UGENE Quick Start Guide
|
|
|
- Kelley Joshua Warren
- 10 years ago
- Views:
Transcription
1
2 Quick Start Guide This document contains a quick introduction to UGENE. For more detailed information, you can find the UGENE User Manual and other special manuals in project website: What is UGENE? What you can do in UGENE? View, edit and annotate DNA, RNA and protein sequences View, edit and align multiple sequence alignments View, align and assemble short reads 3D structures and surface algorithms Workflow Designer: pipelines and repeatable experiments 2
3 What is UGENE? Unipro UGENE is a free cross-platform genome analysis suite. It is distributed under the terms of the GNU General Public License. To learn more about UGENE visit UGENE website. It works on Windows, Mac OS X or Linux and requires only a few clicks to install. Key Features Powerful viewers and editors for DNA and protein sequences, multiple sequence alignments, chromatograms, 3D-structures, short read assemblies and phylogenetic trees. Support for dozens data formats, set of tools for importing and exporting data. Visual designer, runner and debugger for computational workflows from over 100 embedded algorithmic elements. Reusable computational workflows that can be shared, published and read as plain text by everyone. Full featured command line only version for remote desktops. Automatic detection and optimization for multi-core hardware, GPGPU, special instruction sets available on user's PC Setting up UGENE package user automatically gets dozens of tools installed and configured for immediate use Tools provided with UGENE installation BLAST, Smith-Waterman - popular basic local sequence alignment tools. HMMER2/HMMER3 - sequence analysis using profile hidden Markov Models constructed from multiple sequence alignments. ClustalW, ClustalO, Muscle, K-Align, Mafft, T-Coffee multiple sequence alignment algorithms. Repeat finding and sequence comparison algorithms with a convenient dot-plot based results visualization. Open reading frames visualization and export. Restriction sites visualization tool with included version of REBASE database. Transcription factor binding sites analysis with SITECON, weight-matrix based algorithms and included version of JASPAR database. Short read aligners: BWA, Bowtie, Bowtie2, UGENE Aligner. GC-content, AT-content graphs. Mr bayes and Phylip tools for phylogenetic trees construction.... and dozens of other popular and highly cited tools. Hardware requirements UGENE runs smoothly on almost all hardware available: single core Pentium III or higher computer with 200Mb of free disk size and 64Mb memory is enough. Use UGENE on Mac, Windows or Linux operating systems. Both 32 and 64 bit versions are available. No 3rd-party software is needed to be installed to use UGENE! Customization and cooperation UGENE is opensource software: it's easy to customize UGENE, add new features and tools! UGENE team welcomes all developers and researchers to participate in joined projects to improve UGENE or create customizations needed by user! 3
4 What you can do in UGENE? When open UGENE for the first time, there is an empty UGENE window with the main menu bar on the top of the window: Using these menus you can run many algorithms, configure different settings and get help: Menu File Description A set of project/file level operations. Example: create, open, etc. a project; open a document; access remote database to download a file. Actions Various actions associated with the active window. Example: export, remove, edit, analyze a sequence using different plugins (for the Sequence View); edit, align, change the consensus mode (for the Alignment Editor). Settings Tools Application, plugins and tools settings. Various tools, independent of an active window. This menu is extended by different plugins. Example: HMMER2 / HMMER3 tools, SITECON, Workflow Designer. Window A list of active windows and basic manipulations with the windows. Example: close all windows, tile windows, select next window. Help Application help and check for updates. The menus can be dynamically populated with new actions added by plugins. You can select and analyze different files such as sequences, multiple sequence alignments, short reads assemblies and etc. To open a file click on the File-->Open or click on the Open icon and choose the file: You can use UGENE sample files. There are the following sample data: ABIF, ACE, Assembly, CLUSTALW, EMBL, FASTA, FASTQ, Genbank, GFF, HMM, MMDB, MSF, Newick, PDB, Raw, SCF, Stockholm, Swiss-Prot. These files are located in the main UGENE directory: ugene/data/samples. View, edit and annotate DNA, RNA and protein sequences View, edit and align multiple sequence alignments View, align and assemble short reads 3D structures and surface algorithms Workflow Designer: pipelines and repeatable experiments View, edit and annotate DNA, RNA and protein sequences DNA, RNA or protein sequences ( Sequence View ). The Sequence View is one of the major object views in UGENE aimed to visualize and edit DNA, RNA or protein sequences along with their properties like annotations, chromatograms, 3D models, statistical data, etc. For each le 4
