Databases and mapping BWA. Samtools
|
|
|
- Emmeline Owens
- 10 years ago
- Views:
Transcription
1 Databases and mapping BWA Samtools
2 FASTQ, SFF, bax.h5 ACE, FASTG FASTA BAM/SAM GFF, BED GenBank/Embl/DDJB many more File formats
3 FASTQ Output format from Illumina and IonTorrent sequencers. Quality scores:
4 FASTQ Headers (Casava 1.8, qualities Sanger 1:Y:18:ATCACG EAS139 the unique instrument name 136 the run id FC706VJ the flowcell id 2 flowcell lane 2104 tile number within the flowcell lane 'x'-coordinate of the cluster within the tile 'y'-coordinate of the cluster within the tile 1 the member of a pair, 1 or 2 (paired-end or mate-pair reads only) Y Y if the read fails filter (read is bad), N otherwise 18 0 when none of the control bits are on, otherwise it is an even number ATCACG index sequence
5 SFF Standard Flowgram Format - binary format used to encode results from 454 sequencers - can be converted to fasta/fastq (sff2fastq tool)
6 PacBio files.bax.h5 The.bax.h5 files contain sequence data..bas.h5 The bas.h5 file now contains only the information necessary to dereference by hole number the ZMWlevel data. There are currently several different combinations of polymerases (P1-5) and chemistries (C1-3) used by PacBio. They differ by output file and error it's good to know which combination generated your data.
7 ACE Stores complete data about genomic contigs. All assemblers can be run with this or similar file output. Recommended for your final assembly! You can have a look at broken pairs of reads, browse differences in sequencing coverage,...
8 FASTG A format for faithfully representing genome assemblies in the face of allelic polymorphism and assembly uncertainty. The G stands for graph. #FASTG:begin; #FASTG:version=1.0:assembly_name="tiny example"; >chr1:chr1; ACGANNNNN[5:gap:size=(5,4..6)]CAGGC[1:alt:allele C,G]TATACG >chr2;4 ACATACGCATATATATATATATATATAT[20:tandem:size=(10,8..12) AT]TCA GGCA[1:alt A,T,TT]GGAC #FASTG:end;
9 FASTA Be consistent when naming your fasta files! Avoid special characters and spaces in headers..fa, fas.,.fasta,.fna,.faa >sequence_name GGAGGGGACGACGTCAAGTCATCATGGCCTTTATGGGTGGGGCTTCACACGTCATACAATGGTTGGAGCA AAGGGTCGCCAACTCGAGAGAGGGAGCTAATCCCACAAACCCAGCCCCAGTTCGGATTGGAGTCTGCAAC TCGACTCCATGAAGTAGGAATCGCTAGTAATCGTGGATCAGCATGCCACGGTGAATACGTTCCCGGGTCT TGTACACACCGCCCGTCACACCATGGAAGTAGGCCGCATCCGAAGCAGCCTCCCTAACCCTATTGCTGGG AAGGAGGCTGCGAAGGTGGGGTCTATGACTGGGGTGAAGTCGTAACAAGGTAGCCGTACCGGAAGGTGCG
10 BAM/SAM The SAM Format is a text format for storing sequence data in a series of tab delimited ASCII columns. Most often it is generated as a human readable version of its sister BAM format, which stores the same data in a compressed, indexed, binary form. Output from aligners that read FASTQ files and assign the sequences to a position with respect to a known reference genome. Contains header and alignment sections..bam.bai &.sam.sai are indexed version of files for quick access of data
11 GFF/GTF General Feature Format, currently GFF3. The GTF (General Transfer Format) is a refinement of GFF Version 2 and is sometimes referred to as GFF2.5 - used for describing genes and other features of DNA, RNA, and protein sequences
12 BED BED format provides a flexible way to define the data lines that are displayed in an annotation track. BED lines have three required fields and nine additional optional fields. The number of fields per line must be consistent throughout any single set of data in an annotation track. The order of the optional fields is binding: lower-numbered fields must always be populated if higher-numbered fields are used.
