T cell Epitope Prediction

Size: px
Start display at page:

Download "T cell Epitope Prediction"

Transcription

1 Institute for Immunology and Informatics T cell Epitope Prediction EpiMatrix Eric Gustafson January 6, 2011

2 Overview Gathering raw data Popular sources Data Management Conservation Analysis Multiple Alignments / Consensus Sequences Conservatrix Screening for putative T cell epitopes (EpiMatrix) MHC Class I and II Searching for homology Human genome / Other pathogens (GenBank) Vaccine Design Concepts Immunogenic Consensus String of beads

3 MHC/Ligand Interactions Binding is mediated by the interaction of the candidate peptides side chains with specific regions in the floor of the MHC binding groove.

4 MHC/Ligand Interactions The binding groove of both Class I and Class II can be divided into 9 such regions In the case of Class I MHC, the binding groove is closed-ended and can accommodate peptides between 8 and about 11 amino acids in length, although 9-mer and 10-mer peptides are preferred. In the case of Class II MHC the binding groove is open ended. Class II MHC can accommodate longer peptides, typically amino acids in length.

5 How does in silico mapping work? Th cell epitopes are linear and restricted by MHC (HLA). Mature APC MHC Peptide Epitope Because the pockets of the HLA are well known, interactions with peptides can be modeled. The EpiMatrix algorithm scores all the 9 mers in a given sequence for binding affinity across a range of common HLA and reports both detailed and aggregated results.

6 Constructing the matrix Early researchers eluted, sequenced, and aligned peptides bound to MHC They (Falk et al.) discovered that certain amino acids appeared in certain positions more often than others. This information was used to develop rudimentary binding motifs Falk, K., Rötzschke, O., Stevanovic, S., Jung, G. and Rammensee, H. G. Allele specific motifs revealed by sequencing of self peptides eluted from MHC molecules. Nature 1991, 351,

7 Other methods As additional training data became available, many statistically based techniques where used to model the data: Frequency Analysis Hidden Markov Models (HMM) Support Vector Machines (SVM) Stabilization Matrix Methods (SMM) Random Forests Naive Bayesian Analysis

8 How EpiMatrix Scores Amino Acid graphical representation of A*0201 motif (based on list of actual peptides from Chicz) Graphical Representation of A*0201 Coefficient matrix A L L A C D E F G H I K L M N N P Q R S S T T V V W Y Y Y Position S+L+Y+N+V+A+T+Y+L = indication of binding likelihood

9 Comparing scores on a standard scale Predictive matrices are benchmarked against a randomly generated standard curve Random peptides True epitopes DRB1*0101 DRB1*0102 DRB1*0301 DRB1*0401 DRB1*0402 DRB1*0404 DRB1*0405 DRB1*0701 DRB1*0801 DRB1*1101 DRB1*1104 DRB1*1301 DRB1*1302 DRB1*1501 DRB1*1502 DRB5*0101 RANDOM TOTAL

10 HLA Coverage EpiMatrix tests binding to the most common supertype HLA molecules Our results represent >90% of the human populations worldwide No individual haplotype testing necessary Southwood et al., 1998

11 item individualized T cell epitope measure A method for predicting immunogenicity of protein vaccines and biologic therapeutics based on an individual s HLA type item = Sum of the Significant Scores the Expected score for a protein of that length Number of frames = 13 Expected frequency of the hits = 0.05 Expected value for a hit = 2.06 Cohen et al., 2008

12 EpiMatrix: Class I Analysis

13 EpiMatrix: Class I Standard Analysis

14 EpiMatrix Results Current File: SAMPLE Current Sequence: SAMPLE_01 Top 10% of Z Scores Top 5% of Z Scores Top 1% of Z Scores All Z Scores In Top 5% are Considered "Hits" Matrix: KB_A0101_09 KB_A0201_09 KB_A0301_09 KB_A2402_09 KB_B0702_09 KB_B4403_09 Hit Average AA Sequence AA Start GRAVY Z Score Z Score Z Score Z Score Z Score Z Score Count Z Score MGARASVLT GARASVLTG ARASVLTGS RASVLTGSK ASVLTGSKL SVLTGSKLD VLTGSKLDA LTGSKLDAW TGSKLDAWE GSKLDAWEQ SKLDAWEQI KLDAWEQIR LDAWEQIRL DAWEQIRLK AWEQIRLKP WEQIRLKPG EQIRLKPGC QIRLKPGCK IRLKPGCKK RLKPGCKKK LKPGCKKKY KPGCKKKYR PGCKKKYRL GCKKKYRLK PFASLKSLF FASLKSLFG ASLKSLFGT SLKSLFGTD LKSLFGTDQ Maximum Sum of Significant Z Hit Count Total Assesments: 2952 Total Significant Z: Expected Z: Deviation: 75.8 Deviation per 1000: 14.36