5 UGENE analyzes the le content and automatically opens the most appropriate view. To activate the Sequence View open any le with at least one sequence. For example you can use the $ugene/data/samples/genbank/murine.gb le provided with UGENE. After opening the le in UGENE the Sequence View window appears: Sequece View - an object view aimed to visualize DNA, RNA or protein sequences along with their properties like annotations, chromatograms, 3D models, statistical data, etc. Project View - a visual component used to manage active project and bookmarks. Annotations Editor - contains tools to manipulate annotations for a sequence. Options Panel - it is the panel with dierent information tabs and tabs with settings for Sequence View. Task View - shows active tasks, for example, algorithms computations. Log View - shows the program log information. Notifications - shows notifications for task reports. After the view is opened you can see a set of new buttons in the toolbar area. The actions provided by these buttons are available for all sequences opened in the view. These actions also available from the context menu. Many instruments and algorithms are available: Find pattern Find ORFs Find annotated regions Build dotplot Find repeats Find tandems Find restriction sites Primer 3 Find high DNA flexibility regions... Example 1: Finding patterns in your sequence. Do the following steps: Open the by menu, for example. Sequence View with murine.gb opens. ugene/data/samples/murine.gb File >Open Select the Search in Sequence tab of the Options Panel. Click Show more options and more options appear. Insert, for example "TTCCGAGGGACACTAGGCTGACTCCATC" pattern into Search for: field and choose annototation parameters. For example as in the picture below: 5
6 After that click the Search button. If the pattern there is or there are in the sequence it appears as new annotation(s): 6
7 View, edit and align multiple sequence alignments Multiple sequence alignment ( MSA Editor ). The Alignment Editor is a powerful tool for visualization and editing DNA, RNA or protein multiple sequence alignments. To activate the Alignment Editor open any alignment le. For example you can use the $ ugene/data/samples/c LUSTALW/COI.aln le provided with UGENE. After opening the le in UGENE the Alignment Editor window appears: 7
8 The editor supports dierent multiple sequence alignment (MSA) formats, such as ClustalW, MSF and Stockholm. The editor provides interactive visual representation which includes: Navigation through an alignment; Optional coloring schemes (for example Clustal, Jalview like, etc.); Flexible zooming for large alignments; Export publication-ready images of alignment; Several consensus calculation algorithms. Using the Alignment Editor you can: Perform multiple sequence alignment using integrated MUSCLE and KAlign algorithms; Edit an alignment: delete/copy/paste symbols, sequences and subalignments; Build phylogenetic trees; Generate grid proles; Build Hidden Markov Model proles to use with HMM2/HMM3 tools. Example 2: Build a tree from your alignment. You can do this by three different ways: a. From the toolbar. Click to the tree icon: b. From the context menu: c. From the Options Panel: 8
9 After calculation the tree appears in the MSA Editor in a separate window: View, align and assemble short reads SAM/BAM files ( Assembly Browser ). Assembly Browser is used to visualize and efficiently browse large next generation sequence assemblies. Currently supported formats are SAM (Sequence Alignment/Map) and BAM, which is a binary version of the SAM format. Both formats are produced by SAMtools and described in the following specication: SAMtools. To activate the Alignment Editor open any assembly le. For example you can use the $ugene/data/samples/assembly/chrm.bam le provided with UGENE. After opening the le in UGENE the Assembly Browser window appears: 9