13 GenBank/EMBL/DDJB The GenBank sequence format is a rich format for storing sequences and associated annotations. It shares a feature table vocabulary and format with the EMBL and DDJB formats. FEATURES: source, gene, CDS
14 Software needed for this lecture Directory with all programs will be distributed on a USB flash drive. Add the folder with all binaries (executable files) into your path or run the individual programs locally. We will use Blast+, Hmmer, Bowtie/BWA and Samtools today. These programs are used on daily basis by almost every bioinformatician dealing with genomic data and they can be easily run on a laptop. BWA and Samtools need to be compiled from source. If the compilation fails (e.g. missing zlib for samtools), please let me know. Type: cd bwa-0.7.8; make cd samtools ; make
15 Sequence databases NR - non-redundant proteins from GenBank CDS translations, RefSeq Proteins, PDB, SwissProt, PIR and PRF - produced by NCBI. RefSeq - NCBI reference sequence collection, a set of taxonomically diverse, non-redundant and richly annotated sequences. UniProtKB - comprehensive resource for protein sequence and annotation data produced by the Universal Protein Resource consortium. Pfamseq - Pfamseq is the underlying sequence database that Pfam is built upon. As there should be no-overlaps between Pfam domains, this provides a stable sequence database for investigating domains and domain architectures. Swiss-Prot - Manually reviewed, high quality protein sequence and functional annotation - produced by UniProt. PDB - sequences with an experimentally determined structure.
16 Databases of metabolic pathways & enzyme nomenclature KEGG BioCyc ExPASy Enzyme BRENDA Keep in mind that an identical enzymatic reaction can be carried out by enzymes coded by completely different genes. Enzyme Commission number (EC number) is a numerical classification for enzymes, based on the chemical reactions they catalyze.
17 How to make custom blast databases makeblastdb -in fastafile -dbtype nucl/prot update_blastdb.pl - perl script bundled with blast programs - alows downloading/upgrading blast databases such as nr/nt/refseq/swissprot from NCBI ftp://ftp.ncbi.nlm.nih.gov/blast/db/
18 BLAST+ programs ftp://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/ blastn - Search a nucleotide database using a nucleotide query blastx - Search protein database using a translated nucleotide query blastp/psiblast - Search protein database using a protein query tblastn - Search translated nucleotide database using a protein query tblastx - Search translated nucleotide database using a translated nucleotide query blastx -help - prints help for the particular blast program
19 Using blast blastp -db databasename -query yourfastafile > seq_vs_database.blastp Useful blast arguments: -h prints help for a particular blast program -outfmt -num_descriptions -num_alignments -evalue -num_threads
20 Blast exercise Try to find immune proteins in the recently published tsetse fly genome by searching it with Drosophila melanogaster immunity proteins as queries. Use several different e-value cut-offs (1, 1e-3, 1e-6, 1e- 8,...) and output formats. makeblastdb -in Glossina_morsitans.faa -dbtype prot blastp -db Glossina_morsitans.faa -query Drosophila_melanogaster_imunity.faa -num_threads 4 > Dmel_immunity_vs_Gmors.blastp
21 Blast output formats *** Formatting options -outfmt <String> alignment view options: 0 = pairwise, 1 = query-anchored showing identities, 2 = query-anchored no identities, 3 = flat query-anchored, show identities, 4 = flat query-anchored, no identities, 5 = XML Blast output, 6 = tabular, 7 = tabular with comment lines, 8 = Text ASN.1, 9 = Binary ASN.1, 10 = Comma-separated values, 11 = BLAST archive format (ASN.1) Options 6, 7, and 10 can be additionally configured to produce a custom format specified by space delimited format specifiers.
22 HMMER HMMER is mainly used for searching sequence databases for homologs of protein sequences, and for making protein sequence alignments. It implements methods using probabilistic models called profile hidden Markov models (profile HMMs). Compared to BLAST and other sequence alignment and database search tools based on older scoring methodology, HMMER aims to be significantly more accurate and more able to detect remote homologs because of the strength of its underlying mathematical models. In the past, this strength came at significant computational expense, but in the new HMMER3 project, HMMER is now essentially as fast as BLAST. Webserver: User's guide: [PDF, 116 pages] ftp://selab.janelia.org/pub/software/hmmer3/3.1b1/userguide.pdf
23 Standalone HMMER3 1) Build models and align sequences (DNA or protein) hmmbuild Build a profile HMM from an input multiple alignment. hmmalign Make a multiple alignment of many sequences to a common profile HMM.
