MORPHEUS. Prediction of Transcription Factors Binding Sites based on Position Weight Matrix.
|
|
|
- Geraldine Gilmore
- 10 years ago
- Views:
Transcription
1 MORPHEUS Prediction of Transcription Factors Binding Sites based on Position Weight Matrix. Reference: MORPHEUS, a Webtool for Transcripton Factor Binding Analysis Using Position Weight Matrices with Dependency (Minguet EG, Charavay C, Segard S, Parcy F) PLos One Aug 18 ; 10(8):e doi: /journal.pone ecollection 2015 Morpheus is a suite of tools to analyse transcription factor binding sites (TFBS) on DNA sequences. As input, the program uses a set of sequences in FASTA format and a matrix (Count Matrix, a Frequency Matrix or Position Weight Matrix [PWM]). SEQUENCES Sequences must be in standard FASTA format. To facilitate data visualization and identification, we suggest to use short sequence names and to avoid duplicated names. A number between parentheses will be added if a duplicated name is found.
2 Characters not allowed in sequence name: 1.- Avoid the use of - in sequence name as is used as mark for genomic information (see below). Their presence could result in incorrect name truncations and ambiguity in the results. 2.- Characters \(:)/?* <> cannot be used either as several programs use it for creating individual profiles and data results files. By default, those characters are erased from sequence names. White spaces in sequence s name are also substituted by _. Example of Fasta Format: Unambiguous sequences are needed for score calculation of Transcription Factor Binding Sites (TFBS) because a single position can have a big influence over TFBS score. Although only A,C,G,T characters are allowed for score calculation, Morpheus gives the worst possible score if the site contains any ambiguous character (IUPAC DNA code: A, C, G, T, U, R, Y, S, W, K, M, B, D, H, V, N,., -). Log file contains a list with sequences containing such characters to prevent incorrect interpretation of results. Genomic information: If genomic information are available (chromosome number, start position and sequence size) as in the case of ChIP-CHIP or ChIP-seq data, it can be indicated using "-" in sequence name as follow: Name-chromosome number-start position-size For instance :
3 Occupancy result files have independent columns for genomic information (empty if not available) to help further results analysis. LogInfo file : You can find in the LogInfo file information about the process as the number of sequences that have been identified, matrix data used or any problem in sequences/matrix recognition. MATRIX Matrix information can be found in transcription factor databases such as JASPAR or generated from a binding sites alignment using tools such as MEME. Here we describe the adequate way to write that information so that it can be correctly interpreted by Morpheus. In order to facilitate conversion, the mpwm tool is available to generate Morpheus matrix format directly from a binding sites sequence alignment. Morpheus matrix Conversion tool This tool takes as input a file with binding sites sequence alignment either in fasta format or only aligned sequences. All sequences must have the same size. If not, the smaller size will be used. All IUPAC characters for DNA are allowed although only ACGT characters will be used for counting. Optionally, if dependencies must be taken into account another file in txt format with dependencies positions will be necessary. In this file, positions for each dependency must be indicated between squares brackets, one dependency per line. As for example: [2,3,5] [6,9] User must select if matrix is symmetric or asymmetric. When symmetric is selected, the corresponding symmetric dependencies will be generated even if they have not been indicated in the dependency information file. For example, if the dependencies indicated in the example describes dependencies in a symmetric binding site of a total of 15 positions, program will create 4 dependencies: [2,3,5] [6,9] [7,10] [11,13,14] File generated will contain matrix information in Morpheus format ready to use with any analysis tool in Morpheus web.
4 Morpheus Matrix Format The simplest format for a Matrix file is as follow: The first line specifies the characteristics of the matrix separated by whitespaces, followed by information of nucleotide occurrence for each position (one position by line; in the example, a binding site of size 8 positions). MATRIX --> Indicate that next data is a matrix data. ALL matrix files must start with this word. Type of Data --> COUNT or FREQUENCY or SCORE COUNT --> Data is the occurrence number of each nucleotide (ACGT) FREQUENCY --> Data is the occurrence frequency of each nucleotide (ACGT) SCORE --> Data is the position weight matrix. If the data is in "COUNT" or "FREQUENCY" formats, transformation to weights data is done as follows: For each position --> Score nt(acgt) = LN freq nt freq max PSEUDOCOUNTS To avoid null values for freq nt, that are incompatible with score calculation, Morpheus uses Pseudocounts. When a COUNT matrix is provided, null values will be replaced by 1 before the matrix generation. The user can instead replace zeros by a value of its choice as there are different ways to deal with pseudocount values. When a FREQUENCY matrix is provided, a error message is written in LogInfo file if null values are present and no score matrix is generated. The user has to decide by which value the zeros have to be replaced before providing the frequency matrix.