15 EpiMatrix: Class I Extended Analysis

16 EpiMatrix: Class II Standard Analysis

17 EpiMatrix: Class II Standard Analysis

18 EpiMatrix: Class II Standard Analysis

19 ClassII EpiMatrix Report File: FLU-HA - Sequence: PROVIDENCE-2012 September 29, 2010 (Epx Ver. 1.2) Click to Print Click to Download Frame Frame DRB1*0101 DRB1*0301 DRB1*0401 DRB1*0701 DRB1*0801 DRB1*1101 DRB1*1301 DRB1*1501 AA Sequence Start Stop Z-Score Z-Score Z-Score Z-Score Z-Score Z-Score Z-Score Z-Score Hits 1 QKLPGNRNS KLPGNRNST LPGNRNSTA PGNRNSTAT GNRNSTATL NRNSTATLC RYVKQNTLK YVKQNTLKL VKQNTLKLA KQNTLKLAT QNTLKLATG NTLKLATGM TLKLATGMR LKLATGMRN KLATGMRNV LATGMRNVP ATGMRNVPK TGMRNVPKK GMRNVPKKQ MRNVPKKQT RNVPKKQTR Summarized Results DRB1*0101 DRB1*0301 DRB1*0401 DRB1*0701 DRB1*0801 DRB1*1101 DRB1*1301 DRB1*1501 Total Maximum Single Z score Sum of Significant Z scores Count of Significant Z Scores Total Assessments Performed: 2568 Deviation from Expectation: Deviation per 1000 AA: Adjusted for Regulatory Epitopes Deviation from Expectation: Deviation per 1000 AA: 89.24

20 EpiMatrix: Class II Standard Analysis

21 PROVIDENCE 2012 (89.24)

22 EpiMatrix: Class II Extended Analysis

23 EpiMatrix: Class II Standard Analysis

24 ClustiMer identifies T cell Epitopes Epitopes Tend to Cluster T cell epitopes cluster within protein sequences One or more dominant T cell epitope clusters can enable significant immune responses to even otherwise low scoring proteins DRB1*0101 DRB1*0301 DRB1*0401 DRB1*0701 DRB1*0801 DRB1*1101 DRB1*1301 DRB1*1501 T cell epitope clusters make excellent vaccine candidates: Compact Easy to deliver as peptides Highly reactive in vivo

25 Finding Class II Clusters

26 Finding Class II Clusters

27 Interactive Class II Cluster Report

28 Class II Cluster Detail Report EpiMatrix Cluster Detail Report File: FLU-HA Sequence: PROVIDENCE-2012 Cluster: 76 September 29, 2010 (Epx Ver. 1.2) Click to Print Click to Download Back to Cluster Summary Frame Frame Hydrophobicity Z-Score Z-Score Z-Score Z-Score Z-Score Z-Score Z-Score Z-Score DRB1*0101 DRB1*0301 DRB1*0401 DRB1*0701 DRB1*0801 DRB1*1101 DRB1*1301 DRB1*1501 AA Sequence Start Stop Hits 76 CRSFQNKKW RSFQNKKWR SFQNKKWRL FQNKKWRLF QNKKWRLFV NKKWRLFVK KKWRLFVKR KWRLFVKRS WRLFVKRSK RLFVKRSKA LFVKRSKAY FVKRSKAYS VKRSKAYSN KRSKAYSNC RSKAYSNCY SKAYSNCYP Summarized Results DRB1*0101 DRB1*0301 DRB1*0401 DRB1*0701 DRB1*0801 DRB1*1101 DRB1*1301 DRB1*1501 Total Maximum Single Z score Sum of Significant Z scores Count of Significant Z Scores Total Assessments Performed: 128 Hydrophobicity:-1.11 EpiMatrix Score: EpiMatrix Score (w/o flanks): 31.98

29 Interactive Class II Cluster Report

30 Class II Cluster Scale

31 Interactive Class II Cluster Report

32 Class II Logo Report

Detection of T-cell T and their application to vaccine design

Detection of T-cell T and their application to vaccine design QuickTime and a TIFF (Uncompressed) decompressor are needed to see this picture Detection of T-cell T epitopes and their application to vaccine design EpiVax Inc. 16 Bassett Street Providence Rhode Island

More information

Integrating DNA Motif Discovery and Genome-Wide Expression Analysis. Erin M. Conlon

Integrating DNA Motif Discovery and Genome-Wide Expression Analysis. Erin M. Conlon Integrating DNA Motif Discovery and Genome-Wide Expression Analysis Department of Mathematics and Statistics University of Massachusetts Amherst Statistics in Functional Genomics Workshop Ascona, Switzerland

More information

PEPVAC: a web server for multi-epitope vaccine development based on the prediction of supertypic MHC ligands

PEPVAC: a web server for multi-epitope vaccine development based on the prediction of supertypic MHC ligands W138 W142 doi:10.1093/nar/gki357 PEPVAC: a web server for multi-epitope vaccine development based on the prediction of supertypic MHC ligands Pedro A. Reche 1,2, * and Ellis L. Reinherz 1,2 1 Laboratory

More information

Current Motif Discovery Tools and their Limitations

Current Motif Discovery Tools and their Limitations Current Motif Discovery Tools and their Limitations Philipp Bucher SIB / CIG Workshop 3 October 2006 Trendy Concepts and Hypotheses Transcription regulatory elements act in a context-dependent manner.