10 Using the Assembly Browser you can: browsing and zooming assembly, getting information about reads, short reads vizualization, associatin g reference sequence, consensus sequence, exporting. Example 3: Highlighting the strand of reads. You can do this using the context menu or the Options Panel. 10
11 3D structures and surface algorithms 3D structures ( 3D Structure Viewer ). The 3D Structure Viewer is intended for visualization of 3D structures of biological molecules. Using the 3D Structure Viewer you can work with data from the Protein Data Bank (PDB) - a repository for the 3D structural data of large biological molecules, such as proteins and nucleic acids, maintained by the Worlwide Protein Data Bank (wwpdb). You can work as well with data from the NCBI Molecular Modeling DataBase (MMDB), also known as "Entrez Structure", a database of experimentally determined structures obtained from the RCSB Protein Data Bank. The 3D Structure Viewer is opened automatically when you open a PDB or MMDB le. For example, open $ugene/data/samples/pdb/1cf7.p DB. The 3D Structure Viewer adds a view to the upper part of the Sequence View: Using the 3D Structure Viewer you can: Changing 3D Structure Appearance; Moving, zooming and zpinning 3D structure; Highlighting sequence region; Selecting models to display; Exporting 3D structures image; Working with several 3D structure views. Example 5: Calculating Molecular Surface. To calculate the molecular surface of a molecule select the Molecular Surface item in the 3D Structure Viewer context menu or in the Display menu on the toolbar and check one of the following items: SAS (solvent-accessible surface) SES (solvent-excluded surface) vdws (van der Waals surface) To remove the molecular surface that has already been calculated select the O item. You can also select the Molecular Surface Render Style to modify the calculated molecular surface appearance: Convex Map Dots 11
12 Workflow Designer: pipelines and repeatable experiments Workflow Designer. UGENE Workflow Designer is a central part of UGENE that allows a molecular biologist to create and run complex computational workflows even if he or she is not familiar with any programming language. A workflow comprises reproducible, reusable and self-documented research routine, with a simple and unambiguous visual representation suitable for publications. A workflow can be run both locally and remotely, either using graphical interface or launched from the command line. Elements in workflow correspond algorithms integrated into UGENE. Additionally you can create custom workflow elements using integrated scripting language, or by connecting arbitrary external command line utility. To launch the Workflow Designer select the Tools Workflow Designer item in the UGENE main menu. The following window appears: 12
13 Example 4: You can find pattern in a sequence or in sequences and save it as annotations using the following workflow: Create the workflow, choose parameters and click the Run button. If you want to search pattern in many sequences you can add these sequences into Read Sequence element. After the end of the running process a report appears. The report include all information about workflow. 13
14 All your workflows have been saved and you can navigation between it and use it with a help of the Dashboards Manager: Note that workflows in UGENE are easy to read and share, can be reused multiple times and compiled into a separate standalone command line tools! For more detailed information about Workflow Designer use the Workflow Designer Documentation. 14
Unipro UGENE User Manual Version 1.12.3
Unipro UGENE User Manual Version 1.12.3 April 01, 2014 Contents 1 About Unipro................................... 10 1.1 Contacts.......................................... 10 2 About UGENE..................................
Unipro UGENE Manual. Version 1.20.0
Unipro UGENE Manual Version 1.20.0 December 16, 2015 Unipro UGENE Online User Manual About Unipro About UGENE Key Features User Interface High Performance Computing Cooperation Download and Installation
Version 5.0 Release Notes
Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com
CLC Bioinformatics Database
CLC Bioinformatics Database End User USER MANUAL Manual for CLC Bioinformatics Database 4.6 Windows, Mac OS X and Linux September 3, 2015 This software is for research purposes only. QIAGEN Aarhus A/S
Bioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
Vector NTI Advance 11 Quick Start Guide
Vector NTI Advance 11 Quick Start Guide Catalog no. 12605050, 12605099, 12605103 Version 11.0 December 15, 2008 12605022 Published by: Invitrogen Corporation 5791 Van Allen Way Carlsbad, CA 92008 U.S.A.
