ligaments) 2. Storage (casein in mother s milk) 3. Transport (HAEMOGLOBIN!)
More information