More information

Identifying cytotoxic T cell epitopes from genomic and proteomic information: A. Fomsgaard. The human MHC project

Identifying cytotoxic T cell epitopes from genomic and proteomic information: A. Fomsgaard. The human MHC project 1 IMMU993481 P348 28-06-01 15:34:30 Lg/disk / a200348/rig0o4-8 S.L. Lauemøller C. Kesmir S.L. Corbet Identifying cytotoxic T cell epitopes from genomic and proteomic information: A. Fomsgaard The human

More information

Hapten - a small molecule that is antigenic but not (by itself) immunogenic.

Hapten - a small molecule that is antigenic but not (by itself) immunogenic. Chapter 3. Antigens Terminology: Antigen: Substances that can be recognized by the surface antibody (B cells) or by the TCR (T cells) when associated with MHC molecules Immunogenicity VS Antigenicity:

More information

Web Based Tools and Databases for Epitope Prediction and Analysis: A Contextual Review

Web Based Tools and Databases for Epitope Prediction and Analysis: A Contextual Review International Journal of Computational Bioinformatics and In Silico Modeling Vol. 2, No. 4 (2013): 180-185 Review Article Open Access ISSN: 2320-0634 Web Based Tools and Databases for Epitope Prediction

More information

Learning from Diversity

Learning from Diversity Learning from Diversity Epitope Prediction with Sequence and Structure Features using an Ensemble of Support Vector Machines Rob Patro and Carl Kingsford Center for Bioinformatics and Computational Biology

More information

Modelling and analysis of T-cell epitope screening data.

Modelling and analysis of T-cell epitope screening data. Modelling and analysis of T-cell epitope screening data. Tim Beißbarth 2, Jason A. Tye-Din 1, Gordon K. Smyth 1, Robert P. Anderson 1 and Terence P. Speed 1 1 WEHI, 1G Royal Parade, Parkville, VIC 3050,

More information

GenBank, Entrez, & FASTA

GenBank, Entrez, & FASTA GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,

More information

Lecture/Recitation Topic SMA 5303 L1 Sampling and statistical distributions

Lecture/Recitation Topic SMA 5303 L1 Sampling and statistical distributions SMA 50: Statistical Learning and Data Mining in Bioinformatics (also listed as 5.077: Statistical Learning and Data Mining ()) Spring Term (Feb May 200) Faculty: Professor Roy Welsch Wed 0 Feb 7:00-8:0

More information

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

High Resolution Epitope Mapping of Human Autoimmune Sera against Antigens CENPA and KDM6B. PEPperPRINT GmbH Heidelberg, 06/2014

High Resolution Epitope Mapping of Human Autoimmune Sera against Antigens CENPA and KDM6B. PEPperPRINT GmbH Heidelberg, 06/2014 High Resolution Epitope Mapping of Human Autoimmune Sera against Antigens CENPA and KDM6B PEPperPRINT GmbH Heidelberg, 06/2014 Introduction This report describes the epitope mapping of autoimmune sera

More information

Antibody responses to linear and conformational epitopes

Antibody responses to linear and conformational epitopes Antibody responses to linear and conformational epitopes PhD course: Biological Sequence Analysis 30.05.2008 Pernille Andersen Outline Antibodies and B-cell epitopes Classification of B-cell epitopes Prediction

More information

Interaktionen von Nukleinsäuren und Proteinen

Interaktionen von Nukleinsäuren und Proteinen Sonja Prohaska Computational EvoDevo Universitaet Leipzig June 9, 2015 DNA is never naked in a cell DNA is usually in association with proteins. In all domains of life there are small, basic chromosomal

More information

Analysis of the adaptive immune response to West Nile virus

Analysis of the adaptive immune response to West Nile virus Analysis of the adaptive immune response to West Nile virus Jonathan Bramson (PI) Robin Parsons Alina Lelic Galina Denisova Lesley Latham Carole Evelegh Dmitri Denisov Strategy for characterizing T cell

More information

MORPHEUS. http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix.

MORPHEUS. http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix. MORPHEUS http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix. Reference: MORPHEUS, a Webtool for Transcripton Factor Binding Analysis Using

More information

PEPVAC: A web server for multi-epitope vaccine development based on the prediction of supertypic

PEPVAC: A web server for multi-epitope vaccine development based on the prediction of supertypic PEPVAC: A web server for multi-epitope vaccine development based on the prediction of supertypic MHC ligands Pedro A. Reche and Ellis L. Reinherz Laboratory of Immunobiology and Department of Medical Oncology,

More information

Pep-Miner: A Novel Technology for Mass Spectrometry-Based Proteomics

Pep-Miner: A Novel Technology for Mass Spectrometry-Based Proteomics Pep-Miner: A Novel Technology for Mass Spectrometry-Based Proteomics Ilan Beer Haifa Research Lab Dec 10, 2002 Pep-Miner s Location in the Life Sciences World The post-genome era - the age of proteome

