Eukaryotes. PSI Biology Eukaryotes & Gene Expression

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Eukaryotes. www.njctl.org PSI Biology Eukaryotes & Gene Expression"

Transcription

1 Eukaryotes The Eukaryotic Cell Classwork 1. Identify two characteristics that are shared by all cells. 2. Suppose you are investigating a cell that contains a nucleus. Would you categorize this cell as a prokaryote or eukaryote? Explain your answer. 3. Is it more efficient for cells to have a high or low surface area to volume ratio? Explain. 4. Explain, in terms of cell function, why it is more advantageous for cells to be small. 5. Organelles are to cells as organs are to the human body. Explain why this analogy is true. Homework 6. What are two differences between prokaryotic and eukaryotic cells? 7. Would you be more likely to observe a prokaryotic cell or eukaryotic cell under the lowest magnification available on your microscope? Explain your answer. 8. Explain, in terms of surface area to volume ratio, why cells are small. 9. Identify the four major categories of eukaryotic cells. The Nucleus and Gene Expression Classwork 10. Explain how the meaning of the terms prokaryote and eukaryote help explain the structure of the cell. 11. Why is it important that the nucleus of a cell contains nuclear pores? 12. How is it possible that even though all the cells of a multicellular organism contain the same DNA, there are many different types of cells that differ in structure and function? 13. How are chromosomes related to chromatin? 14. How does the packing of DNA impact the process of gene expression in cells? 15. How does the presence of transcription factors influence the process of gene expression? 16. How is the presence of transcription factors related to external stimuli in an environment? 17. Explain the observable differences that would exist between a molecule of pre-mrna and a finished molecule of mrna? 18. In what way does the splicing of a molecule of mrna alter the contents of the molecule? Be sure to use appropriate terminology. 19. How does alternative splicing affect the ability of a molecule of mrna to produce multiple proteins? 20. Explain how nuclear pores are like the gatekeepers of the nuclear membrane.

2 21. How does the length of a poly-a tail on mrna impact the amount of protein can be produced from the mrna? 22. Given the sequence of eukaryotic DNA below, transcribe the gene and complete all three steps of RNA processing. (Exons are bold) Non-template strand:5 ATTATGGGCATATATCCGGCGCCTTAATTATTC3 Template strand: 3 TAATACCCGTATATAGGCCGCGGAATTAATAAG5 23. How is the process of transcription related to the process of translation in the cell? Homework 24. Why is the nucleus often referred to as the control center of the cell. 25. Is the process of gene expression the same in prokaryotes as it is in eukaryotes? Explain your answer. 26. What is the difference between prokaryotic and eukaryotic DNA? 27. What role do histones play in the packing of DNA? 28. How is the presence of transcription factors related to the characteristics that define living organisms? 29. Identify the purpose of the modification of pre-mrna by adding the nucleotide cap and poly-a tail. 30. Why are coding segments of mrna referred to as exons? 31. Explain how alternative splicing allows a cell to produce different proteins from the same segment of mrna. 32. Given the sequence of eukaryotic DNA below, transcribe the gene and complete all three steps of RNA processing. (Exons are bold) Non-template strand:3 GGCCGGCTATAATCGATACTTACGAATGTAAAA5 Template strand: 5 CCGGCCGATATTAGCTATGAATGCTTACATTTT3 33. What role do hydrolytic enzymes play in the production of protein in a cell? Endomembrane System Classwork 34. What are the components of the endomembrane system? 35. How does the role of the smooth endoplasmic reticulum relate to the amount of smooth E.R. found within different types of cells? 36. Explain the progression of a protein through the endomembrane system of a cell. 37. Compare the Golgi apparatus to a component of a city or town, based on the function of the organelle. 38. How is the creation of lysosomes related to the Golgi apparatus? 39. How is a peroxisome related to a lysosome? 40. Why are cell membranes often referred to as semipermeable?

3 41. Identify and explain the process by which large proteins created in the cell are transported to the extracellular environment? 42. What is a secretory protein? Homework 43. Identify the relationship between ribosomes and the rough endoplasmic reticulum. 44. How does a glycoprotein help determine the role of a protein within a cell? 45. What is the function of the Golgi apparatus in the process of protein production within a cell? 46. Identify three different cellular functions accomplished by the smooth E.R. 47. What is the purpose of lysosomes for the cell? 48. What function do peroxisomes perform for the cell? 49. What role might a protein play that is created within the cell and becomes embedded in the cell membrane? 50. Why is endocytosis important for efficient cellular function? Energy-Converting Organelles Classwork 51. Explain the structure of a chloroplast, identifying the areas where the light reactions and Calvin cycle occur. 52. What is the function of the mitochondria for the cell? 53. Do prokaryotic cells contain mitochondria? Explain your answer. 54. Both mitochondria and chloroplasts contain highly folded internal membranes. Explain the importance of these membranes for the organelle, including the importance of the folded nature. 55. Briefly summarize the endosymbiotic theory as proposed by Lynn Margulis. 56. According to the endosymbiotic theory, before they were eukaryotic organelles, the chloroplast and mitochondria more closely resembled what type of organism? 57. Why is mitochondrial DNA utilized to trace maternal heritage? Homework 58. Identify the role of the chloroplast for a plant cell. 59. Do plant cells contain mitochondria even though they are photosynthetic? Explain your answer. 60. Explain the meaning of the term endosymbiosis. 61. What is the evidence used to support the endosymbiotic theory? 62. What is the mitochondrial eve? 63. Why do organisms receive all of their mitochondrial DNA from their mother? Other Organelles and Cellular Structures Classwork 64. How is the central vacuole of a plant cell related to wilting? 65. How do a food vacuole and lysosome help to digest particles within a cell? 66. What is the role of a contractile vacuole in a cell?