24 Individual hmmer programs Search protein queries against protein database phmmer Search a single protein sequence against a protein sequence database. (BLASTP-like) jackhmmer Iteratively search a protein sequence against a protein sequence database. (PSIBLAST-like) hmmsearch Search a protein profile HMM against a protein sequence database. hmmscan Search a protein sequence against a protein profile HMM database Search DNA queries against DNA database nhmmer Search a DNA sequence, alignment, or profile HMM against a DNA sequence database. (BLASTN-like) nhmmscan Search a DNA sequence against a DNA profile HMM database.
25 Searching a protein sequence database with a single protein profile HMM The subdirectory /tutorial in the HMMER distribution contains the files used in the tutorial, as well as a number of examples of various file formats that HMMER reads. hmmbuild globins4.hmm tutorial/globins4.sto hmmsearch globins4.hmm tutorial/globins45.fa > globins4.out phmmer tutorial/hbb_human tutorial/globins45.fa jackhmmer tutorial/hbb_human tutorial/globins45.fa
26 Searching a profile HMM database with a query sequence hmmbuild globins4.hmm tutorial/globins4.sto hmmbuild fn3.hmm tutorial/fn3.sto hmmbuild Pkinase.hmm tutorial/pkinase.sto cat globins4.hmm fn3.hmm Pkinase.hmm > minifam hmmpress minifam hmmscan minifam tutorial/7less_drome
27 Target profile HMM databases Gene3D - a collection of models that are based on CATH structural protein domains. Pfam - a large comprehensive collection of protein families. Superfamily - a collection of models, which represent structural protein domains at the SCOP superfamily level. TIGRFAMS - models that are designed for automated sequence annotation and that are aimed at matching the full length (or near) of the sequence.
28 Mapping high throughput sequencing data - Blat, Bowtie, BWA, MAQ, TopHat, Mummer,... - there are over a hundred of tools available - Illumina, 454, IonT, Sanger, GridIon/MinIon, PacBio,... - some of them are extremely fast and some of them are accurate different mappers give different results! - the two most cited short read aligners are Bowtie and BWA Read_Sequence_Alignment
29 Burrows-Wheeler algorithm (transform) Compression techniques work by finding repeated patterns in the data and encoding the duplications more compactly. The Burrows Wheeler transform (BWT, also called block-sorting compression) rearranges a character string into runs of similar characters. This is useful for compression, since it tends to be easy to compress a string that has runs of repeated characters by techniques such as move-to-front transform and run-length encoding. More importantly, the transformation is reversible, without needing to store any additional data. Working with short-read aligners - create an index for a set of FASTA files obtained from any source - align your reads - analyze SAM and BAM alignment files (SAMtools)
30 Maq Eland Soap Bowtie BWA Soap2
31 BWA (Burrows-Wheeler Aligner) BWA-MEM: For 70bp or longer Illumina, 454, Ion Torrent and Sanger reads, assembly contigs and BAC sequences BWA-backtrack: For short sequences BWA-SW: may have better sensitivity when alignment gaps are frequent. For all the algorithms, BWA first needs to construct the FM-index for the reference genome (the index command). Alignment algorithms are invoked with different sub-commands: aln/samse/sampe for BWAbacktrack, bwasw for BWA-SW and mem for the BWA-MEM algorithm. bwa index ref.fa bwa mem ref.fa reads_f.fastq reads_r.fastq > aln-pe.sam
32 Using BWA and Bowtie2 bwa index lambda_virus.fa bwa mem lambda_virus.fa reads_f.fastq reads_r.fastq > bwa-mem_pe.sam bowtie2-build lambda_virus.fa lambda_virus bowtie2 -x lambda_virus -1 reads_f.fastq -2 reads_r.fastq > bowtie2_pe.sam
33 SAMTOOLS A BAM file is just a SAM file stored in binary. import: SAM-to-BAM conversion view: BAM-to-SAM conversion and subalignment retrieval sort: sorting alignment merge: merging multiple sorted alignments index: indexing sorted alignment faidx: FASTA indexing and subsequence retrieval tview: text alignment viewer pileup: generating position-based output and consensus/indel calling
