Activity 4 Probability, Genetics, and Inheritance
|
|
|
- Adelia Wilcox
- 9 years ago
- Views:
Transcription
1 Activity 4 Probability, Genetics, and Inheritance Objectives After completing this activity students will understand basic probability and single-gene inheritance. Students will be able to predict expected results for a coin tossing exercise and also for a simulated monohybrid genetic cross. Basic terms from genetics and inheritance will be introduced and students will understand the importance of DNA in regulating inheritance and cellular function. Terminology Adaptation, albino, asexual reproduction, cell, chance, characteristic, chromosomes, clone, code, classification, comparison, daughter cell, double helix, DNA, dominant trait, expected results, gamete, gene, genetic cross, genetic trait, genetics, genome, Human Genome Project, inheritance, inherited trait, meiosis, mitosis, molecules, mutation, nucleus, offspring, parent cell, probability, proteins, Punnett square, recessive trait, sexual reproduction, single-gene traits, variation, zygote Grade Level: 4 th -6 th Grade Ideal Class Size: 24 students divided into six groups of four Subject Areas: Life science, inquiry skills, Alg-S1 Time 1-hour introduction and presentation 1-hour hands-on activity/experiment Materials PowerPoint presentation or slide projector w/slides Flip chart or writing board and eraseable colored markers Equipment: o Pennies (40) o Mouse genetics puppets o Bags of male & female checker gametes (1 set of each/pair) Posters: o Genetics & Inheritance: Just what is DNA, and where is it found? o Genetics & Inheritance: How Does Inheritance Work? o Single Gene Traits in Humans Handouts: o Student Probability & Genetics Introduction (1/student) o Student Data Sheets for Probability & Genetics (1/student) o Genetics word search and DNA code puzzle Advanced Preparation 1) Label checker gamete bags with either male or female mouse pictures. Fill each bag with eight black checkers and eight red checkers. Each student pair should receive a male gamete bag and a female gamete bag. (a class of 24 students should have 12 male bags and 12 female bags.) 2) Construct models or puppets of mice with black and red eyes to help explain dominant and recessive traits and the use of the Punnett square. 1
2 3) Copy the Workshop Outline onto a writing board or flip chart. This will help you complete all the steps in the scheduled amount of time. Activity 4: Genetics & Inheritance Workshop Outline LECTURE AND DEMONSTRATIONS (30 minutes) 1. Introduction (15 minutes) A. Today s topic Genetics & Inheritance B. Today s task list/workshop outline C. Review SAFE Rules D. Review the Methods of Science II. Power Point Presentation (15 minutes) TITLE ACTIVITY/EXPERIMENT (1 hour 30 minutes) I. Conduct a probability activity (20 minutes) II. Conduct a simulated genetic cross (50 minutes) III. Science seminar (10 minutes) A. Sharing the Results B. Interpreting the Data IV. Close-out (10 minutes) A. Wrap-up Questions a. Single gene trait poster 2
3 Background Information (supplements information in PowerPoint presentation) INTRODUCTION TO DNA All animals and plants on Earth share something in common. They all use the same code to grow and function. This code can be found in bacteria, elephants, oak trees, and humans. It s the master plan for all organisms, like the source code for a computer program. It s the reason your toes are on the ends of your feet (where they belong) instead of on your hands or hanging off the edges of your ears. The code is called DNA, which is shorthand for Deoxyribose Nucleic Acid. DNA exists as long molecules within the nucleus of almost every cell in an organism. The DNA is in the form of a twisted ladder that scientists call a double helix. The rungs of the ladder make up the four-letter DNA code or alphabet: A, T, C, and G. These alphabet pieces are called bases and they bond together according to special rules: A always pairs with T, and C always pairs with G. [A T C G] When the DNA code is read by the cell, only one strand of the code is used. The string of letters (or bases) make 3-letter long words and the words make sentences, just like the letters, words, and sentences in your science textbook. In DNA, the sentences are called genes. One strand of DNA may contain many genes. ATGCTCGAATAAATGTGAATTTGA ATG CTC GAA TAA ATG TGA ATT TGA <ATG CTC GAA TAA ATG TGA ATT TGA AAA TGG> Genes tell the cells how to make other complex molecules called proteins. Cells produce thousands of different proteins that work together to allow organisms to do all the functions necessary for life. Fun Fact #1: Each cell in our body contains a lot of DNA (about 1.7 meters). If our cells were enlarged to the size of an aspirin pill, the DNA in that cell would be 10,000 meters long. That s as long as 109 football fields. Fun Fact #2: If you opened up all your cells and laid out the DNA end to end, the strands would stretch from the Earth to the Moon about 6,000 times. CHROMOSOMES AND MITOSIS The DNA in each cell is coiled up tightly and packed into compact units called chromosomes. Each body cell of an organism has the same number of chromosomes. The number of chromosomes in each cell is different for different species of organisms. In humans, every cell contains 46 chromosomes. Dogs have 78 chromosomes in every cell. Cats have 38 chromosomes, horses have 64, and fruit flies have 8. 3