More information

Vaxign Reverse Vaccinology Software Demo Introduction Zhuoshuang Allen Xiang, Yongqun Oliver He

Vaxign Reverse Vaccinology Software Demo Introduction Zhuoshuang Allen Xiang, Yongqun Oliver He Vaxign Reverse Vaccinology Software Demo Introduction Zhuoshuang Allen Xiang, Yongqun Oliver He Unit for Laboratory Animal Medicine Department of Microbiology and Immunology Center for Computational Medicine

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Guide for Bioinformatics Project Module 3

Guide for Bioinformatics Project Module 3 Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first

More information

Population coverage analysis of T-Cell epitopes of Neisseria meningitidis serogroup B from Iron acquisition proteins for vaccine design

Population coverage analysis of T-Cell epitopes of Neisseria meningitidis serogroup B from Iron acquisition proteins for vaccine design www.bioinformation.net Hypothesis Volume 6(7) Population coverage analysis of T-Cell epitopes of Neisseria meningitidis serogroup B from Iron acquisition proteins for vaccine design Namrata Misra 1 *,

More information

CSC 2427: Algorithms for Molecular Biology Spring 2006. Lecture 16 March 10

CSC 2427: Algorithms for Molecular Biology Spring 2006. Lecture 16 March 10 CSC 2427: Algorithms for Molecular Biology Spring 2006 Lecture 16 March 10 Lecturer: Michael Brudno Scribe: Jim Huang 16.1 Overview of proteins Proteins are long chains of amino acids (AA) which are produced

More information

Bio-Informatics Lectures. A Short Introduction

Bio-Informatics Lectures. A Short Introduction Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively

More information

BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16

BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16 Course Director: Dr. Barry Grant (DCM&B, bjgrant@med.umich.edu) Description: This is a three module course covering (1) Foundations of Bioinformatics, (2) Statistics in Bioinformatics, and (3) Systems

More information

Identification of CD4+ T cell epitopes specific for the breast cancer associated antigen NY-BR-1

Identification of CD4+ T cell epitopes specific for the breast cancer associated antigen NY-BR-1 9/8/2015 Identification of CD4+ T cell epitopes specific for the breast cancer associated antigen NY-BR-1 Stefan Eichmüller, PhD GMP & T Cell Therapy Unit, German Cancer Research Center, Heidelberg, Germany

More information

specific B cells Humoral immunity lymphocytes antibodies B cells bone marrow Cell-mediated immunity: T cells antibodies proteins

specific B cells Humoral immunity lymphocytes antibodies B cells bone marrow Cell-mediated immunity: T cells antibodies proteins Adaptive Immunity Chapter 17: Adaptive (specific) Immunity Bio 139 Dr. Amy Rogers Host defenses that are specific to a particular infectious agent Can be innate or genetic for humans as a group: most microbes

More information

Supplementary Information

Supplementary Information Supplementary Information S1: Degree Distribution of TFs in the E.coli TRN and CRN based on Operons 1000 TRN Number of TFs 100 10 y = 619.55x -1.4163 R 2 = 0.8346 1 1 10 100 1000 Degree of TFs CRN 100

More information

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh

More information

Bioinformatics Grid - Enabled Tools For Biologists.

Bioinformatics Grid - Enabled Tools For Biologists. Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis

More information

International Journal of Integrative Biology A journal for biology beyond borders ISSN 0973-8363

International Journal of Integrative Biology A journal for biology beyond borders ISSN 0973-8363 Report International Journal of Integrative Biology A journal for biology beyond borders ISSN 0973-8363 In silico CD4+ T cell epitope mapping and HLA coverage analysis for proteins of human hepatitis E

More information

Biological Sequence Data Formats

Biological Sequence Data Formats Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA

More information

Core Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1

Core Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1 Core Bioinformatics 2014/2015 Code: 42397 ECTS Credits: 12 Degree Type Year Semester 4313473 Bioinformàtica/Bioinformatics OB 0 1 Contact Name: Sònia Casillas Viladerrams Email: Sonia.Casillas@uab.cat

More information

Hidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006

Hidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006 Hidden Markov Models in Bioinformatics By Máthé Zoltán Kőrösi Zoltán 2006 Outline Markov Chain HMM (Hidden Markov Model) Hidden Markov Models in Bioinformatics Gene Finding Gene Finding Model Viterbi algorithm

More information

Engineering Problem Solving and Excel. EGN 1006 Introduction to Engineering

Engineering Problem Solving and Excel. EGN 1006 Introduction to Engineering Engineering Problem Solving and Excel EGN 1006 Introduction to Engineering Mathematical Solution Procedures Commonly Used in Engineering Analysis Data Analysis Techniques (Statistics) Curve Fitting techniques

More information

3.2 Roulette and Markov Chains

3.2 Roulette and Markov Chains 238 CHAPTER 3. DISCRETE DYNAMICAL SYSTEMS WITH MANY VARIABLES 3.2 Roulette and Markov Chains In this section we will be discussing an application of systems of recursion equations called Markov Chains.