34 Using SAMTOOLS Convert and sort: samtools view -bs bowtie2_pe.sam > bowtie2-pe.bam samtools sort bowtie2-pe.bam bowtie2-pe.sorted.bam Create a bam index file: samtools index bowtie2-pe.sorted.bam bowtie2-pe.sorted.bam.bai Try it with both bowtie2 and bwa-mem sam files. Aligned reads (.sorted.bam file) can be viewed in genome browsers (e.g. Artemis). Filter out unmapped reads: samtools view -h -F 4 -b test.bam > test_only_mapped.bam
Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment
Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249
Next generation sequencing (NGS)
Next generation sequencing (NGS) Vijayachitra Modhukur BIIT [email protected] 1 Bioinformatics course 11/13/12 Sequencing 2 Bioinformatics course 11/13/12 Microarrays vs NGS Sequences do not need to be known
UGENE Quick Start Guide
Quick Start Guide This document contains a quick introduction to UGENE. For more detailed information, you can find the UGENE User Manual and other special manuals in project website: http://ugene.unipro.ru.
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Data formats and file conversions
Building Excellence in Genomics and Computational Bioscience s Richard Leggett (TGAC) John Walshaw (IFR) Common file formats FASTQ FASTA BAM SAM Raw sequence Alignments MSF EMBL UniProt BED WIG Databases
Welcome to the Plant Breeding and Genomics Webinar Series
Welcome to the Plant Breeding and Genomics Webinar Series Today s Presenter: Dr. Candice Hansey Presentation: http://www.extension.org/pages/ 60428 Host: Heather Merk Technical Production: John McQueen
Module 1. Sequence Formats and Retrieval. Charles Steward
The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
A Tutorial in Genetic Sequence Classification Tools and Techniques
A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University [email protected] www.jakemdrew.com Sequence Characters IUPAC nucleotide
Linear Sequence Analysis. 3-D Structure Analysis
Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical properties Molecular weight (MW), isoelectric point (pi), amino acid content, hydropathy (hydrophilic
Bioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
Analysis of NGS Data
Analysis of NGS Data Introduction and Basics Folie: 1 Overview of Analysis Workflow Images Basecalling Sequences denovo - Sequencing Assembly Annotation Resequencing Alignments Comparison to reference
Guide for Bioinformatics Project Module 3
Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first
Introduction to NGS data analysis
Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High
SGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD
White Paper SGI High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems Haruna Cofer*, PhD January, 2012 Abstract The SGI High Throughput Computing (HTC) Wrapper
Version 5.0 Release Notes
Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com
A Complete Example of Next- Gen DNA Sequencing Read Alignment. Presentation Title Goes Here
A Complete Example of Next- Gen DNA Sequencing Read Alignment Presentation Title Goes Here 1 FASTQ Format: The de- facto file format for sharing sequence read data Sequence and a per- base quality score
Biological Databases and Protein Sequence Analysis
Biological Databases and Protein Sequence Analysis Introduction M. Madan Babu, Center for Biotechnology, Anna University, Chennai 25, India Bioinformatics is the application of Information technology to
BLAST. Anders Gorm Pedersen & Rasmus Wernersson
BLAST Anders Gorm Pedersen & Rasmus Wernersson Database searching Using pairwise alignments to search databases for similar sequences Query sequence Database Database searching Most common use of pairwise
CD-HIT User s Guide. Last updated: April 5, 2010. http://cd-hit.org http://bioinformatics.org/cd-hit/
CD-HIT User s Guide Last updated: April 5, 2010 http://cd-hit.org http://bioinformatics.org/cd-hit/ Program developed by Weizhong Li s lab at UCSD http://weizhong-lab.ucsd.edu [email protected] 1. Introduction
A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques
Proceedings of the 2007 WSEAS International Conference on Computer Engineering and Applications, Gold Coast, Australia, January 17-19, 2007 402 A Multiple DNA Sequence Translation Tool Incorporating Web
org.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers.