Geneious 8.1. Biomatters Ltd
Geneious 8.1 Biomatters Ltd August 10, 2015 2 Contents 1 Getting Started 5 1.1 Downloading & Installing Geneious.......................... 5 1.2 Geneious setup...................................... 6 1.3
CLC Sequence Viewer USER MANUAL
CLC Sequence Viewer USER MANUAL Manual for CLC Sequence Viewer 7.6.1 Windows, Mac OS X and Linux September 3, 2015 This software is for research purposes only. QIAGEN Aarhus A/S Silkeborgvej 2 Prismet
Getting Started Guide - Desktop
Getting Started Guide - Desktop 1. Sign Up PERSONAL OPENTEXT CORE ACCOUNT To get started sharing and collaborating on your files from a Mac or Windows browser, you ll need to sign up for your OpenText
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Visualizing molecular simulations
Visualizing molecular simulations ChE210D Overview Visualization plays a very important role in molecular simulations: it enables us to develop physical intuition about the behavior of a system that is
EMBL-EBI Web Services
EMBL-EBI Web Services Rodrigo Lopez Head of the External Services Team SME Workshop Piemonte 2011 EBI is an Outstation of the European Molecular Biology Laboratory. Summary Introduction The JDispatcher
StrikeRisk v6.0 IEC/EN 62305-2 Risk Management Software Getting Started
StrikeRisk v6.0 IEC/EN 62305-2 Risk Management Software Getting Started Contents StrikeRisk v6.0 Introduction 1/1 1 Installing StrikeRisk System requirements Installing StrikeRisk Installation troubleshooting
DataPA OpenAnalytics End User Training
DataPA OpenAnalytics End User Training DataPA End User Training Lesson 1 Course Overview DataPA Chapter 1 Course Overview Introduction This course covers the skills required to use DataPA OpenAnalytics
Guide for Bioinformatics Project Module 3
Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first
Managing Documents in the Citrix XenApp Remote Desktop
Introduction Managing Documents in the Citrix XenApp Remote Desktop What is a Citrix XenApp Remote Desktop? It is a virtualized instance of MS Windows with only enough software to run TAS in a controlled
14.1. bs^ir^qfkd=obcib`qflk= Ñçê=emI=rkfuI=~åÇ=léÉåsjp=eçëíë
14.1 bs^ir^qfkd=obcib`qflk= Ñçê=emI=rkfuI=~åÇ=léÉåsjp=eçëíë bî~äì~íáåö=oéñäéåíáçå=ñçê=emi=rkfui=~åç=lééåsjp=eçëíë This guide walks you quickly through key Reflection features. It covers: Getting Connected
Geneious 7.0. Biomatters Ltd
h in a flash Geneious 7.0 Biomatters Ltd September 3, 2013 2 Contents 1 Getting Started 7 1.1 Downloading & Installing Geneious.......................... 7 1.2 Using Geneious for the first time............................
Structure Tools and Visualization
Structure Tools and Visualization Gary Van Domselaar University of Alberta [email protected] Slides Adapted from Michel Dumontier, Blueprint Initiative 1 Visualization & Communication Visualization
Getting Started Guide. Chapter 14 Customizing LibreOffice
Getting Started Guide Chapter 14 Customizing LibreOffice Copyright This document is Copyright 2010 2012 by its contributors as listed below. You may distribute it and/or modify it under the terms of either
SGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD
White Paper SGI High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems Haruna Cofer*, PhD January, 2012 Abstract The SGI High Throughput Computing (HTC) Wrapper
HOW TO MAKE YOUR WEBSITE
HOW TO MAKE YOUR WEBSITE Use Netscape Composer to make your web page presentation of a 3D structure of your choosing. You will need to download a few template web pages from the biochemistry website, and
RuleBender 1.1.415 Tutorial
RuleBender 1.1.415 Tutorial Installing and Launching RuleBender Requirements OSX Getting Started Linux Getting Started Windows Getting Started Using the Editor The Main Window Creating and Opening Files
Network Administrator s Guide and Getting Started with Autodesk Ecotect Analysis
Autodesk Ecotect Analysis 2011 Network Administrator s Guide and Getting Started with Autodesk Ecotect Analysis This document describes how to install and activate Autodesk Ecotect Analysis 2011 software
When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want
1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very
Avalanche Remote Control User Guide. Version 4.1.3
Avalanche Remote Control User Guide Version 4.1.3 ii Copyright 2012 by Wavelink Corporation. All rights reserved. Wavelink Corporation 10808 South River Front Parkway, Suite 200 South Jordan, Utah 84095
SA-9600 Surface Area Software Manual
SA-9600 Surface Area Software Manual Version 4.0 Introduction The operation and data Presentation of the SA-9600 Surface Area analyzer is performed using a Microsoft Windows based software package. The
Moxa Device Manager 2.0 User s Guide
First Edition, March 2009 www.moxa.com/product 2009 Moxa Inc. All rights reserved. Reproduction without permission is prohibited. Moxa Device Manager 2.0 User Guide The software described in this manual
Foxit Reader Quick Guide
I Contents Foxit Reader Contents... II Chapter 1 Get Started... 1 Foxit Reader Overview... 1 System Requirements... 1 Install Foxit Reader... 2 Uninstall Foxit Reader... 2 Update Foxit Reader... 2 Workspace...