More information

Data, Measurements, Features

Data, Measurements, Features Data, Measurements, Features Middle East Technical University Dep. of Computer Engineering 2009 compiled by V. Atalay What do you think of when someone says Data? We might abstract the idea that data are

More information

Learning outcomes. Knowledge and understanding. Competence and skills

Learning outcomes. Knowledge and understanding. Competence and skills Syllabus Master s Programme in Statistics and Data Mining 120 ECTS Credits Aim The rapid growth of databases provides scientists and business people with vast new resources. This programme meets the challenges

More information

MASCOT Search Results Interpretation

MASCOT Search Results Interpretation The Mascot protein identification program (Matrix Science, Ltd.) uses statistical methods to assess the validity of a match. MS/MS data is not ideal. That is, there are unassignable peaks (noise) and usually

More information

Statistics Graduate Courses

Statistics Graduate Courses Statistics Graduate Courses STAT 7002--Topics in Statistics-Biological/Physical/Mathematics (cr.arr.).organized study of selected topics. Subjects and earnable credit may vary from semester to semester.

More information

How To Understand And Solve A Linear Programming Problem

How To Understand And Solve A Linear Programming Problem At the end of the lesson, you should be able to: Chapter 2: Systems of Linear Equations and Matrices: 2.1: Solutions of Linear Systems by the Echelon Method Define linear systems, unique solution, inconsistent,

More information

An Introduction to the Use of Bayesian Network to Analyze Gene Expression Data

An Introduction to the Use of Bayesian Network to Analyze Gene Expression Data n Introduction to the Use of ayesian Network to nalyze Gene Expression Data Cristina Manfredotti Dipartimento di Informatica, Sistemistica e Comunicazione (D.I.S.Co. Università degli Studi Milano-icocca

More information

Chapter 3. Protein Structure and Function

Chapter 3. Protein Structure and Function Chapter 3 Protein Structure and Function Broad functional classes So Proteins have structure and function... Fine! -Why do we care to know more???? Understanding functional architechture gives us POWER

More information

Computational localization of promoters and transcription start sites in mammalian genomes

Computational localization of promoters and transcription start sites in mammalian genomes Computational localization of promoters and transcription start sites in mammalian genomes Thomas Down This dissertation is submitted for the degree of Doctor of Philosophy Wellcome Trust Sanger Institute

More information

Therapeutic Systems Immunology

Therapeutic Systems Immunology Therapeutic Systems Immunology Coordination: Robert Preissner, Charité, Berlin 13 Partners from Berlin (7) Göttingen (1) Heidelberg (1) Rostock (2) Tübingen (1) Overview Intro / Mission Partners Systems

More information

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Focusing on results not data comprehensive data analysis for targeted next generation sequencing Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes

More information

Immune Epitope Database NEWSLETTER Volume 7, Issue 1 http://www.iedb.org March 2010

Immune Epitope Database NEWSLETTER Volume 7, Issue 1 http://www.iedb.org March 2010 Immune Epitope Database NEWSLETTER Volume 7, Issue 1 http://www.iedb.org March 2010 IEBD 2.3 Released January 19 The latest version of the IEDB website was released on January 19. A list of the new features

More information

Autoimmunity and immunemediated. FOCiS. Lecture outline

Autoimmunity and immunemediated. FOCiS. Lecture outline 1 Autoimmunity and immunemediated inflammatory diseases Abul K. Abbas, MD UCSF FOCiS 2 Lecture outline Pathogenesis of autoimmunity: why selftolerance fails Genetics of autoimmune diseases Therapeutic

More information

AP BIOLOGY 2008 SCORING GUIDELINES

AP BIOLOGY 2008 SCORING GUIDELINES AP BIOLOGY 2008 SCORING GUIDELINES Question 1 1. The physical structure of a protein often reflects and affects its function. (a) Describe THREE types of chemical bonds/interactions found in proteins.

More information

Recommender Systems Seminar Topic : Application Tung Do. 28. Januar 2014 TU Darmstadt Thanh Tung Do 1

Recommender Systems Seminar Topic : Application Tung Do. 28. Januar 2014 TU Darmstadt Thanh Tung Do 1 Recommender Systems Seminar Topic : Application Tung Do 28. Januar 2014 TU Darmstadt Thanh Tung Do 1 Agenda Google news personalization : Scalable Online Collaborative Filtering Algorithm, System Components

More information

Guidance for Industry

Guidance for Industry Guidance for Industry Interpreting Sameness of Monoclonal Antibody Products Under the Orphan Drug Regulations U.S. Department of Health and Human Services Food and Drug Administration Center for Drug Evaluation

More information

B Cells and Antibodies

B Cells and Antibodies B Cells and Antibodies Andrew Lichtman, MD PhD Brigham and Women's Hospital Harvard Medical School Lecture outline Functions of antibodies B cell activation; the role of helper T cells in antibody production

More information

UGENE Quick Start Guide

UGENE Quick Start Guide Quick Start Guide This document contains a quick introduction to UGENE. For more detailed information, you can find the UGENE User Manual and other special manuals in project website: http://ugene.unipro.ru.