4 67. How are sugars related to the cell wall of plant cells? 68. Why is it important that adjacent plant and animal cells contain cell junctions? 69. Suppose you are investigating a cell that contains plasmodesmata. Would you label this cell as a plant or animal cell? Explain your answer. 70. Which sort of cell junction would you most likely observe between adjacent cells that cannot experience leakage? What type of cells may you be observing? 71. If animal cells need to transport ions and sugars, what sort of cell junction would you predict they would utilize? Support your response. Homework 72. What is a vacuole? 73. How is a central vacuole related to turgor pressure in a cell? 74. What is a cytoskeleton and what does it do for the cell? 75. Compare and contrast the external structure of plant cells and fungi. 76. What role does the extracellular matrix provide for a group of cells? 77. Do plant and animal cells contain the same type of cell junctions? Why or why not? 78. Finish the following analogy. Plasmodesmata: plant cells:: : animal cells. 79. Identify three differences between the structure of plant and animal cells. Free Response 1. Most eukaryotes are multicellular organisms. Explain why a large organism must consist of many cells, by responding to the prompts below: a. The amount of chemical activity in a cell is determined by which characteristic, and why? b. The amount of substances that can enter and leave a cell are determined by which characteristic and why? c. As a cell grows in size, explain how its surface area to volume ratio is affected.

5 2. Below is an illustration of transcription. Respond to the prompts below based upon this illustration. a. In this illustration we can see that an external signal (1) activates a membrane bound protein called a receptor. In step 2, what is the molecule that is produced? b. How do the molecules produced in step 2 interact with DNA? c. What is the role of the molecules produced in step 2, in the process of transcription? 3. The illustration below represents the steps of mrna processing. Use this illustration to respond to the prompts below a. Identify and describe the alteration of the mrna end labeled 1. b. Identify and describe the alteration of the mrna end labeled 2. c. Describe what has occurred during the step labeled 3. How and why has the mrna been changed?

6 4. The theory of endosymbiosis states that the mitochondria and chloroplast were once free-living prokaryotes that were taken up by another prokaryote. a. Explain the four pieces of evidence that support this theory. 5. Mitochondrial Eve is the first human female that gave rise to all humans. a. From whom do eukaryotic organisms inherit their mitochondria and therefore their mitochondrial DNA? b. Explain why the mitochondrial DNA can only be inherited from one parent.

7 Eukaryotes Answer Key 1. Plasma membrane, chromosomes, cytoplasm, ribosomes 2. Eukaryote, prokaryotic cells do not have a nucleus 3. High. A higher ratio keeps cells small, and allows for more efficiency in moving substances in and out of the cell, and an overall more efficient cell 4. Cells need to be small because they need to be able to move substances in and out of the cell at a fast enough rate to sustain life and conduct the chemical processes necessary to support life 5. Organelles are structures within a cell that perform a certain task for the cell, just as an organ is a structure within the body that performs a certain task for the body 6. Prokaryotes lack a nucleus, lack all membrane bound organelles, are smaller than eukaryotes, evolved earlier than eukaryotes, have a single, circular chromosome 7. A eukaryotic cell. Because eukaryotes are much larger than prokaryotes, you would be more likely to see a eukaryotic cell under the lowest power on your microscope 8. The smaller the cell, the higher the surface area to volume ratio. Smaller cells are more efficient because substances can be transported in and out of the cell at a much higher rate in a small cell than a large cell 9. Animal, plant, fungi, protist 10. Prokaryote means before nucleus and eukaryotes means true nucleus 11. Ribosomes are produced in the nucleus, as is mrna, the nuclear pores allow for these molecules to leave the nucleus 12. Different segments of DNA can be activated or deactivated, leading to specialization and differentiation of cells, depending on what segment of DNA is activated, the cell will develop and perform differently 13. Chromatin is chromosomes tightly packed and condensed, wound around histone proteins 14. DNA packed in chromatin cannot be accessed by RNA polymerase and thus cannot be transcribed 15. Transcription factors have the ability to determine which segments of DNA are transcribed and which are not 16. Transcription factors can be produced according to environmental cues, allowing an organism to respond to environmental stimuli 17. Finished mrna would have a 5 G cap and a poly-a tail, the pre-mrna does not have these features 18. Splicing removes segments called introns and joins together segments called exons 19. Alternative splicing allows one molecule of mrna to change which segments are treated as exons, so it can produce multiple proteins depending on which exons are used 20. Nuclear pores keep the interior of the nucleus separate from the rest of the cell, but also allow necessary molecules to leave the cell.

8 21. The longer the poly-a tail, the longer an mrna molecule can produce protein. When the poly-a tail degrades, the mrna can no longer be used for translation AUUAUGGGCAUAUAUCCGGCGCCUUAAUUAUUC3 5 GAUGGGCAUGCGCCUAUUCAAAAA3 23. Transcription produces the mrna that will be used for the process of translation 24. The nucleus contains the DNA, which contains the instructions for creating proteins and regulating cell development and function 25. Not entirely, because prokaryotes do not have a nucleus, the transcription process occurs in within the cytoplasm of the cell 26. Prokaryotic DNA is circular in nature while eukaryotic DNA is linear 27. Histones are proteins around which the DNA is wound, allowing it to pack more tightly 28. Transcription factors allow an organism to respond to environmental stimuli, which is one of the characteristics of life 29. The cap and tail help the mrna to leave the nucleus, protect the coding segments from deterioration by enzymes and make it easier for ribosomes to bind to the mrna 30. Exons receive their name because they are the segments of RNA that are expressed 31. Alternative splicing allows the mrna to rotate the segments that will be expressed into proteins, so the same segment may produce multiple proteins through multiple exon combinations GGCCGGCUAUAAUCGAUACUUACGAAUGUAAAA5 3 AAAAGGCCUAAUCACGAAUGUAG5 33. Hydrolytic enzymes break down the mrna in the cytoplasm, so each molecule will only have time to produce a certain amount of protein before it is degraded 34. Nucleus, rough endoplasmic reticulum, smooth endoplasmic reticulum, golgi apparatus, plasma membrane, lysosomes 35. The smooth E.R. detoxifies substances for the cell, therefore cells in the body that are exposed to toxic substances, such as the liver, have a higher proportion of smooth E.R. than other cells 36. A protein is made on a ribosome on the rough E.R., enters the E.R., is modified and then packaged into a vesicle where it is transported to the Golgi, modified and repackaged, and then either stays in the cell or exits the cell through the cell membrane 37. The Golgi is like a UPS store, in that it accepts proteins, modifies and repackages them, and then redistributes them throughout the cell 38. The Golgi produces vesicles containing powerful digestive enzymes called lysosomes. 39. A peroxisome is a lysosome that is specialized to break down hydrogen peroxide for the cell. 40. Semipermeable means that they allow some things to pass while keeping others out.