4 Within the nucleus of each cell, the chromosomes are found in pairs, with half coming from each parent. So for humans, 23, or half of the 46 chromosomes in each of your cells came from your father and half (23) came from your mother. Fun Fact #3: The least number of chromosomes is found in a species of ant that has only 2 chromosomes. The record for the most chromosomes goes to a species of fern, which has 1,260 chromosomes in each cell. Remember that within the nucleus of every cell in the body, the chromosomes contain the DNA, which carries the genetic code that directs how every cell functions. When the body makes new cells as part of growth, or to repair damaged tissues, the cells divide in a process called mitosis. During mitosis, each parent cell divides to form two daughter cells. The chromosomes in each parent cell also divide, so that each daughter cell has an exact copy of the chromosomes found in the parent cell. This way skin cells, for example, will all have the same genetic information so they will all function alike. ASEXUAL AND SEXUAL REPRODUCTION Some organisms can produce offspring by making exact copies of the parent. This is called asexual reproduction, and is found in single-celled organisms like the Paramecium and Amoeba, and also in simple organisms like sponges. Many plants can also reproduce asexually. The offspring produced by asexual reproduction are always exact copies of their parents in effect they are all clones of the parent organism. Asexual reproduction allows an organism to make lots of copies of itself, but all the copies are identical. So, how do we get so much variation in nature? Why don t we all look just like our brothers and sisters and parents? When most organisms produce offspring, they use a different method, called sexual reproduction. In sexual reproduction, offspring are not exact copies of their parents. Instead, they receive half their genes from their mothers and half from their fathers, so offspring may have characteristics in common with both parents, but they also have many unique traits characteristics that may not be seen in either parent. During sexual reproduction, special cells called gametes are produced by each parent. Because these cells undergo a special type of cell division called meiosis, each gamete contains only half the number of chromosome found in the parent s body cells. So for humans, each body cell has 46 chromosomes (or 23 pairs half from mom and half from dad), but each gamete only has 23 chromosomes, or one chromosome from each pair. During sexual reproduction, the male and female gametes unite to form a zygote, which then has the 46 chromosomes characteristic of human body cells. Zygotes undergo cell division and grow and eventually develop into adults. However, offspring produced by sexual reproduction are not identical to their parents or to their brothers and sisters, because they each received different combinations of the chromosomes from each parent. This is one way that variation is introduced into each generation. Another way that variation can be achieved is through mutation. Sometimes when chromosomes are making copies of themselves, a mistake in the DNA code can occur. Also, there are factors in the environment that can cause errors or changes in the DNA code, such as UV radiation from sunlight, ionizing radiation from natural or man-made radioactive substances, and harsh chemicals 4
5 introduced into the environment. All of these can damage DNA and may result in a mutation in a gene. INHERITANCE AND PROBABILITY Now that you know how genetic traits are passed from parent to offspring, let s see if we can predict how a simple inherited trait will be passed from parents to their offspring. Many traits can be very complicated, and often more than one gene plays a part in how a trait will be expressed in an organism. For example, eye color, height, and weight in humans are all traits that are affected by more than one gene. But there are some traits in humans and other organisms that are determined by a single gene, and these are the kind of traits we will examine today. But first, we need to look at the math behind inheritance. In genetics, when we are trying to figure out how traits may be passed from parents to offspring, probability is an important consideration. If we know a little bit about the trait we are studying, we can use probability to predict how the gene in question will be transferred from parents to offspring. As an example, let s toss a coin: If you examine a coin, you ll see that it has 2 sides heads and tails and so there are 2 possible outcomes when the coin is tossed: it will land with the heads side up, or with the tails side up. When you toss the coin, the probability of getting a heads is ½, or 50%. This represents the number of desired outcomes (heads = 1) divided by the number of possible outcomes (heads + tails = 2). There is also a probability of ½ that we will get a tails if we toss the coin. If we toss our coin only two times, we might get 2 heads, 2 tails, or 1 heads and 1 tails. But the more times we toss our coin, the more likely we are to get closer and closer to our