More information

Data Integration. Lectures 16 & 17. ECS289A, WQ03, Filkov

Data Integration. Lectures 16 & 17. ECS289A, WQ03, Filkov Data Integration Lectures 16 & 17 Lectures Outline Goals for Data Integration Homogeneous data integration time series data (Filkov et al. 2002) Heterogeneous data integration microarray + sequence microarray

More information

CONFORMATIONAL B-CELL EPITOPES CLASSIFICATION USING MACHINE LEARNING TECHNIQUES

CONFORMATIONAL B-CELL EPITOPES CLASSIFICATION USING MACHINE LEARNING TECHNIQUES JOURNAL OF ENGINEERING AND APPLIED SCIENCE, VOL.??, NO.?, AUG. 2011, PP. 327-??? FACULTY OF ENGINEERING, CAIRO UNIVERSITY CONFORMATIONAL B-CELL EPITOPES CLASSIFICATION USING MACHINE LEARNING TECHNIQUES

More information

Disulfide Bonds at the Hair Salon

Disulfide Bonds at the Hair Salon Disulfide Bonds at the Hair Salon Three Alpha Helices Stabilized By Disulfide Bonds! In order for hair to grow 6 inches in one year, 9 1/2 turns of α helix must be produced every second!!! In some proteins,

More information

Lecture 11 Enzymes: Kinetics

Lecture 11 Enzymes: Kinetics Lecture 11 Enzymes: Kinetics Reading: Berg, Tymoczko & Stryer, 6th ed., Chapter 8, pp. 216-225 Key Concepts Kinetics is the study of reaction rates (velocities). Study of enzyme kinetics is useful for

More information

Systems Biology through Data Analysis and Simulation

Systems Biology through Data Analysis and Simulation Biomolecular Networks Initiative Systems Biology through Data Analysis and Simulation William Cannon Computational Biosciences 5/30/03 Cellular Dynamics Microbial Cell Dynamics Data Mining Nitrate NARX

More information

Master's projects at ITMO University. Daniil Chivilikhin PhD Student @ ITMO University

Master's projects at ITMO University. Daniil Chivilikhin PhD Student @ ITMO University Master's projects at ITMO University Daniil Chivilikhin PhD Student @ ITMO University General information Guidance from our lab's researchers Publishable results 2 Research areas Research at ITMO Evolutionary

More information

New HLA class I epitopes defined by murine monoclonal antibodies

New HLA class I epitopes defined by murine monoclonal antibodies Human Immunology 71 (2010) 456 461 Contents lists available at ScienceDirect New HLA class I epitopes defined by murine monoclonal antibodies Nadim El-Awar a, *, Paul I. Terasaki b, Anh Nguyen a, Mamie

More information

THREE DIMENSIONAL REPRESENTATION OF AMINO ACID CHARAC- TERISTICS

THREE DIMENSIONAL REPRESENTATION OF AMINO ACID CHARAC- TERISTICS THREE DIMENSIONAL REPRESENTATION OF AMINO ACID CHARAC- TERISTICS O.U. Sezerman 1, R. Islamaj 2, E. Alpaydin 2 1 Laborotory of Computational Biology, Sabancı University, Istanbul, Turkey. 2 Computer Engineering

More information

IDENTIFICATION OF T-CELL ANTIGENIC DETERMINANTS IN THE PROTEINS OF HUMAN PAPILLOMAVIRUS

IDENTIFICATION OF T-CELL ANTIGENIC DETERMINANTS IN THE PROTEINS OF HUMAN PAPILLOMAVIRUS INTERNATIONAL JOURNAL OF ADVANCED BIOTECHNOLOGY AND BIOINFORMATICS VOL.1, ISSUE.1, November 2012 IDENTIFICATION OF T-CELL ANTIGENIC DETERMINANTS IN THE PROTEINS OF HUMAN PAPILLOMAVIRUS ABSTRACT Dharmendra

More information

PperCHIP. High-Content Peptide Microarrays. Epitope Mapping & Serum Profiling Services

PperCHIP. High-Content Peptide Microarrays. Epitope Mapping & Serum Profiling Services PepperChip High-Content Peptide Microarrays PepperMap Epitope Mapping & Serum Profiling Services PperCHIP access to custom and dard peptide microarrays up to 9,000 features per in a uniquely flexible and

More information

1. Introduction Gene regulation Genomics and genome analyses Hidden markov model (HMM)

1. Introduction Gene regulation Genomics and genome analyses Hidden markov model (HMM) 1. Introduction Gene regulation Genomics and genome analyses Hidden markov model (HMM) 2. Gene regulation tools and methods Regulatory sequences and motif discovery TF binding sites, microrna target prediction

More information

BIOINF 585 Fall 2015 Machine Learning for Systems Biology & Clinical Informatics http://www.ccmb.med.umich.edu/node/1376

BIOINF 585 Fall 2015 Machine Learning for Systems Biology & Clinical Informatics http://www.ccmb.med.umich.edu/node/1376 Course Director: Dr. Kayvan Najarian (DCM&B, kayvan@umich.edu) Lectures: Labs: Mondays and Wednesdays 9:00 AM -10:30 AM Rm. 2065 Palmer Commons Bldg. Wednesdays 10:30 AM 11:30 AM (alternate weeks) Rm.