9 41. Exocytosis- the vesicle containing the proteins binds with the cell membrane and in doing so releases its proteins to the extracellular environment 42. A secretory protein is a protein that is secreted out of the cell 43. Ribosomes are attached to the surface of the rough E.R. 44. They work like a label to identify where the protein will function in or out of the cell. 45. The Golgi modifies and repackages proteins for the cell 46. Calcium storage, detoxification, produce lipids 47. Lysosomes help to break down and recycle old organelles, help digest food and can be used to protect the cell from infection. 48. They break down hydrogen peroxide for the cell 49. It is likely to be used in transporting substances in and out of the cell 50. Endocytosis allows the cell to absorb necessary substances that are too large to move across the membrane 51. A chloroplast is a disk-shaped organelle contained within a double membrane, which is filled with a jellylike substance called stroma and contains stacks of smaller disks called thylakoids. The light reactions occur within the thylakoid membranes, the Calvin Cycle occurs in the stroma 52. Produces ATP for the cell 53. No, mitochondria are membrane bound organelles, and prokaryotes do not contain any membrane bound organelles 54. The membranes allow for a concentration gradient to be created which is used by both of these organelles to accomplish their task. The folded nature of the membranes increases surface area, allowing for more efficiency in production 55. Mitochondria and chloroplasts were once prokaryotic cells, over time they were engulfed by other prokaryotic cells, which would eventually become eukaryotes, and they continued to produce ATP and conduct photosynthesis within their host cell, developing into the organelles that they are today 56. Prokaryotes 57. Mitochondria produce other mitochondria, since mtdna is found only in the mitochondria, and we receive all of our mitochondria from our mother, the mtdna remains relatively unchanged for generations 58. Conduct photosynthesis and produce sugar for the cell 59. Yes, even though they can produce their own sugar, they still need mitochondria to convert the sugar to usable ATP 60. Endosymbiosis is one organism living within another organism 61. Mitochondria and chloroplasts have their own DNA and ribosomes, they reproduce on their own and they are approximately the same size as a prokaryotic cell 62. The first female human on Earth 63. The egg cell contains mitochondria, the sperm cell that fertilizes the egg does not contribute any mitochondria. All mitochondria in the body are derived from these mitochondria

10 64. The central vacuole provides turgor pressure for the plant cell, increasing rigidity and preventing wilting. If the vacuole does not have enough water, it will lose turgor pressure and the plant will wilt 65. A lysosome can bind to a food vacuole and release its enzymes into the vacuole to aid in digestion 66. The contractile vacuole is used to pump water out of the cell 67. Cellulose, a sugar, is the primary component of the cell wall 68. Cell junctions allow adjacent cells to communicate and transport substances back and forth 69. Plant cell. Animal cells do not contain plasmodesmata 70. Tight junctions, animal cells that cannot allow leakage utilize tight junctionsstomach and epithelial lining use these 71. Gap junctions- these work almost like pores that can open and close to allow substances to pass. 72. Membranous sacks found in plant and animal cells that perform a variety of functions 73. The central vacuole is the organelle that creates turgor pressure for the plant cell based on the amount of water it contains 74. A cytoskeleton is a system of tubules and filaments that is used for structure, support and movement 75. Both have cell walls, plant cell walls are composed of cellulose, fungi of chitin 76. Structural support, healing, communication, tissue separation 77. No. plant cells use plasmodesmata, because they have a cell wall, animal cells have tight junctions, gap junctions and adhering junctions 78. Gap junctions 79. Plant cells have cell walls, chloroplasts, central vacuole. Animal cells lack each of these features but do contain centrioles, which plants do not 1. Cell Size a. The amount of chemical activity in a cell is determined by its volume. If the volume is too large, then interactions are fewer, distances molecules must travel are farther. Therefore the cell must have enough volume to contain cell organelles, nutrients, water, and for materials to move, but not so large that materials cannot reach their destination. b. The amount of substances that can enter and leave a cell are determined by the cell s surface area. The surface area must be large enough that transfer into and out of the cell provides the nutrients and molecules required to maintain equilibrium. Too small a sruafce area would not apply enough movement to support the volume of the cell. c. As a cell grows in size, the relationship between its surface area and volume changes. This ratio changes such that the surface area becomes smaller relative to the volume of the cell (or stated differently, the volume increases more rapidly than the surface area).