Installation Guide for Windows
Installation Guide for Windows Overview: Getting Ready Installing Sequencher Activating and Installing the License Registering Sequencher GETTING READY Trying Sequencher: Sequencher 5.2 and newer requires
Getting Started with CodeXL
AMD Developer Tools Team Advanced Micro Devices, Inc. Table of Contents Introduction... 2 Install CodeXL... 2 Validate CodeXL installation... 3 CodeXL help... 5 Run the Teapot Sample project... 5 Basic
BioHPC Web Computing Resources at CBSU
BioHPC Web Computing Resources at CBSU 3CPG workshop Robert Bukowski Computational Biology Service Unit http://cbsu.tc.cornell.edu/lab/doc/biohpc_web_tutorial.pdf BioHPC infrastructure at CBSU BioHPC Web
SMARTEAM - Editor Administrator Guide
SMARTEAM - Editor Administrator Guide SmarTeam Corporation Ltd. Web: www.smarteam.com Tel: +972-9-7644000 5 Hagavish St., P.O.B 7020 Email: [email protected] Fax: +972-9-7644001 Kfar Saba, Israel 44641
GOOGLE DOCS APPLICATION WORK WITH GOOGLE DOCUMENTS
GOOGLE DOCS APPLICATION WORK WITH GOOGLE DOCUMENTS Last Edited: 2012-07-09 1 Navigate the document interface... 4 Create and Name a new document... 5 Create a new Google document... 5 Name Google documents...
How to install and use the File Sharing Outlook Plugin
How to install and use the File Sharing Outlook Plugin Thank you for purchasing Green House Data File Sharing. This guide will show you how to install and configure the Outlook Plugin on your desktop.
Data formats and file conversions
Building Excellence in Genomics and Computational Bioscience s Richard Leggett (TGAC) John Walshaw (IFR) Common file formats FASTQ FASTA BAM SAM Raw sequence Alignments MSF EMBL UniProt BED WIG Databases
A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques
Proceedings of the 2007 WSEAS International Conference on Computer Engineering and Applications, Gold Coast, Australia, January 17-19, 2007 402 A Multiple DNA Sequence Translation Tool Incorporating Web
Creating a Website with Google Sites
Creating a Website with Google Sites This document provides instructions for creating and publishing a website with Google Sites. At no charge, Google Sites allows you to create a website for various uses,
Molecular Visualization. Introduction
Molecular Visualization Jeffry D. Madura Department of Chemistry & Biochemistry Center for Computational Sciences Duquesne University Introduction Assessments of change, dynamics, and cause and effect
VPN Web Portal Usage Guide
VPN Web Portal Usage Guide Table of Contents WHAT IS VPN WEB CLIENT 4 SUPPORTED WEB BROWSERS 4 LOGGING INTO VPN WEB CLIENT 5 ESTABLISHING A VPN CONNECTION 6 KNOWN ISSUES WITH MAC COMPUTERS 6 ACCESS INTRANET
Moxa Device Manager 2.3 User s Manual
User s Manual Third Edition, March 2011 www.moxa.com/product 2011 Moxa Inc. All rights reserved. User s Manual The software described in this manual is furnished under a license agreement and may be used
Databases and mapping BWA. Samtools
Databases and mapping BWA Samtools FASTQ, SFF, bax.h5 ACE, FASTG FASTA BAM/SAM GFF, BED GenBank/Embl/DDJB many more File formats FASTQ Output format from Illumina and IonTorrent sequencers. Quality scores:
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
How to use Mints@Home
How to use Mints@Home Citrix Remote Access gives Mints users the ability to access University Of Cambridge and MINTS resources from any computer, anywhere in the world,. The service requires a high-speed
BLACKBOARD CONTENT COLLECTION FACULTY TRAINING GUIDE
BLACKBOARD CONTENT COLLECTION FACULTY TRAINING GUIDE Table of Contents About the Guide... 1 Overview... 2 Navigating the Content Collection... 3 Accessing the Content Collection... 3 Content Collection
Ansur Test Executive. Users Manual
Ansur Test Executive Users Manual April 2008 2008 Fluke Corporation, All rights reserved. All product names are trademarks of their respective companies Table of Contents 1 Introducing Ansur... 4 1.1 About
Statel Robot Service Help. 2004... Eurostat
Statel Robot Service Help 2 SRS help 1 Introduction 1.1 Overview The objective of the STATEL Robot Service is to provide an automatic tool to automate file transfer in a process pipeline using STATEL.