5 SYMMETRY --> ASYMMETRIC or SYMMETRIC In some cases, due to structure of transcription factor or because it binds as homodimer, the matrix is palindromic, so the scores of a sequence and of its reverse complement are the same. In these cases matrix has a SYMMETRIC structure. If SYMMETRIC option is chosen but the matrix is asymmetric, scores will be calculated on a single DNA strand! NAME --> The name of your matrix. Default values: Only the term MATRIX and the matrix type are required for running the program. If one or both of the two others descriptive data (symmetry or name) are missing, the program will use default parameters. Symmetry --> ASYMMETRIC Name --> Unknown LogInfo file: You can find in the LogInfo file information about matrix importation. DEPENDENCY DATA Position weight matrices assume that each base of the binding site contributes independently to the Transcription Factor/DNA affinity. However, there is evidence that interdependencies between positions exist and should be taken into account. Morpheus format allows using independent positions together with dependency in the needed positions. For dependency data, a line with the word "DEPENDENCY" followed by the positions implicated, between brackets, precedes dependency data. This data is organized by alphabetical order for duplets (AA, AC, AG, TG, TT) or triplets (AAA, AAC, AAG,, TTG, TTT). In order to facilitate data visualization the use of [A,C,G,T] characters are allowed, for example: DEPENDENCY (6 7 8) A C G T AA AC AG AT CA CC CG
6 CT GA GC GG GT TA TC TG TT Data in independent matrix for positions implicated in dependencies are not taken into account for score calculation. INPUT FILES Score & Occupancy: These programs need a file with matrix information (Morpheus format) and a file with sequences (Fasta format). ROC-AUC: This program needs two result files from Score (option best only) or Occupancy, one with the positive data set and the other with the negative data set. mpwm: This program needs aligned motifs either in fasta format or raw format. Negative Set Generator Tool: This program needs a file with sequences (fasta format); and optionally a text file with a list of chromosome sizes. OUTPUT FILES Two types of files are generated from each program with TFBS information: 1) File(s) in txt format with data organized in columns (score, position, TFBS sequence, etc.) 2) Image file(s) with TFBS information (score profile, score distribution, ROC-AUC, etc.), using general parameters. If other graphic representations are needed, txt files contains all required data to generate them. Sometimes txt output files are not correctly visualized with some simple text processor. If you are not able to see information in organized columns try to use other text processor. PROGRAMS mpwm Format Conversion Tool (see also MATRIX format) This tools allows generation of a matrix file in Morpheus format from an alignment of binding sites. Alignment can be either in fasta format or raw sequence alignment (a list of the motifs sequences).
7 This tool DO NOT do sequences alignment, it use motifs alignment (from tools like MEME) to generate matrix information in mpwm format. All sequences must have the same size so each position has the same information, because of that when several sizes are detected sequences are trimmed in the 3 end to match the smaller motif. If the model must contain some dependency information, a list of the involved positions for each dependency must be provided in a text file: one dependency by line between square brackets, with positions separated by commas. [4,6] [9,10,11] [2,17] Score This tool calculates the scores of TFBS present in a list of DNA sequences. Program needs a file with matrix information in Morpheus format (mpwm) and a file with sequences in fasta format. The available options are: Option All determines the score of all sites in each DNA sequence and generate quantitative profiles. Option Limit gives similar results than All but only site with a score higher than a given limit will be shown. User must indicate the desired limit. Option Best gives the site with the best score in each DNA sequence. Result of this option can be used as input for the ROC-AUC tool. This tool generates graphic outputs what allows a quick overview of results. In all options a histogram is generated to reflect distribution of scores (a), that allows a quick general evaluation. "All" and "Limit" give an additional graphic output showing the position of the best sites in each sequence (b). A score profile is generated for each sequence in the input fasta format. a b
8 Occupancy This tool calculates Transcription Factor Occupancy as the relative expected number of bound transcription factor molecules of each DNA sequence based on previous formalism (Roider et al., 2007). Affinity score correlates with the relative equilibrium dissociation constant following a linear curve: The linear correlation between in vitro binding measurements and computed scores allows an experimental determination of a and b values The occupancy is calculated as: Where K A,S is the relative equilibrium association constant for site S (the inverse of the relative equilibrium dissociation constant): K A,S = 1/K D,S Finally, the protein concentration of the transcription factor is needed and can be provided by the user. However, since protein concentration in vivo is rarely determined, a default value will be used so that the probability of binding to the best site (maximal score) is equal to 0.5, and the corresponding value will be indicated in the output files. Program has two options: Option All use all sites in each sequence for Occupancy calculation. Option Limit gives similar results than All but a score limit can be specified so all sites with score worse than the limit will not be used. If this option is selected, limit value will have to be given as input. As graphic output, a histogram is generated to show the occupancy distribution (a). This tool also gives a graphic output showing occupancy of each sequence (b). The Result file can be used as input for ROC-AUC tool. a b