org.rn.eg.db December 16, 2015 org.rn.egaccnum Map Entrez Gene identifiers to GenBank Accession Numbers org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank
NGS Data Analysis: An Intro to RNA-Seq
NGS Data Analysis: An Intro to RNA-Seq March 25th, 2014 GST Colloquim: March 25th, 2014 1 / 1 Workshop Design Basics of NGS Sample Prep RNA-Seq Analysis GST Colloquim: March 25th, 2014 2 / 1 Experimental
17 July 2014 WEB-SERVER MANUAL. Contact: Michael Hackenberg ([email protected])
WEB-SERVER MANUAL Contact: Michael Hackenberg ([email protected]) 1 1 Introduction srnabench is a free web-server tool and standalone application for processing small- RNA data obtained from next generation
Pairwise Sequence Alignment
Pairwise Sequence Alignment [email protected] SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What
Basic processing of next-generation sequencing (NGS) data
Basic processing of next-generation sequencing (NGS) data Getting from raw sequence data to expression analysis! 1 Reminder: we are measuring expression of protein coding genes by transcript abundance
When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want
1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very
SRA File Formats Guide
SRA File Formats Guide Version 1.1 10 Mar 2010 National Center for Biotechnology Information National Library of Medicine EMBL European Bioinformatics Institute DNA Databank of Japan 1 Contents SRA File
Comparing Methods for Identifying Transcription Factor Target Genes
Comparing Methods for Identifying Transcription Factor Target Genes Alena van Bömmel (R 3.3.73) Matthew Huska (R 3.3.18) Max Planck Institute for Molecular Genetics Folie 1 Transcriptional Regulation TF
Analysis of ChIP-seq data in Galaxy
Analysis of ChIP-seq data in Galaxy November, 2012 Local copy: https://galaxy.wi.mit.edu/ Joint project between BaRC and IT Main site: http://main.g2.bx.psu.edu/ 1 Font Conventions Bold and blue refers
Frequently Asked Questions Next Generation Sequencing
Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided
This document presents the new features available in ngklast release 4.4 and KServer 4.2.
This document presents the new features available in ngklast release 4.4 and KServer 4.2. 1) KLAST search engine optimization ngklast comes with an updated release of the KLAST sequence comparison tool.
An agent-based layered middleware as tool integration
An agent-based layered middleware as tool integration Flavio Corradini Leonardo Mariani Emanuela Merelli University of L Aquila University of Milano University of Camerino ITALY ITALY ITALY Helsinki FSE/ESEC
Data Analysis & Management of High-throughput Sequencing Data. Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute
Data Analysis & Management of High-throughput Sequencing Data Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute Current Issues Current Issues The QSEQ file Number files per
Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003
Similarity Searches on Sequence Databases: BLAST, FASTA Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Outline Importance of Similarity Heuristic Sequence Alignment:
Unipro UGENE Manual. Version 1.20.0
Unipro UGENE Manual Version 1.20.0 December 16, 2015 Unipro UGENE Online User Manual About Unipro About UGENE Key Features User Interface High Performance Computing Cooperation Download and Installation
Syllabus of B.Sc. (Bioinformatics) Subject- Bioinformatics (as one subject) B.Sc. I Year Semester I Paper I: Basic of Bioinformatics 85 marks
Syllabus of B.Sc. (Bioinformatics) Subject- Bioinformatics (as one subject) B.Sc. I Year Semester I Paper I: Basic of Bioinformatics 85 marks Semester II Paper II: Mathematics I 85 marks B.Sc. II Year
A Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
Distributed Data Mining in Discovery Net. Dr. Moustafa Ghanem Department of Computing Imperial College London
Distributed Data Mining in Discovery Net Dr. Moustafa Ghanem Department of Computing Imperial College London 1. What is Discovery Net 2. Distributed Data Mining for Compute Intensive Tasks 3. Distributed
Introduction. Overview of Bioconductor packages for short read analysis
Overview of Bioconductor packages for short read analysis Introduction General introduction SRAdb Pseudo code (Shortread) Short overview of some packages Quality assessment Example sequencing data in Bioconductor
Searching Nucleotide Databases
Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames
Module 3. Genome Browsing. Using Web Browsers to View Genome Annota4on. Kers4n Howe Wellcome Trust Sanger Ins4tute zfish- [email protected].