Next generation sequencing (NGS)
Next generation sequencing (NGS) Vijayachitra Modhukur BIIT [email protected] 1 Bioinformatics course 11/13/12 Sequencing 2 Bioinformatics course 11/13/12 Microarrays vs NGS Sequences do not need to be known
SIMIAN systems. Sitellite Desktop User Manual. Sitellite Professional Edition
Sitellite Desktop User Manual Sitellite Professional Edition Introduction The Sitellite Desktop is a cross-platform desktop application that can manage one or more Sitellite 5-powered websites in a more
Clone Manager. Getting Started
Clone Manager for Windows Professional Edition Volume 2 Alignment, Primer Operations Version 9.5 Getting Started Copyright 1994-2015 Scientific & Educational Software. All rights reserved. The software
DOCUMENT MANAGEMENT SYSTEM
DOCUMENT MANAGEMENT SYSTEM USER S MANUAL By: MIS Department Software Division Page 1 of 14 1. Overview Document Management System is a powerful web based file manager and storage utility. It was developed
PyRy3D: a software tool for modeling of large macromolecular complexes MODELING OF STRUCTURES FOR LARGE MACROMOLECULAR COMPLEXES
MODELING OF STRUCTURES FOR LARGE MACROMOLECULAR COMPLEXES PyRy3D is a method for building low-resolution models of large macromolecular complexes. The components (proteins, nucleic acids and any other
Manual Client Management Software HDR50-CMS
Manual Client Management Software HDR50-CMS HDR50-CMS (Client Management Software) A-1. Install HDR50-CMS for Windows PC HDR50-CMS is a program for communication between DVR and PC to control signal and
WinTask x64 Scheduler for Windows 7 64 bit, Windows 8/8.1 64 bit and Windows 2008 R2 64 bit. Scheduler Quick Start Guide
WinTask x64 Scheduler for Windows 7 64 bit, Windows 8/8.1 64 bit and Windows 2008 R2 64 bit Scheduler Quick Start Guide 2 INTRODUCTION 5 CHAPTER I : INSTALLATION 7 CHAPTER II : SET UP YOUR FIRST SCHEDULED
3D structure visualization and high quality imaging. Chimera
3D structure visualization and high quality imaging. Chimera Vincent Zoete 2008 Contact : vincent.zoete@isb sib.ch 1/27 Table of Contents Presentation of Chimera...3 Exercise 1...4 Loading a structure
Quickstart Tutorial. Bradford Technologies, Inc. 302 Piercy Road, San Jose, California 95138 800-622-8727 fax 408-360-8529 www.bradfordsoftware.
Quickstart Tutorial A ClickFORMS Tutorial Page 2 Bradford Technologies. All Rights Reserved. No part of this document may be reproduced in any form or by any means without the written permission of Bradford
BIOC351: Proteins. PyMOL Laboratory #1. Installing and Using
BIOC351: Proteins PyMOL Laboratory #1 Installing and Using Information and figures for this handout was obtained from the following sources: Introduction to PyMOL (2009) DeLano Scientific LLC. Installing
WatchDox for Mac User Guide
WatchDox for Mac User Guide Version 2.3.0 Confidentiality This document contains confidential material that is proprietary to WatchDox. The information and ideas herein may not be disclosed to any unauthorized
Integrated Open-Source Geophysical Processing and Visualization
Integrated Open-Source Geophysical Processing and Visualization Glenn Chubak* University of Saskatchewan, Saskatoon, Saskatchewan, Canada [email protected] and Igor Morozov University of Saskatchewan,
Zoom Plug-ins for Adobe
= Zoom Plug-ins for Adobe User Guide Copyright 2010 Evolphin Software. All rights reserved. Table of Contents Table of Contents Chapter 1 Preface... 4 1.1 Document Revision... 4 1.2 Audience... 4 1.3 Pre-requisite...