expected probability of 50% heads and 50% tails. Based upon what we know about coins, we form an hypothesis that the probability of getting a heads when we toss the coin is ½ or 50%. Then we test our hypothesis by tossing the coin and recording the results. [a probability exercise will be conducted during class to demonstrate these concepts.] EYE COLOR IN MICE Now that we ve explored how probability is important in genetics, let s investigate the inheritance of a simulated genetic trait in mice that is determined by a single gene. Mice may have either black eyes or red eyes, and from the work of other mouse researchers we know that pure black-eyed mice bred to pure red-eyed mice always produce offspring with black eyes. Thus, we say that the gene for black eyes is dominant and the gene for red eyes is recessive, because the gene for black eyes dominates the gene for red eyes. In genetics, it is often useful to represent genetic crosses like the one described above using a Punnett square: We ll represent the mouse eye color gene by the letter B. The dominant gene for black eyes will be designated by B ; the recessive gene for red eyes by b. In the cross described above, because Dad is a pure black-eyed mouse, he s designated as BB. Mom is a pure red-eyed mouse, designated by bb. 5
6 Mom s genes pure red eyes (bb) b b Dad s genes pure black eyes (BB) B B Offspring: all black eyes () BB X bb Dad can produce gametes that have only B genes. Mom can produce gametes that have only b genes. All offspring will be and have black eyes. What happens if we now breed together the offspring from the cross above? Using another Punnett square will help us figure out what outcome we expect from this cross. Mom s genes black eyes () B b Dad s genes black eyes () B BB b bb Offspring: ¾ have black eyes (BB or ) ¼ have red eyes (bb) X Dad now produces ½ of his gametes with the dominant B gene and ½ with the recessive b gene. So does Mom. The offspring have both black and red eyes: ¾ carry the dominant B gene and have black eyes; ¼ carry 2 recessive b genes and have red eyes. So, from this genetic cross, we expect to produce: 1 pure black-eyed mouse (BB) 2 black-eyed mice that each carry 1 B and 1 b gene () 1 pure red-eyed mouse (bb) The Punnett square helps us form an hypothesis about the outcome we expect when we breed together 2 mice that each have genes. Let s test that prediction. [a simulated mouse genetic cross will be conducted during class to demonstrate these concepts.] OTHER TOPICS THAT COULD BE COVERED 1. As an example of how a single-gene mutation may greatly affect an organism, you could use an albino and normal rat snake or corn snake as a demo. Albinism is usually a single-gene mutation. Talk about the impacts to a snake that needs to be camouflaged to avoid predators and to hunt for prey efficiently. 2. Survey the class for single-gene traits that are easy to detect in humans. Those in the chart below are easy to determine: 6
7 DOMINANT TRAIT tongue roller crossed hands left thumb on top widow s peak present able to wiggle ears no hitchhiker s thumb bent pinky (end of little finger bends toward 4 th finger when little fingers are held side-byside) free ear lobes hair present on the middle segment of any or all fingers Dimples present on face RECESSIVE TRAIT non tongue roller right thumb on top no widow s peak can t wiggle ears hitchhiker s thumb straight little finger attached ear lobes no hair on middle segments of fingers no dimples 3. Talk about pedigrees. Pedigrees basically are family trees that trace genetically inherited traits of interest. Geneticists use pedigrees to study human and animal diseases. Breeders use pedigrees to track traits that they are interested in promoting in their animals or plants. Sample pedigree from our mouse eye-color experiment: 4. Talk about the Human Genome Project. The entire human genome has now been mapped. (A genome includes all the genes of an organism) Show chromosome maps that indicate the genetic disorders/traits that have been mapped to specific areas of specific chromosomes. Other genomes that either have already been mapped or will be mapped in the near future include: rice yeast Arabidopsis (a small plant in the mustard family) fruit fly (Drosophila) round worm (C. elegans) mouse (Mus) Japanese pufferfish Plasmodium (the parasite that causes malaria) mosquito E. coli and 46 other bacteria and 16 prokaryotes Dog 7
8 Fun Fact #4 The human genome contains 3 billion base pairs of DNA, about the same amount as frogs and sharks. But other genomes are much larger. A newt genome has about 15 billion base pairs of DNA, and a lily genome has almost 100 billion. Fun Fact #5 The human genome codes for about 35,000 genes. 