9 ROC-AUC This tool calculates Receiver Operating Characteristic Area Under the Curve (ROC-AUC) from two data sets (such as bound and not bound regions, from a ChIP experiment for instance) from the Score tool (option Best ) or the Occupancy tool outputs. A double histogram (with values for each dataset) is generated to reflect values distribution and as a visual representation of dataset's overlap (a). It also gives a graphical output with ROC curve (b). a b Negative Set Generator Tool This tools allows generation of a negative set that can be used in comparison with an experimental positive set of sequences. In all cases, the negative set has the same number of sequences of the original positive set and with the same nucleotide size. This is particularly important when using occupancy prediction. We offer two methods to generate a negative set : SUFFLE This method randomly shuffle each sequence in the positive set of sequences so the new sequence has exactly the same proportion of the four nucleotides than the original positive sequence. GENOMIC This method randomly select genomic regions that are not present in the positive set of sequences. This method requieres genomic information (chrosomome, position and size of each sequence in the positive set; see Sequences point of this user guide for sequence s name) and the nucleotide size of each chromosome as a list in a text file (only numbers are allowed! Avoid using any other character; neither points or commas). In this file the order of numbers must correspond wih the natural order of chromosome number: first number is chromosome 1, the next one the chromome 2, and so on. If some chromosomes are not named as numbers, just do the assotiation by yourself and remember it.
10 This option randomly generates a negative set of sequences that do not overlap with any sequence in the positive set and produce a file with their genomic coordinates (NOT the sequences). Maybe some users will find it as a little inconvenient but we have designed this option so it can be used for any species now and in the future, and for any species with a complete genome version it must be really easy to get a set of sequences from their genomic coordinates. Each method can have its advantages depending of the origin of the positive set and the porpose of the comparison. However we can indicate some comments and suggestions: - If no complete genome is available only shuffle option can be used, obviously. - With Shuffle option the negative set preserves the nucleotide proportion of the original positive set of sequences, what can be an advantage for some binding site evaluation methods that uses nucleotides background to calculate a p-value for each motif. Shuffle option reflects the probability of random generation of binding sites. - With Genomic option the negative set corresponds with random real sequences present in the experiment in competition with those in the positive set. Although binding in vivo it is the result of several factors (as chromatine structure) and not just the sequence affinity, it is assumed that the positive set must be enriched with the motifs bound by the protein. A model that do not reflect this situation will indicate any bad assumption in the binding model.
Interaktionen von Nukleinsäuren und Proteinen
Sonja Prohaska Computational EvoDevo Universitaet Leipzig June 9, 2015 DNA is never naked in a cell DNA is usually in association with proteins. In all domains of life there are small, basic chromosomal
MATCH Commun. Math. Comput. Chem. 61 (2009) 781-788
MATCH Communications in Mathematical and in Computer Chemistry MATCH Commun. Math. Comput. Chem. 61 (2009) 781-788 ISSN 0340-6253 Three distances for rapid similarity analysis of DNA sequences Wei Chen,
HIGH DENSITY DATA STORAGE IN DNA USING AN EFFICIENT MESSAGE ENCODING SCHEME Rahul Vishwakarma 1 and Newsha Amiri 2
HIGH DENSITY DATA STORAGE IN DNA USING AN EFFICIENT MESSAGE ENCODING SCHEME Rahul Vishwakarma 1 and Newsha Amiri 2 1 Tata Consultancy Services, India [email protected] 2 Bangalore University, India ABSTRACT
Pairwise Sequence Alignment
Pairwise Sequence Alignment [email protected] SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What
Comparing Methods for Identifying Transcription Factor Target Genes
Comparing Methods for Identifying Transcription Factor Target Genes Alena van Bömmel (R 3.3.73) Matthew Huska (R 3.3.18) Max Planck Institute for Molecular Genetics Folie 1 Transcriptional Regulation TF
Current Motif Discovery Tools and their Limitations
Current Motif Discovery Tools and their Limitations Philipp Bucher SIB / CIG Workshop 3 October 2006 Trendy Concepts and Hypotheses Transcription regulatory elements act in a context-dependent manner.