11 At some point the materials needs to move into and out of the cell can t do so effectively enough to support the processes within the cell. 2. Gene Expression a. the molecule produced is a transcription factor b. transcription factors can bind with DNA near the promoter region of a gene. The combination of the transcription factor and RNA polymerase initiates the transcription of that gene. c. The transcription factors allow an external signal or stimulus to initiate the transcription of a particular gene, whose protein is needed by the cell. 3. RNA Processing a. the mrna end labeled 1 is the 5 end of the pre-mrna molecule. A nucleotide cap is attached to this 5 end. This helps the ribosomes attach to the mrna so that translation can begin and it protects the mrna from hydrolytic enzymes. b. The 3 end of the pre-mrna receives a poly A tail. This is the addition of a series of adenosine nucleotides. c. The pre-mrna is altered by the removal of introns (intervening nonecoding regions) leaving the exons (the expressed coding regions). Essentially the non-coding is removed to leave a continuous coding sequence in the mature mrna. 4. Mitochondria and chloroplasts can only arise from existing mitochondria and chloroplasts. A cell without these structures cannot produce them. Mitochondria and chloroplasts have their own DNA, that resembles bacterial DNA. Mitochondria and chloroplasts have a single circular DNA strand, identical to the DNA found in prokaryotes. Mitochondria and chloroplasts synthesize their own proteins utilizing their own mechanisms. These mechanisms are similar to those found in bacteria. 5. Mitochondria a. eukaryotic cells and therefore eukaryotic organisms inherit their mitochondria from the female contribution. b. mitochondria are carried within the female egg contribution to offspring. The male sperm cell contains a portion of the DNA from the nucleus. The sperm cells are small and do not carry any organelles however, the much larger egg contributes a portion of the DNA from the nucleus as well as the mitochondria, containing the mitochondrial DNA

Cell Structure and Function. Eukaryotic Cell: Neuron

Cell Structure and Function. Eukaryotic Cell: Neuron Cell Structure and Function Eukaryotic Cell: Neuron Cell Structure and Function Eukaryotic Cells: Blood Cells Cell Structure and Function Prokaryotic Cells: Bacteria Cell Structure and Function All living

More information

Cell Structure & Function!

Cell Structure & Function! Cell Structure & Function! Chapter 3! The most exciting phrase to hear in science, the one that heralds new discoveries, is not 'Eureka!' but 'That's funny.! -- Isaac Asimov Animal Cell Plant Cell Cell

More information

Plasma Membrane hydrophilic polar heads

Plasma Membrane hydrophilic polar heads The Parts of the Cell 3 main parts in ALL cells: plasma membrane, cytoplasm, genetic material this is about the parts of a generic eukaryotic cell Plasma Membrane -is a fluid mosaic model membrane is fluid

More information

Review of the Cell and Its Organelles

Review of the Cell and Its Organelles Biology Learning Centre Review of the Cell and Its Organelles Tips for most effective learning of this material: Memorize the names and structures over several days. This will help you retain what you

More information

Plant and Animal Cells

Plant and Animal Cells Plant and Animal Cells a. Explain that cells take in nutrients in order to grow, divide and to make needed materials. S7L2a b. Relate cell structures (cell membrane, nucleus, cytoplasm, chloroplasts, and

More information

CELLS: PLANT CELLS 20 FEBRUARY 2013

CELLS: PLANT CELLS 20 FEBRUARY 2013 CELLS: PLANT CELLS 20 FEBRUARY 2013 Lesson Description In this lesson we will discuss the following: The Cell Theory Terminology Parts of Plant Cells: Organelles Difference between plant and animal cells

More information

Chapter 5 Organelles. Lesson Objectives List the organelles of the cell and their functions. Distinguish between plant and animal cells.

Chapter 5 Organelles. Lesson Objectives List the organelles of the cell and their functions. Distinguish between plant and animal cells. Chapter 5 Organelles Lesson Objectives List the organelles of the cell and their functions. Distinguish between plant and animal cells. Check Your Understanding What is a cell? How do we visualize cells?

More information

Introduction to the Cell: Plant and Animal Cells

Introduction to the Cell: Plant and Animal Cells Introduction to the Cell: Plant and Animal Cells Tissues, Organs, and Systems of Living Things Cells, Cell Division, and Animal Systems and Plant Systems Cell Specialization Human Systems All organisms

More information

Biology I. Chapter 7

Biology I. Chapter 7 Biology I Chapter 7 Interest Grabber NOTEBOOK #1 Are All Cells Alike? All living things are made up of cells. Some organisms are composed of only one cell. Other organisms are made up of many cells. 1.

More information

Lecture 8. Protein Trafficking/Targeting. Protein targeting is necessary for proteins that are destined to work outside the cytoplasm.

Lecture 8. Protein Trafficking/Targeting. Protein targeting is necessary for proteins that are destined to work outside the cytoplasm. Protein Trafficking/Targeting (8.1) Lecture 8 Protein Trafficking/Targeting Protein targeting is necessary for proteins that are destined to work outside the cytoplasm. Protein targeting is more complex

More information

The Cell Teaching Notes and Answer Keys

The Cell Teaching Notes and Answer Keys The Cell Teaching Notes and Answer Keys Subject area: Science / Biology Topic focus: The Cell: components, types of cells, organelles, levels of organization Learning Aims: describe similarities and differences

More information

Comparing Plant And Animal Cells

Comparing Plant And Animal Cells Comparing Plant And Animal Cells http://khanacademy.org/video?v=hmwvj9x4gny Plant Cells shape - most plant cells are squarish or rectangular in shape. amyloplast (starch storage organelle)- an organelle

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

Biology Chapter 7 Practice Test

Biology Chapter 7 Practice Test Biology Chapter 7 Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. The work of Schleiden and Schwann can be summarized by

More information

7.2 Cells: A Look Inside

7.2 Cells: A Look Inside CHAPTER 7 CELL STRUCTURE AND FUNCTION 7.2 Cells: A Look Inside Imagine a factory that makes thousands of cookies a day. Ingredients come into the factory, get mixed and baked, then the cookies are packaged.