1. Introduction (15 minutes) LECTURE AND DEMONSTRATIONS (30 minutes) A. Today s topic Today s topic is Probability, Genetics, and Inheritance. We re going to meet an SREL researcher named Travis Glenn who uses DNA to figure out which male and female alligators are the parents of which baby gators. Then you ll get to do a probability exercise with coin tosses and conduct your own simulated genetic cross. B. Today s task list / workshop outline C. Review SAFE Rules D. Review the Methods of Science II. PowerPoint Presentation (15 minutes) III. Demonstrations (5 minutes) A. Cracking the Code [Suggestion: Lead the students through the first line of their DNA Code Puzzle to illustrate how a genetic code is translated] EXPERIMENT (1 hour 30 minutes) I. Conduct a probability exercise (20 minutes) [Pass out a Probability Data Sheet and a penny to each student. Lead them through the coin toss exercise and collect their data on the front board. Explain the math involved as outlined in the introductory material and segue into probability, genetic crosses, and the use of Punnett squares.] II. Conduct a simulated genetic cross (50 minutes) [Review the concepts of dominant and recessive () traits and illustrate the use of the Punnett square using the following crosses for eye color in mice: BB X bb and X where BB = black eyes, = black eye dominance/red eye recessive, and bb = red eyes. Discuss probability and how a hypothesis, or prediction, can be made using the Punnett square. Then conduct an experiment using the checker gametes to see how well the actual results of the cross support 8
9 the expected results. Students will then conduct their own experiments using the instructions on the student data sheets.] III. Science Seminar (10 minutes) A. Sharing the results B. Graphing and interpreting the data IV. Close-out (10 minutes) A. Wrap-Up Questions [Take a minute to answer questions the students may have come up with during the activity, and to assess their comprehension of the material covered. Share the large Single Gene Trait poster with the class.] 9
Bio EOC Topics for Cell Reproduction: Bio EOC Questions for Cell Reproduction:
Bio EOC Topics for Cell Reproduction: Asexual vs. sexual reproduction Mitosis steps, diagrams, purpose o Interphase, Prophase, Metaphase, Anaphase, Telophase, Cytokinesis Meiosis steps, diagrams, purpose
12.1 The Role of DNA in Heredity
12.1 The Role of DNA in Heredity Only in the last 50 years have scientists understood the role of DNA in heredity. That understanding began with the discovery of DNA s structure. In 1952, Rosalind Franklin
Variations on a Human Face Lab
Variations on a Human Face Lab Introduction: Have you ever wondered why everybody has a different appearance even if they are closely related? It is because of the large variety or characteristics that
Genetics 1. Defective enzyme that does not make melanin. Very pale skin and hair color (albino)
Genetics 1 We all know that children tend to resemble their parents. Parents and their children tend to have similar appearance because children inherit genes from their parents and these genes influence
Lesson Plan: GENOTYPE AND PHENOTYPE
Lesson Plan: GENOTYPE AND PHENOTYPE Pacing Two 45- minute class periods RATIONALE: According to the National Science Education Standards, (NSES, pg. 155-156), In the middle-school years, students should
LAB : PAPER PET GENETICS. male (hat) female (hair bow) Skin color green or orange Eyes round or square Nose triangle or oval Teeth pointed or square
Period Date LAB : PAPER PET GENETICS 1. Given the list of characteristics below, you will create an imaginary pet and then breed it to review the concepts of genetics. Your pet will have the following
Heredity. Sarah crosses a homozygous white flower and a homozygous purple flower. The cross results in all purple flowers.
Heredity 1. Sarah is doing an experiment on pea plants. She is studying the color of the pea plants. Sarah has noticed that many pea plants have purple flowers and many have white flowers. Sarah crosses
Mendelian and Non-Mendelian Heredity Grade Ten
Ohio Standards Connection: Life Sciences Benchmark C Explain the genetic mechanisms and molecular basis of inheritance. Indicator 6 Explain that a unit of hereditary information is called a gene, and genes
Chapter 13: Meiosis and Sexual Life Cycles
Name Period Concept 13.1 Offspring acquire genes from parents by inheriting chromosomes 1. Let s begin with a review of several terms that you may already know. Define: gene locus gamete male gamete female
Chapter 13: Meiosis and Sexual Life Cycles
Name Period Chapter 13: Meiosis and Sexual Life Cycles Concept 13.1 Offspring acquire genes from parents by inheriting chromosomes 1. Let s begin with a review of several terms that you may already know.
Mitosis, Meiosis and Fertilization 1
Mitosis, Meiosis and Fertilization 1 I. Introduction When you fall and scrape the skin off your hands or knees, how does your body make new skin cells to replace the skin cells that were scraped off? How
Genetics for the Novice
Genetics for the Novice by Carol Barbee Wait! Don't leave yet. I know that for many breeders any article with the word genetics in the title causes an immediate negative reaction. Either they quickly turn
Sexual Reproduction. The specialized cells that are required for sexual reproduction are known as. And come from the process of: GAMETES
Sexual Reproduction Sexual Reproduction We know all about asexual reproduction 1. Only one parent required. 2. Offspring are identical to parents. 3. The cells that produce the offspring are not usually
Meiosis is a special form of cell division.
Page 1 of 6 KEY CONCEPT Meiosis is a special form of cell division. BEFORE, you learned Mitosis produces two genetically identical cells In sexual reproduction, offspring inherit traits from both parents
DNA Determines Your Appearance!