T cell Epitope Prediction
Institute for Immunology and Informatics T cell Epitope Prediction EpiMatrix Eric Gustafson January 6, 2011 Overview Gathering raw data Popular sources Data Management Conservation Analysis Multiple Alignments
GenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
Tutorial for proteome data analysis using the Perseus software platform
Tutorial for proteome data analysis using the Perseus software platform Laboratory of Mass Spectrometry, LNBio, CNPEM Tutorial version 1.0, January 2014. Note: This tutorial was written based on the information
Introduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]
A Tutorial in Genetic Sequence Classification Tools and Techniques
A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University [email protected] www.jakemdrew.com Sequence Characters IUPAC nucleotide
LabGenius. Technical design notes. The world s most advanced synthetic DNA libraries. [email protected] V1.5 NOV 15
LabGenius The world s most advanced synthetic DNA libraries Technical design notes [email protected] V1.5 NOV 15 Introduction OUR APPROACH LabGenius is a gene synthesis company focussed on the design and manufacture
Frequently Asked Questions Next Generation Sequencing
Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided
Next Generation Sequencing: Adjusting to Big Data. Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013
Next Generation Sequencing: Adjusting to Big Data Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013 Outline Human Genome Project Next-Generation Sequencing Personalized Medicine
STATISTICA Formula Guide: Logistic Regression. Table of Contents
: Table of Contents... 1 Overview of Model... 1 Dispersion... 2 Parameterization... 3 Sigma-Restricted Model... 3 Overparameterized Model... 4 Reference Coding... 4 Model Summary (Summary Tab)... 5 Summary
Biological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
Data Analysis Tools. Tools for Summarizing Data
Data Analysis Tools This section of the notes is meant to introduce you to many of the tools that are provided by Excel under the Tools/Data Analysis menu item. If your computer does not have that tool
Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain?
Networked Systems, COMPGZ01, 2012 Answer TWO questions from Part ONE on the answer booklet containing lined writing paper, and answer ALL questions in Part TWO on the multiple-choice question answer sheet.
How To Understand And Solve A Linear Programming Problem
At the end of the lesson, you should be able to: Chapter 2: Systems of Linear Equations and Matrices: 2.1: Solutions of Linear Systems by the Echelon Method Define linear systems, unique solution, inconsistent,
How Does My TI-84 Do That
How Does My TI-84 Do That A guide to using the TI-84 for statistics Austin Peay State University Clarksville, Tennessee How Does My TI-84 Do That A guide to using the TI-84 for statistics Table of Contents
Next Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University [email protected] http://tandem.bu.edu/ The Human Genome Project took
Didacticiel - Études de cas
1 Topic Linear Discriminant Analysis Data Mining Tools Comparison (Tanagra, R, SAS and SPSS). Linear discriminant analysis is a popular method in domains of statistics, machine learning and pattern recognition.
InfiniteInsight 6.5 sp4
End User Documentation Document Version: 1.0 2013-11-19 CUSTOMER InfiniteInsight 6.5 sp4 Toolkit User Guide Table of Contents Table of Contents About this Document 3 Common Steps 4 Selecting a Data Set...
LAGUARDIA COMMUNITY COLLEGE CITY UNIVERSITY OF NEW YORK DEPARTMENT OF MATHEMATICS, ENGINEERING, AND COMPUTER SCIENCE
LAGUARDIA COMMUNITY COLLEGE CITY UNIVERSITY OF NEW YORK DEPARTMENT OF MATHEMATICS, ENGINEERING, AND COMPUTER SCIENCE MAT 119 STATISTICS AND ELEMENTARY ALGEBRA 5 Lecture Hours, 2 Lab Hours, 3 Credits Pre-
Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003
Similarity Searches on Sequence Databases: BLAST, FASTA Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Outline Importance of Similarity Heuristic Sequence Alignment:
Data Mining Techniques Chapter 5: The Lure of Statistics: Data Mining Using Familiar Tools
Data Mining Techniques Chapter 5: The Lure of Statistics: Data Mining Using Familiar Tools Occam s razor.......................................................... 2 A look at data I.........................................................