More information

COMPARISON OF PLANT AND ANIMAL CELLS SIMILARITIES IN PLANT & ANIMAL CELLS

COMPARISON OF PLANT AND ANIMAL CELLS SIMILARITIES IN PLANT & ANIMAL CELLS COMPARISON OF PLANT AND ANIMAL CELLS Cells vary widely in structure and function, even within the same organism. The human body, for example, has more than 200 different types of cells, each with a specialized

More information

RAD 223. Radiography physiology. Lecture Notes. First lecture: Cell and Tissue

RAD 223. Radiography physiology. Lecture Notes. First lecture: Cell and Tissue RAD 223 Radiography physiology Lecture Notes First lecture: Cell and Tissue Physiology: the word physiology derived from a Greek word for study of nature. It is the study of how the body and its part work

More information

The microscope is an important tool.

The microscope is an important tool. KEY CONCEPT Microscopes allow us to see inside the cell. BEFORE, you learned Some organisms are unicellular and some are multicellular A microscope is necessary to study most cells The cell theory describes

More information

called a cell wall. The cell wall protects against mechanical stress and keeps the cell from becoming over-filled with water.

called a cell wall. The cell wall protects against mechanical stress and keeps the cell from becoming over-filled with water. What are Cells? By: Byron Norelius About Cells A cell is the basic unit of life. All living organisms are composed of one (unicellular) or more (multicellular) cells. In unicellular organisms, like many

More information

Cellular Structure and Function

Cellular Structure and Function Chapter Test A CHAPTER 7 Cellular Structure and Function Part A: Multiple Choice In the space at the left, write the letter of the term or phrase that best answers each question. 1. Which defines a cell?

More information

AP Biology-Chapter #6 & 7 Review

AP Biology-Chapter #6 & 7 Review DO NOT WRITE ON THIS TEST- USE ANSWER DOCUMENT AP Biology-Chapter #6 & 7 Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. All of the following are

More information

tissues are made of cells that work together, organs are )

tissues are made of cells that work together, organs are ) Study Guide Cells Unit Test Matching. Write the letter of the correct response on the line. You may use the responses more than once. A. proteins B. simple carbohydrates C. complex carbohydrates D. lipids

More information

Cell and Membrane Practice. A. chromosome B. gene C. mitochondrion D. vacuole

Cell and Membrane Practice. A. chromosome B. gene C. mitochondrion D. vacuole Name: ate: 1. Which structure is outside the nucleus of a cell and contains N?. chromosome. gene. mitochondrion. vacuole 2. potato core was placed in a beaker of water as shown in the figure below. Which

More information

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed

More information

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination

More information

RNA & Protein Synthesis

RNA & Protein Synthesis RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis

More information

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu. Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.au What is Gene Expression & Gene Regulation? 1. Gene Expression

More information

Student name ID # 2. (4 pts) What is the terminal electron acceptor in respiration? In photosynthesis? O2, NADP+

Student name ID # 2. (4 pts) What is the terminal electron acceptor in respiration? In photosynthesis? O2, NADP+ 1. Membrane transport. A. (4 pts) What ion couples primary and secondary active transport in animal cells? What ion serves the same function in plant cells? Na+, H+ 2. (4 pts) What is the terminal electron

More information

Video Links: Differences Between Plant and Animal Cells http://www.youtube.com/watch?v=mwz4ptp_qeu

Video Links: Differences Between Plant and Animal Cells http://www.youtube.com/watch?v=mwz4ptp_qeu Comparing Animal and Plant Cells by Annie Plant and animal cells are known as Eukaryotic cells which contain a nucleus and other genetic material enclosed within membranes. (Science Daily, n.d.) The primary

More information

Gymnázium, Brno, Slovanské nám. 7, WORKBOOK - Biology WORKBOOK. www.gymnaslo.agb.cz

Gymnázium, Brno, Slovanské nám. 7, WORKBOOK - Biology WORKBOOK. www.gymnaslo.agb.cz WORKBOOK www.gymnaslo.agb.cz Subjekt: Biology Teacher: Iva Kubištová Student:.. School year:../. This material was prepared with using http://biologygmh.com/ Topics: 1. 2. 3. Cell Structure and Function

More information

GENE REGULATION. Teacher Packet

GENE REGULATION. Teacher Packet AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures

More information

1. When you come to a station, attempt to answer each question for that station.

1. When you come to a station, attempt to answer each question for that station. Name: Block: Steps for completing this study guide 1. When you come to a station, attempt to answer each question for that station. 2. Once you are done answering the questions, or if you can t answer

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

4a. A Busy Factory. Cell Structure: An Overview

4a. A Busy Factory. Cell Structure: An Overview 4a. A Busy Factory Imagine a bustling factory manufacturing the latest must-have gadget. Whether they make bicycles, cell phones, or hot air balloons, most factories are set up in essentially the same

More information

Anatomy and Physiology Placement Exam 2 Practice with Answers at End!

Anatomy and Physiology Placement Exam 2 Practice with Answers at End! Anatomy and Physiology Placement Exam 2 Practice with Answers at End! General Chemical Principles 1. bonds are characterized by the sharing of electrons between the participating atoms. a. hydrogen b.

More information

2007 7.013 Problem Set 1 KEY

2007 7.013 Problem Set 1 KEY 2007 7.013 Problem Set 1 KEY Due before 5 PM on FRIDAY, February 16, 2007. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Where in a eukaryotic cell do you

More information

Control of Gene Expression

Control of Gene Expression Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring

More information

UNIT 1 - Living Organisms and the Environment Situations. Cells

UNIT 1 - Living Organisms and the Environment Situations. Cells Lesson Summaries HUMAN AND SOCIAL BIOLOGY UNIT 1 - Living Organisms and the Environment Situations Lesson 2 Cells OBJECTIVES At the end of this lesson you will be able to: a) Describe the structure of

More information

Look for these related items from Learning Resources :

Look for these related items from Learning Resources : Look for these related items from Learning Resources : LER 1901 Cross Section Plant Cell LER 1902 Cross Section Heart Model LER 1903 Cross Section Brain Model LER 2437 Cross Section Earth Model For a dealer

More information

Complex multicellular organisms are produced by cells that switch genes on and off during development.