Module 3 Genome Browsing Using Web Browsers to View Genome Annota4on Kers4n Howe Wellcome Trust Sanger Ins4tute zfish- [email protected] Introduc.on Genome browsing The Ensembl gene set Guided examples
Removing Sequential Bottlenecks in Analysis of Next-Generation Sequencing Data
Removing Sequential Bottlenecks in Analysis of Next-Generation Sequencing Data Yi Wang, Gagan Agrawal, Gulcin Ozer and Kun Huang The Ohio State University HiCOMB 2014 May 19 th, Phoenix, Arizona 1 Outline
Practical Guideline for Whole Genome Sequencing
Practical Guideline for Whole Genome Sequencing Disclosure Kwangsik Nho Assistant Professor Center for Neuroimaging Department of Radiology and Imaging Sciences Center for Computational Biology and Bioinformatics
Apply PERL to BioInformatics (II)
Apply PERL to BioInformatics (II) Lecture Note for Computational Biology 1 (LSM 5191) Jiren Wang http://www.bii.a-star.edu.sg/~jiren BioInformatics Institute Singapore Outline Some examples for manipulating
Unipro UGENE User Manual Version 1.12.3
Unipro UGENE User Manual Version 1.12.3 April 01, 2014 Contents 1 About Unipro................................... 10 1.1 Contacts.......................................... 10 2 About UGENE..................................
Geneious 4.0.2. Biomatters Ltd
Geneious 4.0.2 Biomatters Ltd 17th September 2008 2 Contents 1 Getting Started 7 1.1 Downloading & Installing Geneious.......................... 7 1.2 Using Geneious for the first time............................
RAST Automated Analysis. What is RAST for?
RAST Automated Analysis Gordon D. Pusch Fellowship for Interpretation of Genomes What is RAST for? RAST is designed to rapidly call and annotate the genes of a complete or essentially complete prokaryotic
Bio-Informatics Lectures. A Short Introduction
Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively
Global and Discovery Proteomics Lecture Agenda
Global and Discovery Proteomics Christine A. Jelinek, Ph.D. Johns Hopkins University School of Medicine Department of Pharmacology and Molecular Sciences Middle Atlantic Mass Spectrometry Laboratory Global
UCLA Team Sequences Cell Line, Puts Open Source Software Framework into Production
Page 1 of 6 UCLA Team Sequences Cell Line, Puts Open Source Software Framework into Production February 05, 2010 Newsletter: BioInform BioInform - February 5, 2010 By Vivien Marx Scientists at the department
Next Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University [email protected] http://tandem.bu.edu/ The Human Genome Project took
Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at
Woods Hole Zebrafish Genetics and Development Bioinformatics/Genomics Lab Ian Woods Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at http://faculty.ithaca.edu/iwoods/docs/wh/
GenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
Introduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
Copy Number Variation: available tools
Copy Number Variation: available tools Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Introduction A literature review of available
Deep Sequencing Data Analysis
Deep Sequencing Data Analysis Ross Whetten Professor Forestry & Environmental Resources Background Who am I, and why am I teaching this topic? I am not an expert in bioinformatics I started as a biologist
Geospiza s Finch-Server: A Complete Data Management System for DNA Sequencing
KOO10 5/31/04 12:17 PM Page 131 10 Geospiza s Finch-Server: A Complete Data Management System for DNA Sequencing Sandra Porter, Joe Slagel, and Todd Smith Geospiza, Inc., Seattle, WA Introduction The increased
LifeScope Genomic Analysis Software 2.5
USER GUIDE LifeScope Genomic Analysis Software 2.5 Graphical User Interface DATA ANALYSIS METHODS AND INTERPRETATION Publication Part Number 4471877 Rev. A Revision Date November 2011 For Research Use
454 Sequencing System Software Manual Version 2.6
454 Sequencing System Software Manual Version 2.6 Part C: May 2011 Instrument / Kit GS Junior / Junior GS FL+ / L+ GS FL+ / LR70 GS FL / LR70 For life science research only. Not for use in diagnostic procedures.