More information

Pairwise Sequence Alignment

Pairwise Sequence Alignment Pairwise Sequence Alignment carolin.kosiol@vetmeduni.ac.at SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What

More information

Myoglobin and Hemoglobin

Myoglobin and Hemoglobin Myoglobin and Hemoglobin Myoglobin and hemoglobin are hemeproteins whose physiological importance is principally related to their ability to bind molecular oxygen. Myoglobin (Mb) The oxygen storage protein

More information

SGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD

SGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD White Paper SGI High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems Haruna Cofer*, PhD January, 2012 Abstract The SGI High Throughput Computing (HTC) Wrapper

More information

Antibody Structure, and the Generation of B-cell Diversity CHAPTER 4 04/05/15. Different Immunoglobulins

Antibody Structure, and the Generation of B-cell Diversity CHAPTER 4 04/05/15. Different Immunoglobulins Antibody Structure, and the Generation of B-cell Diversity B cells recognize their antigen without needing an antigen presenting cell CHAPTER 4 Structure of Immunoglobulin G Different Immunoglobulins Differences

More information

Recognition of T cell epitopes (Abbas Chapter 6)

Recognition of T cell epitopes (Abbas Chapter 6) Recognition of T cell epitopes (Abbas Chapter 6) Functions of different APCs (Abbas Chapter 6)!!! Directon Routes of antigen entry (Abbas Chapter 6) Flow of Information Barrier APCs LNs Sequence of Events

More information

Lecture 19: Proteins, Primary Struture

Lecture 19: Proteins, Primary Struture CPS260/BGT204.1 Algorithms in Computational Biology November 04, 2003 Lecture 19: Proteins, Primary Struture Lecturer: Pankaj K. Agarwal Scribe: Qiuhua Liu 19.1 The Building Blocks of Protein [1] Proteins

More information

Making the switch to a safer CAR-T cell therapy

Making the switch to a safer CAR-T cell therapy Making the switch to a safer CAR-T cell therapy HaemaLogiX 2015 Technical Journal Club May 24 th 2016 Christina Müller - chimeric antigen receptor = CAR - CAR T cells are generated by lentiviral transduction

More information

Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011

Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011 Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear

More information

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want 1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very

More information

CHAPTER 8 IMMUNOLOGICAL IMPLICATIONS OF PEPTIDE CARBOHYDRATE MIMICRY

CHAPTER 8 IMMUNOLOGICAL IMPLICATIONS OF PEPTIDE CARBOHYDRATE MIMICRY CHAPTER 8 IMMUNOLOGICAL IMPLICATIONS OF PEPTIDE CARBOHYDRATE MIMICRY Immunological Implications of Peptide-Carbohydrate Mimicry 8.1 Introduction The two chemically dissimilar molecules, a peptide (12mer)

More information

Helices From Readily in Biological Structures

Helices From Readily in Biological Structures The α Helix and the β Sheet Are Common Folding Patterns Although the overall conformation each protein is unique, there are only two different folding patterns are present in all proteins, which are α

More information

Interaktionen von RNAs und Proteinen

Interaktionen von RNAs und Proteinen Sonja Prohaska Computational EvoDevo Universitaet Leipzig June 9, 2015 Studying RNA-protein interactions Given: target protein known to bind to RNA problem: find binding partners and binding sites experimental

More information

Introduction to Genome Annotation

Introduction to Genome Annotation Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT

More information

BLAST. Anders Gorm Pedersen & Rasmus Wernersson

BLAST. Anders Gorm Pedersen & Rasmus Wernersson BLAST Anders Gorm Pedersen & Rasmus Wernersson Database searching Using pairwise alignments to search databases for similar sequences Query sequence Database Database searching Most common use of pairwise

More information

SUPPLEMENTARY METHODS

SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS Description of parameter selection for the automated calling algorithm The first analyses of the HLA data were performed with the haploid cell lines described by Horton et al. (1).

More information

Error Tolerant Searching of Uninterpreted MS/MS Data

Error Tolerant Searching of Uninterpreted MS/MS Data Error Tolerant Searching of Uninterpreted MS/MS Data 1 In any search of a large LC-MS/MS dataset 2 There are always a number of spectra which get poor scores, or even no match at all. 3 Sometimes, this

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

Protein & DNA Sequence Analysis. Bobbie-Jo Webb-Robertson May 3, 2004

Protein & DNA Sequence Analysis. Bobbie-Jo Webb-Robertson May 3, 2004 Protein & DNA Sequence Analysis Bobbie-Jo Webb-Robertson May 3, 2004 Sequence Analysis Anything connected to identifying higher biological meaning out of raw sequence data. 2 Genomic & Proteomic Data Sequence

More information

MultiQuant Software 2.0 for Targeted Protein / Peptide Quantification

MultiQuant Software 2.0 for Targeted Protein / Peptide Quantification MultiQuant Software 2.0 for Targeted Protein / Peptide Quantification Gold Standard for Quantitative Data Processing Because of the sensitivity, selectivity, speed and throughput at which MRM assays can