Complex multicellular organisms are produced by cells that switch genes on and off during development. Home Control of Gene Expression Gene Regulation Is Necessary? By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring

More information

the plant & animal cell

the plant & animal cell 6.1 Basic unit of life Biology Biology Structure & functions of 06 the plant & animal cell In 1665, Robert Hooke observed a section of a cork using a microscope prepared by him. He discovered a structure

More information

B2 1 Cells, Tissues and Organs

B2 1 Cells, Tissues and Organs B2 Cells, Tissues and Organs 5 minutes 5 marks Page of 7 Q. The diagram shows a bacterium. On the drawing, name the structures labelled A, B, C and D. (Total 4 marks) Q2. (a) The diagrams show cells containing

More information

PLANT AND ANIMAL CELL ORGANELLES

PLANT AND ANIMAL CELL ORGANELLES reflect The heart is an example of an organ. Think for a minute about your body. It s organized into parts that perform specific functions. For example, your heart functions to help transport materials

More information

pathway that involves taking in heat from the environment at each step. C.

pathway that involves taking in heat from the environment at each step. C. Study Island Cell Energy Keystone Review 1. Cells obtain energy by either capturing light energy through photosynthesis or by breaking down carbohydrates through cellular respiration. In both photosynthesis

More information

Protein Synthesis How Genes Become Constituent Molecules

Protein Synthesis How Genes Become Constituent Molecules Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein

More information

Partnerships Implementing Engineering Education Worcester Polytechnic Institute Worcester Public Schools Supported by: National Science Foundation

Partnerships Implementing Engineering Education Worcester Polytechnic Institute Worcester Public Schools Supported by: National Science Foundation Cells & Heredity: 6.C.2 Design a Cell Travel Brochure Grade Level 6 Sessions Seasonality Instructional Mode(s) Team Size WPS Benchmarks MA Frameworks Key Words 15-50 minutes N/A Individual N/A 06.SC.LS.05

More information

Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.

Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells. Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,

More information

Buddhist Chi Hong Chi Lam Memorial College A.L. Bio. Notes (by Denise Wong) The Cell... Page 28

Buddhist Chi Hong Chi Lam Memorial College A.L. Bio. Notes (by Denise Wong) The Cell... Page 28 The Cell... Page 28 Organelles of cells: Introduction : - The cell is the fundamental unit of life. - The modern Cell theory states : i) All living organisms are composed of cells. ii) All new cells are

More information

Cellular Reproduction

Cellular Reproduction 9 Cellular Reproduction section 1 Cellular Growth Before You Read Think about the life cycle of a human. On the lines below, write some of the stages that occur in the life cycle of a human. In this section,

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

Cells are tiny building blocks that make up all living things. Cells are so small that you need a microscope to see them.

Cells are tiny building blocks that make up all living things. Cells are so small that you need a microscope to see them. FC01 CELLS s are tiny building blocks that make up all living things. s are so small that you need a microscope to see them. ANIMAL CELL PLANT CELL This is the control centre of the cell. It contains chromosomes

More information

Drexel-SDP GK-12 ACTIVITY

Drexel-SDP GK-12 ACTIVITY Drexel-SDP GK-12 ACTIVITY Subject Area(s): Biology Associated Unit: None Associated Lesson: None Activity Title : Plant or Animal Cell? Grade Level: 7 and 8 (7-9) Activity Dependency: None Time Required:

More information

Animal & Plant Cell Slides

Animal & Plant Cell Slides Animal & Plant Cell Slides Category: Biology Type: Class Experiment, 60 min class Materials: 2 Glass Slides 2 Cover Slips 1 Bottle of methylene blue (optional) 1 Plastic tray 1 Bottle of iodine 1 Plastic

More information

Chapter 18 Regulation of Gene Expression

Chapter 18 Regulation of Gene Expression Chapter 18 Regulation of Gene Expression 18.1. Gene Regulation Is Necessary By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection

More information

Section 7-3 Cell Boundaries

Section 7-3 Cell Boundaries Note: For the past several years, I ve been puzzling how to integrate new discoveries on the nature of water movement through cell membranes into Chapter 7. The Section below is a draft of my first efforts

More information

The Cell Theory The Discovery of Cells Basic Properties of Cells Two Fundamentally Different Classes of Cells: Prokaryotes and Eukaryotes

The Cell Theory The Discovery of Cells Basic Properties of Cells Two Fundamentally Different Classes of Cells: Prokaryotes and Eukaryotes The Discovery of Cells 1. Robert Hooke (1665), English microscopist described chambers in cork; called them cells (cellulae) since they reminded him of cells occupied by monks living in a monastery He

More information

PRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY

PRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY Name PRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY Cell Structure Identify animal, plant, fungal and bacterial cell ultrastructure and know the structures functions. Plant cell Animal cell

More information

C E L L O. Recommended Age: 6 years-8 years Time: 45 minutes prep, additional 3 hours for Jello to set

C E L L O. Recommended Age: 6 years-8 years Time: 45 minutes prep, additional 3 hours for Jello to set C E L L O Recommended Age: 6 years-8 years Time: 45 minutes prep, additional 3 hours for Jello to set The smallest and simplest unit of life is called a cell. Cells are divided into two types of cells

More information

PLANT CELLS AND ANIMAL CELLS

PLANT CELLS AND ANIMAL CELLS PLANT CELLS AND ANIMAL CELLS General Science, Biology, Anatomy, Physiology Grades 6 12 OBJECTIVES CONTENT THINKING SKILL/PROCESS Students will learn the role of cells as building blocks of all living structures.