DNA Determines Your Appearance! Summary DNA contains all the information needed to build your body. Did you know that your DNA determines things such as your eye color, hair color, height, and even the
BioBoot Camp Genetics
BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before
Heredity - Patterns of Inheritance
Heredity - Patterns of Inheritance Genes and Alleles A. Genes 1. A sequence of nucleotides that codes for a special functional product a. Transfer RNA b. Enzyme c. Structural protein d. Pigments 2. Genes
AP: LAB 8: THE CHI-SQUARE TEST. Probability, Random Chance, and Genetics
Ms. Foglia Date AP: LAB 8: THE CHI-SQUARE TEST Probability, Random Chance, and Genetics Why do we study random chance and probability at the beginning of a unit on genetics? Genetics is the study of inheritance,
GCSE BITESIZE Examinations
GCSE BITESIZE Examinations General Certificate of Secondary Education AQA SCIENCE A BLY1B Unit Biology B1b (Evolution and Environment) AQA BIOLOGY Unit Biology B1b (Evolution and Environment) FOUNDATION
Terms: The following terms are presented in this lesson (shown in bold italics and on PowerPoint Slides 2 and 3):
Unit B: Understanding Animal Reproduction Lesson 4: Understanding Genetics Student Learning Objectives: Instruction in this lesson should result in students achieving the following objectives: 1. Explain
LAB : THE CHI-SQUARE TEST. Probability, Random Chance, and Genetics
Period Date LAB : THE CHI-SQUARE TEST Probability, Random Chance, and Genetics Why do we study random chance and probability at the beginning of a unit on genetics? Genetics is the study of inheritance,
B2 5 Inheritrance Genetic Crosses
B2 5 Inheritrance Genetic Crosses 65 minutes 65 marks Page of 55 Q. A woman gives birth to triplets. Two of the triplets are boys and the third is a girl. The triplets developed from two egg cells released
A trait is a variation of a particular character (e.g. color, height). Traits are passed from parents to offspring through genes.
1 Biology Chapter 10 Study Guide Trait A trait is a variation of a particular character (e.g. color, height). Traits are passed from parents to offspring through genes. Genes Genes are located on chromosomes
Chapter 9 Patterns of Inheritance
Bio 100 Patterns of Inheritance 1 Chapter 9 Patterns of Inheritance Modern genetics began with Gregor Mendel s quantitative experiments with pea plants History of Heredity Blending theory of heredity -
1. Why is mitosis alone insufficient for the life cycle of sexually reproducing eukaryotes?
Chapter 13: Meiosis and Sexual Life Cycles 1. Why is mitosis alone insufficient for the life cycle of sexually reproducing eukaryotes? 2. Define: gamete zygote meiosis homologous chromosomes diploid haploid
Problems 1-6: In tomato fruit, red flesh color is dominant over yellow flesh color, Use R for the Red allele and r for the yellow allele.
Genetics Problems Name ANSWER KEY Problems 1-6: In tomato fruit, red flesh color is dominant over yellow flesh color, Use R for the Red allele and r for the yellow allele. 1. What would be the genotype
Respiration occurs in the mitochondria in cells.
B3 Question Which process occurs in the mitochondria in cells? Why do the liver and muscle cells have large number of mitochondria? What is the function of the ribosomes? Answer Respiration occurs in the
MCAS Biology. Review Packet
MCAS Biology Review Packet 1 Name Class Date 1. Define organic. THE CHEMISTRY OF LIFE 2. All living things are made up of 6 essential elements: SPONCH. Name the six elements of life. S N P C O H 3. Elements
Genetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
CCR Biology - Chapter 7 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 7 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. A person who has a disorder caused
Biology Final Exam Study Guide: Semester 2
Biology Final Exam Study Guide: Semester 2 Questions 1. Scientific method: What does each of these entail? Investigation and Experimentation Problem Hypothesis Methods Results/Data Discussion/Conclusion
Genetics Part 1: Inheritance of Traits
Genetics Part 1: Inheritance of Traits Genetics is the study of how traits are passed from parents to offspring. Offspring usually show some traits of each parent. For a long time, scientists did not understand
Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA
Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns
Make a model DNA strand
Make a model DNA strand Summary A strand of DNA looks like a ladder that has been twisted into a corkscrew. Just like a ladder, a DNA strand has two rails running parallel to each other and rungs that
Baby Lab. Class Copy. Introduction
Class Copy Baby Lab Introduction The traits on the following pages are believed to be inherited in the explained manner. Most of the traits, however, in this activity were created to illustrate how human
Teacher Guide: Have Your DNA and Eat It Too ACTIVITY OVERVIEW. http://gslc.genetics.utah.edu
ACTIVITY OVERVIEW Abstract: Students build an edible model of DNA while learning basic DNA structure and the rules of base pairing. Module: The Basics and Beyond Prior Knowledge Needed: DNA contains heritable
Biology 1406 Exam 4 Notes Cell Division and Genetics Ch. 8, 9
Biology 1406 Exam 4 Notes Cell Division and Genetics Ch. 8, 9 Ch. 8 Cell Division Cells divide to produce new cells must pass genetic information to new cells - What process of DNA allows this? Two types