More information

Identification of CD8 + T Cell Epitopes in the West Nile Virus Polyprotein by Reverse-Immunology Using NetCTL

Identification of CD8 + T Cell Epitopes in the West Nile Virus Polyprotein by Reverse-Immunology Using NetCTL Identification of CD8 + T Cell Epitopes in the West Nile Virus Polyprotein by Reverse-Immunology Using NetCTL Mette Voldby Larsen 1 *, Alina Lelic 2, Robin Parsons 2, Morten Nielsen 1, Ilka Hoof 1, Kasper

More information

Searching Nucleotide Databases

Searching Nucleotide Databases Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames

More information

Using MATLAB: Bioinformatics Toolbox for Life Sciences

Using MATLAB: Bioinformatics Toolbox for Life Sciences Using MATLAB: Bioinformatics Toolbox for Life Sciences MR. SARAWUT WONGPHAYAK BIOINFORMATICS PROGRAM, SCHOOL OF BIORESOURCES AND TECHNOLOGY, AND SCHOOL OF INFORMATION TECHNOLOGY, KING MONGKUT S UNIVERSITY

More information

RNA Structure and folding

RNA Structure and folding RNA Structure and folding Overview: The main functional biomolecules in cells are polymers DNA, RNA and proteins For RNA and Proteins, the specific sequence of the polymer dictates its final structure

More information

Classification of Bad Accounts in Credit Card Industry

Classification of Bad Accounts in Credit Card Industry Classification of Bad Accounts in Credit Card Industry Chengwei Yuan December 12, 2014 Introduction Risk management is critical for a credit card company to survive in such competing industry. In addition

More information

Built from 20 kinds of amino acids

Built from 20 kinds of amino acids Built from 20 kinds of amino acids Each Protein has a three dimensional structure. Majority of proteins are compact. Highly convoluted molecules. Proteins are folded polypeptides. There are four levels

More information

Machine Learning and Data Analysis overview. Department of Cybernetics, Czech Technical University in Prague. http://ida.felk.cvut.

Machine Learning and Data Analysis overview. Department of Cybernetics, Czech Technical University in Prague. http://ida.felk.cvut. Machine Learning and Data Analysis overview Jiří Kléma Department of Cybernetics, Czech Technical University in Prague http://ida.felk.cvut.cz psyllabus Lecture Lecturer Content 1. J. Kléma Introduction,

More information

LESSON 3: ANTIBODIES/BCR/B-CELL RESPONSES

LESSON 3: ANTIBODIES/BCR/B-CELL RESPONSES Introduction to immunology. LESSON 3: ANTIBODIES/BCR/B-CELL RESPONSES Today we will get to know: The antibodies How antibodies are produced, their classes and their maturation processes Antigen recognition

More information

Computational Systems Biology. Lecture 2: Enzymes

Computational Systems Biology. Lecture 2: Enzymes Computational Systems Biology Lecture 2: Enzymes 1 Images from: David L. Nelson, Lehninger Principles of Biochemistry, IV Edition, Freeman ed. or under creative commons license (search for images at http://search.creativecommons.org/)

More information

Dr. Rita P.-Y. Chen Institute of Biological Chemistry Academia Sinica

Dr. Rita P.-Y. Chen Institute of Biological Chemistry Academia Sinica PEPTIDE SYNTHESIS Dr. Rita P.-Y. Chen Institute of Biological Chemistry Academia Sinica 1 Solution phase chemistry -Time consuming: isolation and purification at each step -Low yield: can t drive reaction

More information

Data Mining Analysis of HIV-1 Protease Crystal Structures

Data Mining Analysis of HIV-1 Protease Crystal Structures Data Mining Analysis of HIV-1 Protease Crystal Structures Gene M. Ko, A. Srinivas Reddy, Sunil Kumar, and Rajni Garg AP0907 09 Data Mining Analysis of HIV-1 Protease Crystal Structures Gene M. Ko 1, A.

More information

Custom Antibodies & Recombinant Proteins

Custom Antibodies & Recombinant Proteins Custom Antibodies & Recombinant Proteins INTRODUCTION Custom services to meet your research and development requirements Improvements in health, medicine and diagnostics over the past century can be largely

More information

Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003

Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Similarity Searches on Sequence Databases: BLAST, FASTA Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Outline Importance of Similarity Heuristic Sequence Alignment:

More information

3 months 1.5 months 1.5 months. 1 month

3 months 1.5 months 1.5 months. 1 month Rabbit monoclonal antibody (Mab) is secreted by the plasma B-cell of the rabbit. Traditional generation of rabbit Mab relies on a rabbit myeloma for B- cell fusion (

More information

BioMmune Technologies Inc. Corporate Presentation 2015

BioMmune Technologies Inc. Corporate Presentation 2015 BioMmune Technologies Inc Corporate Presentation 2015 * Harnessing the body s own immune system to fight cancer & other autoimmune diseases BioMmune Technologies Inc. (IMU) ABOUT A public biopharmaceutical

More information