X Series Application Note 43:
X Series Application Note 43: Using the Remote Viewing & Web Pages of the X - Series & GR Series Recorders The Remote Viewing function of the X-Series and GR Series Recorders provide the user with the
Tutorial Guide to the IS Unix Service
Tutorial Guide to the IS Unix Service The aim of this guide is to help people to start using the facilities available on the Unix and Linux servers managed by Information Services. It refers in particular
Software Development Kit
Open EMS Suite by Nokia Software Development Kit Functional Overview Version 1.3 Nokia Siemens Networks 1 (21) Software Development Kit The information in this document is subject to change without notice
For Introduction to Java Programming, 5E By Y. Daniel Liang
Supplement H: NetBeans Tutorial For Introduction to Java Programming, 5E By Y. Daniel Liang This supplement covers the following topics: Getting Started with NetBeans Creating a Project Creating, Mounting,
Q N X S O F T W A R E D E V E L O P M E N T P L A T F O R M v 6. 4. 10 Steps to Developing a QNX Program Quickstart Guide
Q N X S O F T W A R E D E V E L O P M E N T P L A T F O R M v 6. 4 10 Steps to Developing a QNX Program Quickstart Guide 2008, QNX Software Systems GmbH & Co. KG. A Harman International Company. All rights
Smoke Density Monitor application documentation
Smoke Density Monitor application documentation Navigating the User interface Fig. 1 Screen shot of the application layout. Description Graphical Monitor Data Browser Trending Graph Alarm View Create Report
User Guide Win7Zilla
User Guide Win7Zilla Table of contents Section 1: Installation... 3 1.1 System Requirements... 3 1.2 Software Installation... 3 1.3 Uninstalling Win7Zilla software... 3 Section 2: Navigation... 4 2.1 Main
Geneious 4.0.2. Biomatters Ltd
Geneious 4.0.2 Biomatters Ltd 17th September 2008 2 Contents 1 Getting Started 7 1.1 Downloading & Installing Geneious.......................... 7 1.2 Using Geneious for the first time............................
Personal Computer Checklist (Google Chrome) RealPage, Inc.
Personal Computer Checklist (Google Chrome) RealPage, Inc. IMPORTANT NOTICE: YOUR USE OF THESE MATERIALS SHALL BE DEEMED TO CONSTITUTE YOUR AGREEMENT THAT SUCH USE SHALL BE GOVERNED BY THE MUTUAL NON-
End User Guide. July 22, 2015
End User Guide July 22, 2015 1 Contents Quick Start 3 General Features 4 Mac/Windows Sharing 15 Android/ ios Sharing 16 Device Compatibility Guide 17 Windows Aero Theme Requirement 18 2 Quick Start For
Getting Started With LP360
Getting Started With LP360 10/30/2014 1 Contents What is LP360?... 3 System Requirements... 3 Installing LP360... 4 How to Enable the LP360 Extension... 4 How to Display the LP360 Toolbar... 4 How to Import
Processing Data with rsmap3d Software Services Group Advanced Photon Source Argonne National Laboratory
Processing Data with rsmap3d Software Services Group Advanced Photon Source Argonne National Laboratory Introduction rsmap3d is an application for producing 3D reciprocal space maps from x-ray diffraction
STEP BY STEP IIS, DotNET and SQL-Server Installation for an ARAS Innovator9x Test System
STEP BY STEP IIS, DotNET and SQL-Server Installation for an ARAS Innovator9x Test System Abstract The intention of this document is to ensure successful installation of 3rd-Party software required for
BusinessObjects Enterprise InfoView User's Guide
BusinessObjects Enterprise InfoView User's Guide BusinessObjects Enterprise XI 3.1 Copyright 2009 SAP BusinessObjects. All rights reserved. SAP BusinessObjects and its logos, BusinessObjects, Crystal Reports,
Using the SAS Enterprise Guide (Version 4.2)
2011-2012 Using the SAS Enterprise Guide (Version 4.2) Table of Contents Overview of the User Interface... 1 Navigating the Initial Contents of the Workspace... 3 Useful Pull-Down Menus... 3 Working with
CODESOFT Installation Scenarios
CODESOFT Installation Scenarios NOTES: CODESOFT is a separate install from existing versions of CODESOFT. You will need to make note of your current settings (default directories, etc.) so you can duplicate
A QUICK OVERVIEW OF THE OMNeT++ IDE
Introduction A QUICK OVERVIEW OF THE OMNeT++ IDE The OMNeT++ 4.x Integrated Development Environment is based on the Eclipse platform, and extends it with new editors, views, wizards, and additional functionality.