More information

To be able to describe polypeptide synthesis including transcription and splicing

To be able to describe polypeptide synthesis including transcription and splicing Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

All About Cells Literacy Foundations Science: Biology

All About Cells Literacy Foundations Science: Biology Version 01 All About Cells Literacy Foundations Science: Biology 2012 by Open School BC This work is licensed under the Creative Commons Attribution-NonCommercial 4.0 International License. To view a copy

More information

Cells. Introduction WSBCTC 1

Cells. Introduction WSBCTC 1 Cells Cells are the fundamental unit of life. All living things are composed of cells. While there are several characteristics that are common to all cells, such as the presence of a cell membrane, cytoplasm,

More information

The Cell. Grade 8 Activity Plan

The Cell. Grade 8 Activity Plan The Cell Grade 8 Activity Plan Plant Cell Project Objectives: 1. To identify cell organelles and their functions. 2. To demonstrate the difference between plant and animal cells. Keywords/concepts: cells,

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

Gene Models & Bed format: What they represent.

Gene Models & Bed format: What they represent. GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression (Learning Objectives) Explain the role of gene expression is differentiation of function of cells which leads to the emergence of different tissues, organs, and organ systems

More information

Chloroplasts and Mitochondria

Chloroplasts and Mitochondria Name: KEY Period: Chloroplasts and Mitochondria Plant cells and some Algae contain an organelle called the chloroplast. The chloroplast allows plants to harvest energy from sunlight to carry on a process

More information

CORAL REEF ECOLOGY. Objectives Students will learn that coral is an animal. Students will learn the differences between plant and animal cells.

CORAL REEF ECOLOGY. Objectives Students will learn that coral is an animal. Students will learn the differences between plant and animal cells. CORAL REEF ECOLOGY Concepts Scientific method Difference between plants and animals cells HCPS III Benchmarks SC 4.1.2 SC 4.4.1 Duration 2 hours Source Material PRISM Vocabulary Cell Cell Membrane Cytosol

More information

chapter3 Cell Structure and Function

chapter3 Cell Structure and Function chapter3 Cell Structure and Function Chapter Concepts 3.1 the cellular level of Organization What does the cell theory state? 46 What instruments would a scientist use to study and view small cells? 46

More information

IIn our high tech world, one of the hottest areas of development

IIn our high tech world, one of the hottest areas of development Topic 1.1 Why are cells important? Key Concepts Studying cells helps us understand how organisms function. Cellular organelles work together to carry out life functions. Cellular processes enable organisms

More information

Anatomy PHL 212. By Dr Tajdar Husain Khan

Anatomy PHL 212. By Dr Tajdar Husain Khan Anatomy PHL 212 By Dr Tajdar Husain Khan Overview of Anatomy Anatomy(from the Greek word anatome,"dissection") is a branch of natural science dealing with the structural organization of living things The

More information

Plant and Animal Cells

Plant and Animal Cells Plant and Animal Cells Strand Topic Life Systems Investigating organelles and their functions in cells of living things Primary SOL LS.2 The student will investigate and understand that all living things

More information

the!sun!to!sugars.!this!is!called!! photosynthesis.!the!byproduct!of!those! Nucleus! sugars!is!our!oxygen.!

the!sun!to!sugars.!this!is!called!! photosynthesis.!the!byproduct!of!those! Nucleus! sugars!is!our!oxygen.! Cytoplasm ANIMAL CELL Vacuoles Mitochondria Chromosomes GolgiApparatus Chloroplast+ TheChloroplastiswhatmakesthefood inthecell.they reonlyfoundinplant cellsandsomeprotists.everygreen plantyouseeisconvertingenergyfrom

More information

CONCEPTS OF BIOLOGY - BIOL115 Dr. SG Saupe; Fall 2006 Exam #2

CONCEPTS OF BIOLOGY - BIOL115 Dr. SG Saupe; Fall 2006 Exam #2 CONCEPTS OF BIOLOGY - BIOL115 Dr. SG Saupe; Fall 2006 Exam #2 name And he gave it for his opinion, that whoever could make two ears of corn or two blades of grass to grow upon a spot where only one grew

More information

Mitochondrial DNA Analysis

Mitochondrial DNA Analysis Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)

More information

SAMPLE PAGES. Unit 11.1 Living Things. Topic 1: Cells, tissues and organs Authors: Martin Hanson with Diaiti Zure. The discovery of cells.

SAMPLE PAGES. Unit 11.1 Living Things. Topic 1: Cells, tissues and organs Authors: Martin Hanson with Diaiti Zure. The discovery of cells. Unit 11.1 Living Things Topic 1: Cells, tissues and organs Authors: Martin Hanson with Diaiti Zure Millions of plant and animal species live in the world and PNG has over 5% of the total species on the

More information

MOLECULAR BIOLOGY AND GENETICS- English 2015/2016 Fall Term 1 st year program

MOLECULAR BIOLOGY AND GENETICS- English 2015/2016 Fall Term 1 st year program MOLECULAR BIOLOGY AND GENETICS- English 2015/2016 Fall Term 1 st year program 14/09 Monday 15/09 Tuesday 16/09 Wednesday 17/09 Thursday 18/09 Friday Atatürk İlkeleri ve 10:00-11:00 Faculty of Law lecture

More information

Question. Which of the following are necessary in order for photosynthesis to occur? A. water B. light energy C. carbon dioxide D.