BLAST. Anders Gorm Pedersen & Rasmus Wernersson
BLAST Anders Gorm Pedersen & Rasmus Wernersson Database searching Using pairwise alignments to search databases for similar sequences Query sequence Database Database searching Most common use of pairwise
Nebula A web-server for advanced ChIP-seq data analysis. Tutorial. by Valentina BOEVA
Nebula A web-server for advanced ChIP-seq data analysis Tutorial by Valentina BOEVA Content Upload data to the history pp. 5-6 Check read number and sequencing quality pp. 7-9 Visualize.BAM files in UCSC
Chapter 6: Episode discovery process
Chapter 6: Episode discovery process Algorithmic Methods of Data Mining, Fall 2005, Chapter 6: Episode discovery process 1 6. Episode discovery process The knowledge discovery process KDD process of analyzing
MS Access Queries for Database Quality Control for Time Series
Work Book MS Access Queries for Database Quality Control for Time Series GIS Exercise - 12th January 2004 NILE BASIN INITIATIVE Initiative du Bassin du Nil Information Products for Nile Basin Water Resources
How To Use Statgraphics Centurion Xvii (Version 17) On A Computer Or A Computer (For Free)
Statgraphics Centurion XVII (currently in beta test) is a major upgrade to Statpoint's flagship data analysis and visualization product. It contains 32 new statistical procedures and significant upgrades
Analysis of gene expression data. Ulf Leser and Philippe Thomas
Analysis of gene expression data Ulf Leser and Philippe Thomas This Lecture Protein synthesis Microarray Idea Technologies Applications Problems Quality control Normalization Analysis next week! Ulf Leser:
Basic Data Analysis. Stephen Turnbull Business Administration and Public Policy Lecture 12: June 22, 2012. Abstract. Review session.
June 23, 2012 1 review session Basic Data Analysis Stephen Turnbull Business Administration and Public Policy Lecture 12: June 22, 2012 Review session. Abstract Quantitative methods in business Accounting
(http://genomes.urv.es/caical) TUTORIAL. (July 2006)
(http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA
Introduction to Quantitative Methods
Introduction to Quantitative Methods October 15, 2009 Contents 1 Definition of Key Terms 2 2 Descriptive Statistics 3 2.1 Frequency Tables......................... 4 2.2 Measures of Central Tendencies.................
Combining Data from Different Genotyping Platforms. Gonçalo Abecasis Center for Statistical Genetics University of Michigan
Combining Data from Different Genotyping Platforms Gonçalo Abecasis Center for Statistical Genetics University of Michigan The Challenge Detecting small effects requires very large sample sizes Combined
Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) [email protected]
Bioinformatique et Séquençage Haut Débit, Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) [email protected] 1 RNA Transcription to RNA and subsequent
Gamma Distribution Fitting
Chapter 552 Gamma Distribution Fitting Introduction This module fits the gamma probability distributions to a complete or censored set of individual or grouped data values. It outputs various statistics
DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE
DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE We recommend for the sequence visualization the use of software that allows the examination of raw data in order to determine quantitatively how good has
Stat 411/511 THE RANDOMIZATION TEST. Charlotte Wickham. stat511.cwick.co.nz. Oct 16 2015
Stat 411/511 THE RANDOMIZATION TEST Oct 16 2015 Charlotte Wickham stat511.cwick.co.nz Today Review randomization model Conduct randomization test What about CIs? Using a t-distribution as an approximation
DNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
Chapter 6 DNA Replication
Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore
org.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers.
org.rn.eg.db December 16, 2015 org.rn.egaccnum Map Entrez Gene identifiers to GenBank Accession Numbers org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank
?<BACBC;@@A=2(?@?;@=2:;:%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
NGS data format NGS data format @SRR031028.1708655 GGATGATGGATGGATAGATAGATGAAGAGATGGATGGATGGGTGGGTGGTATGCAGCATACCTGAAGTGC BBBCB=ABBB@BA=?BABBBBA??B@BAAA>ABB;@5=@@@?8@:==99:465727:;41'.9>;933!4 @SRR031028.843803
Choices, choices, choices... Which sequence database? Which modifications? What mass tolerance?
