1 replicating molecule populations of molecules in compartments. 2 independent replicators chromosomes

Transcription

1 Maynard Smith & Szathmary (1995) from to 1 replicating molecule populations of molecules in compartments 2 independent replicators chromosomes 3 RNA as gene and enzyme DNA genes, protein enzymes Walter Salzburger: Major Transitions in Evolution 4 bacterial cell (prokaryotes) cells with nuclei, organelles (eukaryotes) 5 asexual clones sexual populations 6 protists (single-celled) animals, plants, fungi 7 solitary individuals colonies (non-reproductive casts) 8 primate societies human societies (language) Maynard Smith & Szathmary (1995) molecules - populations of molecules molecules - populations of molecules The first objects with the properties of multiplication, variation and heredity were replicating molecules, similar to RNA but perhaps simpler These molecules were not informational, because they did not code for other structures In a protocell, populations of replicating molecules were enclosed within some kind of membrane ( compartment ) replicating molecule metabolic product

2 molecules - populations of molecules Stromatolites...are witnesses of the oldest known fossils, dating back to up to 3.5 billion years...are layered structures that have been formed by cyanobacteria and other microbes protocell formed when cells grow on the sea surface, and sediments are deposited among or above the cells. The cells then grow up to the light, leaving a mineralized layer below them. Cyanobacteria were likely responsible for the creation of earth s oxygen and, today, are nearly extinct replicators - chromosomes replicators - chromosomes In living organisms, replicating molecules ( genes ) are linked together end to end to form chromosomes. Most simple organisms have a single chromosome per cell. chromosome cell This has the effect that when one gene is replicated, all are (coordinated replication) gene This situation favors co-operation between genes in a compartment. protein

3 Today, there is a division of labor between two classes of molecules: nucleic acids (DNA, RNA) and proteins Nucleic acids store and transmit information, proteins catalyze chemical reactions and form structure (e.g., muscles, hair) ribozyme transfer RNA (trna) I seems likely that, initially, this division did not exist and that RNA performed both functions The transition from this RNA world to the world of DNA and proteins required the evolution of the genetic code messenger RNA (mrna) UGAUUGAGCCGUGUCAAUAU micro RNA (mirna) ribosomal RNA (rrna) images: transcription translation

4 prokaryote - eukaryote relatively simple prokaryote cell no nucleus (i.e., DNA lies in no particular region) a single circular chromosome (most often) small ribosomes in two of the three domains of life (bacteria, archaea) complex internal structure DNA is organized in the nucleus genetic code Ridley (1996) eukaryote cell more than one chromosome organelles (mitochondria, chloroplasts) large ribosomes in all complex multicellular organisms prokaryote - eukaryote prokaryote - eukaryote endosymbiont hypothesis three domains of life

5 Hydra Haplodiploid life cycle without fusion Life cycle with syngamy and a one-step meiosis endomitosis One-step meiosis cell fusion One-step meiosis Genome duplication followed by a simple form of meiosis Endomitosis is replaced by fusion; this is a sexual cycle

6 protists - animals, plants, fungi Modern sexual life cycle Protists exist as single cells (or sometimes colonies) Animals, plants, fungi are composed of many different kinds of cells. Therefore, each individual carries many thousands to millions copies of the genetic information cell fusion two-step meiosis Although - in animals, plants and fungi - all cells contain the same information, they are very different in shape, composition, function, etc. Multicellularity most likely evolved three times in eukaryotes Two-step meiosis is only found in eukaryotes protists - animals, plants, fungi ephithelial cells macrophage cell true animals (metazoa) nerve cell plants muscle cells blood cells pigment cells images: true fungi

7 solitary individuals - colonies solitary individuals - colonies Social insects: Some animals, notably ants, bees, wasps and termites, live in colonies in which only a few individuals reproduce. Such colonies have been likened to a superorganism, analogous to a multicellular organism. The sterile workers are analogous to body cells, and the reproducing individuals to the cells of the germ line. It has been estimated that one-third of the animal biomass of the Amazon rainforest consists of ants and termites. The same might be true for other habitats as well. groups nr. of eusocial species Isoptera all termites 2200 Homoptera some gall aphids 40 Hymenoptera hover wasps (Stenogastinae) 50 independent-founding paper wasps (Polistinae) 630 swarm-founding paper wasps (Polybiini) 400 yellowjackets, hornets (Vespinae) 78 sweat bees (Halictinae) 400 bumble bees (Bombinae) 200 honey bees (Apini) 5 stingless bees (Meliponinae) 280 ants (Formicidae) 9500 eusocial insects solitary individuals - colonies primate - human (language) chimpanzee human gorilla orangutan rhesus macaque leaf cutter ant evolution of language Was language the decisive step in the transition from an ape to a human society? images: National Geographic, Leonardo da Vinci