Human Blood Types: Codominance and Multiple Alleles. Codominance: both alleles in the heterozygous genotype express themselves fully
Human Blood Types: Codominance and Multiple Alleles Codominance: both alleles in the heterozygous genotype express themselves fully Multiple alleles: three or more alleles for a trait are found in the
Junior s Family Tree Inherited Traits of Animals
Junior s Family Tree Inherited Traits of Animals Objectives 1. Students will understand genetic make-up is received from both parents and is expressed by traits that can be predicted. 2. Students will
XII. Biology, Grade 10
XII. Biology, Grade 10 Grade 10 Biology Pilot Test The spring 2004 Grade 10 MCAS Biology Test was based on learning standards in the Biology content strand of the Massachusetts Science and Technology/Engineering
Science 10-Biology Activity 14 Worksheet on Sexual Reproduction
Science 10-Biology Activity 14 Worksheet on Sexual Reproduction 10 Name Due Date Show Me NOTE: This worksheet is based on material from pages 367-372 in Science Probe. 1. Sexual reproduction requires parents,
Genetics Lecture Notes 7.03 2005. Lectures 1 2
Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several
MCB41: Second Midterm Spring 2009
MCB41: Second Midterm Spring 2009 Before you start, print your name and student identification number (S.I.D) at the top of each page. There are 7 pages including this page. You will have 50 minutes for
Summary. 16 1 Genes and Variation. 16 2 Evolution as Genetic Change. Name Class Date
Chapter 16 Summary Evolution of Populations 16 1 Genes and Variation Darwin s original ideas can now be understood in genetic terms. Beginning with variation, we now know that traits are controlled by
Reproductive System & Development: Practice Questions #1
Reproductive System & Development: Practice Questions #1 1. Which two glands in the diagram produce gametes? A. glands A and B B. glands B and E C. glands C and F D. glands E and F 2. Base your answer
Name: 4. A typical phenotypic ratio for a dihybrid cross is a) 9:1 b) 3:4 c) 9:3:3:1 d) 1:2:1:2:1 e) 6:3:3:6
Name: Multiple-choice section Choose the answer which best completes each of the following statements or answers the following questions and so make your tutor happy! 1. Which of the following conclusions
Bob Jesberg. Boston, MA April 3, 2014
DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double
Cell Division Simulation: Bacteria Activity One
Cell Division Simulation: Bacteria Activity One Introduction All living things are made of cells. Some living things, like plants and animals, are made of millions of cells. But some living things are
This fact sheet describes how genes affect our health when they follow a well understood pattern of genetic inheritance known as autosomal recessive.
11111 This fact sheet describes how genes affect our health when they follow a well understood pattern of genetic inheritance known as autosomal recessive. In summary Genes contain the instructions for
Biological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
DNA Paper Model Activity Level: Grade 6-8
Karen Mayes DNA Paper Model Activity Level: Grade 6-8 Students will be able to: 1. Identify the component molecules of DNA. 2. Construct a model of the DNA double-helix. 3. Identify which bases are found
Basic Concepts Recombinant DNA Use with Chapter 13, Section 13.2
Name Date lass Master 19 Basic oncepts Recombinant DN Use with hapter, Section.2 Formation of Recombinant DN ut leavage Splicing opyright lencoe/mcraw-hill, a division of he Mcraw-Hill ompanies, Inc. Bacterial
FAQs: Gene drives - - What is a gene drive?
FAQs: Gene drives - - What is a gene drive? During normal sexual reproduction, each of the two versions of a given gene has a 50 percent chance of being inherited by a particular offspring (Fig 1A). Gene
7A The Origin of Modern Genetics
Life Science Chapter 7 Genetics of Organisms 7A The Origin of Modern Genetics Genetics the study of inheritance (the study of how traits are inherited through the interactions of alleles) Heredity: the
Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
CHROMOSOME STRUCTURE CHROMOSOME NUMBERS
CHROMOSOME STRUCTURE 1. During nuclear division, the DNA (as chromatin) in a Eukaryotic cell's nucleus is coiled into very tight compact structures called chromosomes. These are rod-shaped structures made
Today you will extract DNA from some of your cells and learn more about DNA. Extracting DNA from Your Cells
DNA Based on and adapted from the Genetic Science Learning Center s How to Extract DNA from Any Living Thing (http://learn.genetics.utah.edu/units/activities/extraction/) and BioRad s Genes in a bottle
Chapter 3. Cell Division. Laboratory Activities Activity 3.1: Mock Mitosis Activity 3.2: Mitosis in Onion Cells Activity 3.
Chapter 3 Cell Division Laboratory Activities Activity 3.1: Mock Mitosis Activity 3.2: Mitosis in Onion Cells Activity 3.3: Mock Meiosis Goals Following this exercise students should be able to Recognize
Workshop: Cellular Reproduction via Mitosis & Meiosis
Workshop: Cellular Reproduction via Mitosis & Meiosis Introduction In this workshop you will examine how cells divide, including how they partition their genetic material (DNA) between the two resulting
Grade 5 Standard 5 Unit Test Heredity. 1. In what way will a kitten always be like its parents? The kitten will...