Optimization 1 Choices, choices, choices... Which sequence database? Which modifications? What mass tolerance? Where to begin? 2 Sequence Databases Swiss-prot MSDB, NCBI nr dbest Species specific ORFS
Didacticiel Études de cas
1 Theme Data Mining with R The rattle package. R (http://www.r project.org/) is one of the most exciting free data mining software projects of these last years. Its popularity is completely justified (see
When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want
1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very
Genetomic Promototypes
Genetomic Promototypes Mirkó Palla and Dana Pe er Department of Mechanical Engineering Clarkson University Potsdam, New York and Department of Genetics Harvard Medical School 77 Avenue Louis Pasteur Boston,
DESCRIPTIVE STATISTICS AND EXPLORATORY DATA ANALYSIS
DESCRIPTIVE STATISTICS AND EXPLORATORY DATA ANALYSIS SEEMA JAGGI Indian Agricultural Statistics Research Institute Library Avenue, New Delhi - 110 012 [email protected] 1. Descriptive Statistics Statistics
Trend and Seasonal Components
Chapter 2 Trend and Seasonal Components If the plot of a TS reveals an increase of the seasonal and noise fluctuations with the level of the process then some transformation may be necessary before doing
Real-time PCR: Understanding C t
APPLICATION NOTE Real-Time PCR Real-time PCR: Understanding C t Real-time PCR, also called quantitative PCR or qpcr, can provide a simple and elegant method for determining the amount of a target sequence
Lecture 11 Enzymes: Kinetics
Lecture 11 Enzymes: Kinetics Reading: Berg, Tymoczko & Stryer, 6th ed., Chapter 8, pp. 216-225 Key Concepts Kinetics is the study of reaction rates (velocities). Study of enzyme kinetics is useful for
Excel supplement: Chapter 7 Matrix and vector algebra
Excel supplement: Chapter 7 atrix and vector algebra any models in economics lead to large systems of linear equations. These problems are particularly suited for computers. The main purpose of this chapter
PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: [email protected]
BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,
Arithmetic Coding: Introduction
Data Compression Arithmetic coding Arithmetic Coding: Introduction Allows using fractional parts of bits!! Used in PPM, JPEG/MPEG (as option), Bzip More time costly than Huffman, but integer implementation
6 3 The Standard Normal Distribution
290 Chapter 6 The Normal Distribution Figure 6 5 Areas Under a Normal Distribution Curve 34.13% 34.13% 2.28% 13.59% 13.59% 2.28% 3 2 1 + 1 + 2 + 3 About 68% About 95% About 99.7% 6 3 The Distribution Since
RESTRICTION DIGESTS Based on a handout originally available at
RESTRICTION DIGESTS Based on a handout originally available at http://genome.wustl.edu/overview/rst_digest_handout_20050127/restrictiondigest_jan2005.html What is a restriction digests? Cloned DNA is cut
Network Analysis. BCH 5101: Analysis of -Omics Data 1/34
Network Analysis BCH 5101: Analysis of -Omics Data 1/34 Network Analysis Graphs as a representation of networks Examples of genome-scale graphs Statistical properties of genome-scale graphs The search
Chapter 3 Quantitative Demand Analysis
Managerial Economics & Business Strategy Chapter 3 uantitative Demand Analysis McGraw-Hill/Irwin Copyright 2010 by the McGraw-Hill Companies, Inc. All rights reserved. Overview I. The Elasticity Concept
Tutorial 3: Graphics and Exploratory Data Analysis in R Jason Pienaar and Tom Miller
Tutorial 3: Graphics and Exploratory Data Analysis in R Jason Pienaar and Tom Miller Getting to know the data An important first step before performing any kind of statistical analysis is to familiarize
Summary of important mathematical operations and formulas (from first tutorial):
EXCEL Intermediate Tutorial Summary of important mathematical operations and formulas (from first tutorial): Operation Key Addition + Subtraction - Multiplication * Division / Exponential ^ To enter a
Biological Sequence Data Formats
Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA
3. About R2oDNA Designer
3. About R2oDNA Designer Please read these publications for more details: Casini A, Christodoulou G, Freemont PS, Baldwin GS, Ellis T, MacDonald JT. R2oDNA Designer: Computational design of biologically-neutral
Using Excel (Microsoft Office 2007 Version) for Graphical Analysis of Data
Using Excel (Microsoft Office 2007 Version) for Graphical Analysis of Data Introduction In several upcoming labs, a primary goal will be to determine the mathematical relationship between two variable
July 7th 2009 DNA sequencing