Introduction to next-generation sequencing data
Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS
High Throughput Sequencing Data Analysis using Cloud Computing
High Throughput Sequencing Data Analysis using Cloud Computing Stéphane Le Crom ([email protected]) LBD - Université Pierre et Marie Curie (UPMC) Institut de Biologie de l École normale supérieure
How To Use The Assembly Database In A Microarray (Perl) With A Microarcode) (Perperl 2) (For Macrogenome) (Genome 2)
The Ensembl Core databases and API Useful links Installation instructions: http://www.ensembl.org/info/docs/api/api_installation.html Schema description: http://www.ensembl.org/info/docs/api/core/core_schema.html
Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011
Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear
8/7/2012. Experimental Design & Intro to NGS Data Analysis. Examples. Agenda. Shoe Example. Breast Cancer Example. Rat Example (Experimental Design)
Experimental Design & Intro to NGS Data Analysis Ryan Peters Field Application Specialist Partek, Incorporated Agenda Experimental Design Examples ANOVA What assays are possible? NGS Analytical Process
When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want
1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very
BioHPC Web Computing Resources at CBSU
BioHPC Web Computing Resources at CBSU 3CPG workshop Robert Bukowski Computational Biology Service Unit http://cbsu.tc.cornell.edu/lab/doc/biohpc_web_tutorial.pdf BioHPC infrastructure at CBSU BioHPC Web
Next Generation Sequencing
Next Generation Sequencing Cavan Reilly December 5, 2012 Table of contents Next generation sequencing NGS and microarrays Study design Quality assessment Burrows Wheeler transform BWT example Introduction
BIOINFORMATICS TUTORIAL
Bio 242 BIOINFORMATICS TUTORIAL Bio 242 α Amylase Lab Sequence Sequence Searches: BLAST Sequence Alignment: Clustal Omega 3d Structure & 3d Alignments DO NOT REMOVE FROM LAB. DO NOT WRITE IN THIS DOCUMENT.
Sequencing the Human Genome
Revised and Updated Edvo-Kit #339 Sequencing the Human Genome 339 Experiment Objective: In this experiment, students will read DNA sequences obtained from automated DNA sequencing techniques. The data
Protein & DNA Sequence Analysis. Bobbie-Jo Webb-Robertson May 3, 2004
Protein & DNA Sequence Analysis Bobbie-Jo Webb-Robertson May 3, 2004 Sequence Analysis Anything connected to identifying higher biological meaning out of raw sequence data. 2 Genomic & Proteomic Data Sequence
Next Generation Sequencing Data Visualization
Next Generation Sequencing Data Visualization GBrowse2 from GMOD Andreas Gisel Institute for Biomedical Technologies CNR Bari - Italy GMOD is the Generic Model Organism Database project GMOD is a collection
Focusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling
Lectures 1 and 8 15 February 7, 2013 This is a review of the material from lectures 1 and 8 14. Note that the material from lecture 15 is not relevant for the final exam. Today we will go over the material
-> Integration of MAPHiTS in Galaxy
Enabling NGS Analysis with(out) the Infrastructure, 12:0512 Development of a workflow for SNPs detection in grapevine From Sets to Graphs: Towards a Realistic Enrichment Analy species: MAPHiTS -> Integration
Processing Genome Data using Scalable Database Technology. My Background
Johann Christoph Freytag, Ph.D. [email protected] http://www.dbis.informatik.hu-berlin.de Stanford University, February 2004 PhD @ Harvard Univ. Visiting Scientist, Microsoft Res. (2002)
RNA-Seq Tutorial 1. John Garbe Research Informatics Support Systems, MSI March 19, 2012