Grade 5 Standard 5 Unit Test Heredity Multiple Choice 1. In what way will a kitten always be like its parents? The kitten will... A. be the same color. B. learn the same things. C. have the same body structures.
Reebops. A model organism for teaching genetic concepts
A model organism for teaching genetic concepts The activity helps to demonstrate how genetics is responsible both for similarities and variation among members of the same species. are imaginary organisms
www.njctl.org PSI Biology Mitosis & Meiosis
Mitosis and Meiosis Mitosis Classwork 1. Identify two differences between meiosis and mitosis. 2. Provide an example of a type of cell in the human body that would undergo mitosis. 3. Does cell division
Name: Class: Date: ID: A
Name: Class: _ Date: _ Meiosis Quiz 1. (1 point) A kidney cell is an example of which type of cell? a. sex cell b. germ cell c. somatic cell d. haploid cell 2. (1 point) How many chromosomes are in a human
Amazing DNA facts. Hands-on DNA: A Question of Taste Amazing facts and quiz questions
Amazing DNA facts These facts can form the basis of a quiz (for example, how many base pairs are there in the human genome?). Students should be familiar with most of this material, so the quiz could be
1.5 page 3 DNA Replication S. Preston 1
AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 3 l. DNA Replication 1. Go through PowerPoint 2. Read notes p2 and then watch the animation
Reproductive System. from the Human Body System Series. catalog # 3322. Published & Distributed by AGC/UNITED LEARNING
Reproductive System from the Human Body System Series catalog # 3322 Published & Distributed by AGC/UNITED LEARNING 1560 Sherman Avenue Suite 100 Evanston, IL 60201 1-800-323-9084 24-Hour Fax No. 847-328-6706
An Overview of Cells and Cell Research
An Overview of Cells and Cell Research 1 An Overview of Cells and Cell Research Chapter Outline Model Species and Cell types Cell components Tools of Cell Biology Model Species E. Coli: simplest organism
CHROMOSOMES AND INHERITANCE
SECTION 12-1 REVIEW CHROMOSOMES AND INHERITANCE VOCABULARY REVIEW Distinguish between the terms in each of the following pairs of terms. 1. sex chromosome, autosome 2. germ-cell mutation, somatic-cell
Practice Questions 1: Evolution
Practice Questions 1: Evolution 1. Which concept is best illustrated in the flowchart below? A. natural selection B. genetic manipulation C. dynamic equilibrium D. material cycles 2. The diagram below
Genetic Mutations. Indicator 4.8: Compare the consequences of mutations in body cells with those in gametes.
Genetic Mutations Indicator 4.8: Compare the consequences of mutations in body cells with those in gametes. Agenda Warm UP: What is a mutation? Body cell? Gamete? Notes on Mutations Karyotype Web Activity
somatic cell egg genotype gamete polar body phenotype homologous chromosome trait dominant autosome genetics recessive
CHAPTER 6 MEIOSIS AND MENDEL Vocabulary Practice somatic cell egg genotype gamete polar body phenotype homologous chromosome trait dominant autosome genetics recessive CHAPTER 6 Meiosis and Mendel sex
PRACTICE PROBLEMS - PEDIGREES AND PROBABILITIES
PRACTICE PROBLEMS - PEDIGREES AND PROBABILITIES 1. Margaret has just learned that she has adult polycystic kidney disease. Her mother also has the disease, as did her maternal grandfather and his younger
Mendelian Genetics in Drosophila
Mendelian Genetics in Drosophila Lab objectives: 1) To familiarize you with an important research model organism,! Drosophila melanogaster. 2) Introduce you to normal "wild type" and various mutant phenotypes.
Lecture 7 Mitosis & Meiosis
Lecture 7 Mitosis & Meiosis Cell Division Essential for body growth and tissue repair Interphase G 1 phase Primary cell growth phase S phase DNA replication G 2 phase Microtubule synthesis Mitosis Nuclear
BioSci 2200 General Genetics Problem Set 1 Answer Key Introduction and Mitosis/ Meiosis
BioSci 2200 General Genetics Problem Set 1 Answer Key Introduction and Mitosis/ Meiosis Introduction - Fields of Genetics To answer the following question, review the three traditional subdivisions of
Chromosomes, Mapping, and the Meiosis Inheritance Connection
Chromosomes, Mapping, and the Meiosis Inheritance Connection Carl Correns 1900 Chapter 13 First suggests central role for chromosomes Rediscovery of Mendel s work Walter Sutton 1902 Chromosomal theory
The correct answer is c A. Answer a is incorrect. The white-eye gene must be recessive since heterozygous females have red eyes.