July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer
Version 5.0 Release Notes
Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com
Algebra 1 Course Information
Course Information Course Description: Students will study patterns, relations, and functions, and focus on the use of mathematical models to understand and analyze quantitative relationships. Through
SAS Software to Fit the Generalized Linear Model
SAS Software to Fit the Generalized Linear Model Gordon Johnston, SAS Institute Inc., Cary, NC Abstract In recent years, the class of generalized linear models has gained popularity as a statistical modeling
Memory Systems. Static Random Access Memory (SRAM) Cell
Memory Systems This chapter begins the discussion of memory systems from the implementation of a single bit. The architecture of memory chips is then constructed using arrays of bit implementations coupled
Serial Cloner 1.2. User Manual Part I -Basic functions -
Serial Cloner 1.2 User Manual Part I -Basic functions - I Built-In Help Window You will find in this manual the description of the different windows and functions of Serial Cloner as well as some useful
STAT 35A HW2 Solutions
STAT 35A HW2 Solutions http://www.stat.ucla.edu/~dinov/courses_students.dir/09/spring/stat35.dir 1. A computer consulting firm presently has bids out on three projects. Let A i = { awarded project i },
Math Review. for the Quantitative Reasoning Measure of the GRE revised General Test
Math Review for the Quantitative Reasoning Measure of the GRE revised General Test www.ets.org Overview This Math Review will familiarize you with the mathematical skills and concepts that are important
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
How To Understand Enzyme Kinetics
Chapter 12 - Reaction Kinetics In the last chapter we looked at enzyme mechanisms. In this chapter we ll see how enzyme kinetics, i.e., the study of enzyme reaction rates, can be useful in learning more
Interaktionen von RNAs und Proteinen
Sonja Prohaska Computational EvoDevo Universitaet Leipzig June 9, 2015 Studying RNA-protein interactions Given: target protein known to bind to RNA problem: find binding partners and binding sites experimental
Sequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment
Sequence Analysis 15: lecture 5 Substitution matrices Multiple sequence alignment A teacher's dilemma To understand... Multiple sequence alignment Substitution matrices Phylogenetic trees You first need
A Web Based Software for Synonymous Codon Usage Indices
International Journal of Information and Computation Technology. ISSN 0974-2239 Volume 3, Number 3 (2013), pp. 147-152 International Research Publications House http://www. irphouse.com /ijict.htm A Web
2013 MBA Jump Start Program. Statistics Module Part 3
2013 MBA Jump Start Program Module 1: Statistics Thomas Gilbert Part 3 Statistics Module Part 3 Hypothesis Testing (Inference) Regressions 2 1 Making an Investment Decision A researcher in your firm just
Introduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
Protein Protein Interaction Networks
Functional Pattern Mining from Genome Scale Protein Protein Interaction Networks Young-Rae Cho, Ph.D. Assistant Professor Department of Computer Science Baylor University it My Definition of Bioinformatics
How To Test For Significance On A Data Set
Non-Parametric Univariate Tests: 1 Sample Sign Test 1 1 SAMPLE SIGN TEST A non-parametric equivalent of the 1 SAMPLE T-TEST. ASSUMPTIONS: Data is non-normally distributed, even after log transforming.
Clone Manager. Getting Started
Clone Manager for Windows Professional Edition Volume 2 Alignment, Primer Operations Version 9.5 Getting Started Copyright 1994-2015 Scientific & Educational Software. All rights reserved. The software
15.062 Data Mining: Algorithms and Applications Matrix Math Review
.6 Data Mining: Algorithms and Applications Matrix Math Review The purpose of this document is to give a brief review of selected linear algebra concepts that will be useful for the course and to develop
Compensation Basics - Bagwell. Compensation Basics. C. Bruce Bagwell MD, Ph.D. Verity Software House, Inc.
Compensation Basics C. Bruce Bagwell MD, Ph.D. Verity Software House, Inc. 2003 1 Intrinsic or Autofluorescence p2 ac 1,2 c 1 ac 1,1 p1 In order to describe how the general process of signal cross-over
Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6
Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6 In the last lab, you learned how to perform basic multiple sequence alignments. While useful in themselves for determining conserved residues