Question. Which of the following are necessary in order for photosynthesis to occur? A. water B. light energy C. carbon dioxide D. Photosynthesis is the process through which plants convert light energy to chemical energy in order to produce food The energy involved in photosynthesis is eventually stored in the chemical bonds of molecules

More information

NO CALCULATORS OR CELL PHONES ALLOWED

NO CALCULATORS OR CELL PHONES ALLOWED Biol 205 Exam 1 TEST FORM A Spring 2008 NAME Fill out both sides of the Scantron Sheet. On Side 2 be sure to indicate that you have TEST FORM A The answers to Part I should be placed on the SCANTRON SHEET.

More information

Biology. Slide 1of 51. End Show. Copyright Pearson Prentice Hall

Biology. Slide 1of 51. End Show. Copyright Pearson Prentice Hall Biology 1of 51 8-3 The Reactions of Photosynthesis 2of 51 Inside a Chloroplast Inside a Chloroplast In plants, photosynthesis takes place inside chloroplasts. Plant Chloroplast Plant cells 3of 51 Inside

More information

CHAPTER 40 The Mechanism of Protein Synthesis

CHAPTER 40 The Mechanism of Protein Synthesis CHAPTER 40 The Mechanism of Protein Synthesis Problems: 2,3,6,7,9,13,14,15,18,19,20 Initiation: Locating the start codon. Elongation: Reading the codons (5 3 ) and synthesizing protein amino carboxyl.

More information

What makes cells different from each other? How do cells respond to information from environment?

What makes cells different from each other? How do cells respond to information from environment? What makes cells different from each other? How do cells respond to information from environment? Regulation of: - Transcription - prokaryotes - eukaryotes - mrna splicing - mrna localisation and translation

More information

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page

More information

Unit I: Introduction To Scientific Processes

Unit I: Introduction To Scientific Processes Unit I: Introduction To Scientific Processes This unit is an introduction to the scientific process. This unit consists of a laboratory exercise where students go through the QPOE2 process step by step

More information

Photosynthesis and Cellular Respiration. Stored Energy

Photosynthesis and Cellular Respiration. Stored Energy Photosynthesis and Cellular Respiration Stored Energy What is Photosynthesis? plants convert the energy of sunlight into the energy in the chemical bonds of carbohydrates sugars and starches. SUMMARY EQUATION:

More information

Chapter 12: The Cell Cycle

Chapter 12: The Cell Cycle Name Period Chapter 12: The Cell Cycle Overview: 1. What are the three key roles of cell division? State each role, and give an example. Key Role Reproduction Growth and development Tissue removal Example

More information

AP BIOLOGY 2009 SCORING GUIDELINES

AP BIOLOGY 2009 SCORING GUIDELINES AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure

More information

If and when cancer cells stop dividing, they do so at random points, not at the normal checkpoints in the cell cycle.

If and when cancer cells stop dividing, they do so at random points, not at the normal checkpoints in the cell cycle. Cancer cells have escaped from cell cycle controls Cancer cells divide excessively and invade other tissues because they are free of the body s control mechanisms. Cancer cells do not stop dividing when

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

10. T and B cells are types of a. endocrine cells. c. lymphocytes. b. platelets. d. complement cells.

10. T and B cells are types of a. endocrine cells. c. lymphocytes. b. platelets. d. complement cells. Virus and Immune System Review Directions: Write your answers on a separate piece of paper. 1. Why does a cut in the skin threaten the body s nonspecific defenses against disease? a. If a cut bleeds, disease-fighting

More information

PART I: Neurons and the Nerve Impulse

PART I: Neurons and the Nerve Impulse PART I: Neurons and the Nerve Impulse Identify each of the labeled structures of the neuron below. A. B. C. D. E. F. G. Identify each of the labeled structures of the neuron below. A. dendrites B. nucleus

More information

Osmosis, Diffusion and Cell Transport

Osmosis, Diffusion and Cell Transport Osmosis, Diffusion and Cell Transport Types of Transport There are 3 types of transport in cells: 1. Passive Transport: does not use the cell s energy in bringing materials in & out of the cell 2. Active

More information

Eukaryotic Cells Organelles Cell Wall cell wall

Eukaryotic Cells Organelles Cell Wall cell wall Eukaryotic Cells Think back to Schwann and Schleiden. It wasn t until that fateful lunch that Schwann realized he was seeing cells. After that moment cell biology knowledge exploded (just a saying; it

More information

Investigating cells. Cells are the basic units of living things (this means that all living things are made up of one or more cells).

Investigating cells. Cells are the basic units of living things (this means that all living things are made up of one or more cells). SG Biology Summary notes Investigating cells Sub-topic a: Investigating living cells Cells are the basic units of living things (this means that all living things are made up of one or more cells). Cells

More information

While reading these chapters, constantly ask yourself, How is this information helping me to understand how cells get energy from food?

While reading these chapters, constantly ask yourself, How is this information helping me to understand how cells get energy from food? Biology 160 Reading Guide 07: Photosynthesis NAME: This is DUE: Come prepared to share your findings with your group. ** Fill this reading guide out as you are reading the chapters. This will help you

More information

SOME Important Points About Cellular Energetics by Dr. Ty C.M. Hoffman

SOME Important Points About Cellular Energetics by Dr. Ty C.M. Hoffman SOME Important Points About Cellular Energetics by Dr. Ty C.M. Hoffman An Introduction to Metabolism Most biochemical processes occur as biochemical pathways, each individual reaction of which is catalyzed

More information

Photosynthesis Chapter 8 E N E R G Y T O M A K E F O O D?

Photosynthesis Chapter 8 E N E R G Y T O M A K E F O O D? Photosynthesis Chapter 8 H O W D O E S T H E P L A N T U S E T H E S U N S E N E R G Y T O M A K E F O O D? http://www.youtube.com/watch?v=pe82qtkssh4 Autotroph vs. Heterotroph Autotrophs/Producers-organisms

More information