1. Why is the white-eye phenotype always observed in males carrying the white-eye allele? a. Because the trait is dominant b. Because the trait is recessive c. Because the allele is located on the X chromosome
LAB 8 EUKARYOTIC CELL DIVISION: MITOSIS AND MEIOSIS
LAB 8 EUKARYOTIC CELL DIVISION: MITOSIS AND MEIOSIS Los Angeles Mission College Biology 3 Name: Date: INTRODUCTION BINARY FISSION: Prokaryotic cells (bacteria) reproduce asexually by binary fission. Bacterial
Worksheet - COMPARATIVE MAPPING 1
Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that
Scheme of work Cambridge IGCSE Biology (0610)
Scheme of work Cambridge IGCSE Biology (0610) Unit 8: Inheritance and evolution Recommended prior knowledge Basic knowledge of Unit 1 cell structure is required, and also an understanding of the processes
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
IDENTIFICATION OF ORGANISMS
reflect Take a look at the pictures on the right. Think about what the two organisms have in common. They both need food and water to survive. They both grow and reproduce. They both have similar body
Cell Growth and Reproduction Module B, Anchor 1
Cell Growth and Reproduction Module B, Anchor 1 Key Concepts: - The larger a cell becomes, the more demands the cell places on its DNA. In addition, a larger cell is less efficient in moving nutrients
14.3 Studying the Human Genome
14.3 Studying the Human Genome Lesson Objectives Summarize the methods of DNA analysis. State the goals of the Human Genome Project and explain what we have learned so far. Lesson Summary Manipulating
Biology 1406 - Notes for exam 5 - Population genetics Ch 13, 14, 15
Biology 1406 - Notes for exam 5 - Population genetics Ch 13, 14, 15 Species - group of individuals that are capable of interbreeding and producing fertile offspring; genetically similar 13.7, 14.2 Population
A and B are not absolutely linked. They could be far enough apart on the chromosome that they assort independently.
Name Section 7.014 Problem Set 5 Please print out this problem set and record your answers on the printed copy. Answers to this problem set are to be turned in to the box outside 68-120 by 5:00pm on Friday
Biology 3A Laboratory MITOSIS Asexual Reproduction
Biology 3A Laboratory MITOSIS Asexual Reproduction OBJECTIVE To study the cell cycle and understand how, when and why cells divide. To study and identify the major stages of cell division. To relate the
Phonics. High Frequency Words P.008. Objective The student will read high frequency words.
P.008 Jumping Words Objective The student will read high frequency words. Materials High frequency words (P.HFW.005 - P.HFW.064) Choose target words. Checkerboard and checkers (Activity Master P.008.AM1a
Worksheet: The theory of natural selection
Worksheet: The theory of natural selection Senior Phase Grade 7-9 Learning area: Natural Science Strand: Life and living Theme: Biodiversity, change and continuity Specific Aim 1: Acquiring knowledge of
Teacher Guide: Traits Bingo ACTIVITY OVERVIEW. http://gslc.genetics.utah.edu
ACTIVITY OVERVIEW Abstract: In this bingo game students cross off or color bingo squares in response to questions about their traits. This activity is designed to be used as a review following An Inventory
Cells & Cell Organelles
Cells & Cell Organelles The Building Blocks of Life H Biology Types of cells bacteria cells Prokaryote - no organelles Eukaryotes - organelles animal cells plant cells Cell size comparison Animal cell
GENETIC CROSSES. Monohybrid Crosses
GENETIC CROSSES Monohybrid Crosses Objectives Explain the difference between genotype and phenotype Explain the difference between homozygous and heterozygous Explain how probability is used to predict
Process 3.5. A Pour it down the sink. B Pour it back into its original container. C Dispose of it as directed by his teacher.
Process 3.5 Biology EOI sample test questions Objective numbers correspond to the State Priority Academic Student Skills (PASS) standards and objectives. This number is also referenced with the local objective
edtpa: Task 1 Secondary Science
PART A - About the School Where You Are Teaching a. In what type of school do you teach? Middle School: High School: High School 9-12 Other (please describe): Urban: Suburban: Suburban school setting Rural:
PLANT EVOLUTION DISPLAY Handout
PLANT EVOLUTION DISPLAY Handout Name: TA and Section time Welcome to UCSC Greenhouses. This sheet explains a few botanical facts about plant reproduction that will help you through the display and handout.
(D) 181-183, 186-187, 190-193 TFYI 187 TPK 190
NEVADA Life Science Content Standards for Grade 8 Life s Structure and Function A From Bacteria to Plants B Animal Diversity C Human Body Systems D OBJECTIVES Content Standard 6.0: Structure and Function
PUSD High Frequency Word List
PUSD High Frequency Word List For Reading and Spelling Grades K-5 High Frequency or instant words are important because: 1. You can t read a sentence or a paragraph without knowing at least the most common.
Chapter 12: The Cell Cycle
Name Period Chapter 12: The Cell Cycle Overview: 1. What are the three key roles of cell division? State each role, and give an example. Key Role Example 2. What is meant by the cell cycle? Concept 12.1
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