RNA-Seq Tutorial 1 John Garbe Research Informatics Support Systems, MSI March 19, 2012 Tutorial 1 RNA-Seq Tutorials RNA-Seq experiment design and analysis Instruction on individual software will be provided
Sequencing Analysis Software User Guide
Sequencing Analysis Software User Guide For Pipeline Version 1.5 and CASAVA Version 1.0 FOR RESEARCH USE ONLY ACGTACGTACGTACG TACGTACGTACGTACGTA A G T G AC CG C T AC CGT ILLUMINA PROPRIETARY Catalog #
(A GUIDE for the Graphical User Interface (GUI) GDE)
The Genetic Data Environment: A User Modifiable and Expandable Multiple Sequence Analysis Package (A GUIDE for the Graphical User Interface (GUI) GDE) Jonathan A. Eisen Department of Biological Sciences
Geneious 8.1. Biomatters Ltd
Geneious 8.1 Biomatters Ltd August 10, 2015 2 Contents 1 Getting Started 5 1.1 Downloading & Installing Geneious.......................... 5 1.2 Geneious setup...................................... 6 1.3
BIOLOMICS SOFTWARE & SERVICES GENERAL INFORMATION DOCUMENT
BIOLOMICS SOFTWARE & SERVICES GENERAL INFORMATION DOCUMENT BIOAWARE SA NV - VERSION 2.0 - AUGUST 2013 BIOLOMICS SOFTWARE DYNAMIC CREATION AND MODIFICATION OF DATABASES Create simple or complex databases
Laboratorio di Bioinformatica
Laboratorio di Bioinformatica Lezione #2 Dr. Marco Fondi Contact: [email protected] www.unifi.it/dblemm/ tel. 0552288308 Dip.to di Biologia Evoluzionistica Laboratorio di Evoluzione Microbica e Molecolare,
About the Princess Margaret Computational Biology Resource Centre (PMCBRC) cluster
Cluster Info Sheet About the Princess Margaret Computational Biology Resource Centre (PMCBRC) cluster Welcome to the PMCBRC cluster! We are happy to provide and manage this compute cluster as a resource
Genome Viewing. Module 2. Using Genome Browsers to View Annotation of the Human Genome
Module 2 Genome Viewing Using Genome Browsers to View Annotation of the Human Genome Bert Overduin, Ph.D. PANDA Coordination & Outreach EMBL - European Bioinformatics Institute Wellcome Trust Genome Campus
Clone Manager. Getting Started
Clone Manager for Windows Professional Edition Volume 2 Alignment, Primer Operations Version 9.5 Getting Started Copyright 1994-2015 Scientific & Educational Software. All rights reserved. The software
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
MetaPathways v1.0 Installation
MetaPathways v1.0 Installation Niels W. Hanson, Kishori M. Konwar, Antoine P. Pagé, and Steven J. Hallam This document explains the basic installation and setup of the MetaPathways v1.0 pipeline on a typical
Integrated Rule-based Data Management System for Genome Sequencing Data
Integrated Rule-based Data Management System for Genome Sequencing Data A Research Data Management (RDM) Green Shoots Pilots Project Report by Michael Mueller, Simon Burbidge, Steven Lawlor and Jorge Ferrer
Biological Sequence Data Formats
Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA
Eoulsan Analyse du séquençage à haut débit dans le cloud et sur la grille
Eoulsan Analyse du séquençage à haut débit dans le cloud et sur la grille Journées SUCCES Stéphane Le Crom (UPMC IBENS) [email protected] Paris November 2013 The Sanger DNA sequencing method Sequencing
Sequence Database Administration
Sequence Database Administration 1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases
CRAC: An integrated approach to analyse RNA-seq reads Additional File 3 Results on simulated RNA-seq data.
: An integrated approach to analyse RNA-seq reads Additional File 3 Results on simulated RNA-seq data. Nicolas Philippe and Mikael Salson and Thérèse Commes and Eric Rivals February 13, 2013 1 Results