MENDELEY USING GUIDE CITATION TOOLS CONTENT. Gain access Mendeley Institutional account
MENDELEY USING GUIDE CONTENT Gain access Mendeley Institutional account Create new Mendeley Institutional account Upgrade existing free Mendeley account Start Using Mendeley Download the desktop program
Advanced Event Viewer Manual
Advanced Event Viewer Manual Document version: 2.2944.01 Download Advanced Event Viewer at: http://www.advancedeventviewer.com Page 1 Introduction Advanced Event Viewer is an award winning application
10 STEPS TO YOUR FIRST QNX PROGRAM. QUICKSTART GUIDE Second Edition
10 STEPS TO YOUR FIRST QNX PROGRAM QUICKSTART GUIDE Second Edition QNX QUICKSTART GUIDE A guide to help you install and configure the QNX Momentics tools and the QNX Neutrino operating system, so you can
Comparing Methods for Identifying Transcription Factor Target Genes
Comparing Methods for Identifying Transcription Factor Target Genes Alena van Bömmel (R 3.3.73) Matthew Huska (R 3.3.18) Max Planck Institute for Molecular Genetics Folie 1 Transcriptional Regulation TF
Reference Manual DATAKIT
Reference Manual DATAKIT 1 PRELUDE This documentation defines the whole features of the application CrossManager, designed to convert 2D and 3D models from a list of available input formats into one of
Visualization with OpenDX
Alexey I. Baranov Visualization with OpenDX User s Guide Springer Contents 1 Visualization with OpenDX..................................... 1 1.1 OpenDX module installation.................................
Using the Synchronization Client
Using the Synchronization Client The owncloud Desktop Client remains in the background and is visible as an icon in the system tray (Windows, KDE), status bar (Mac OS X), or notification area (Linux).
AVG 8.5 Anti-Virus Network Edition
AVG 8.5 Anti-Virus Network Edition User Manual Document revision 85.2 (23. 4. 2009) Copyright AVG Technologies CZ, s.r.o. All rights reserved. All other trademarks are the property of their respective
MultiExperiment Viewer Quickstart Guide
MultiExperiment Viewer Quickstart Guide Table of Contents: I. Preface - 2 II. Installing MeV - 2 III. Opening a Data Set - 2 IV. Filtering - 6 V. Clustering a. HCL - 8 b. K-means - 11 VI. Modules a. T-test
Phylogenetic Trees Made Easy
Phylogenetic Trees Made Easy A How-To Manual Fourth Edition Barry G. Hall University of Rochester, Emeritus and Bellingham Research Institute Sinauer Associates, Inc. Publishers Sunderland, Massachusetts
Insight Video Net. LLC. CMS 2.0. Quick Installation Guide
Insight Video Net. LLC. CMS 2.0 Quick Installation Guide Table of Contents 1. CMS 2.0 Installation 1.1. Software Required 1.2. Create Default Directories 1.3. Create Upload User Account 1.4. Installing
5nine Hyper-V Commander
5nine Hyper-V Commander 5nine Hyper-V Commander provides a local graphical user interface (GUI), and a Framework to manage Hyper-V R2 server and various functions such as Backup/DR, HA and P2V/V2V. It
Viewing and Troubleshooting Perfmon Logs
CHAPTER 7 To view perfmon logs, you can download the logs or view them locally. This chapter contains information on the following topics: Viewing Perfmon Log Files, page 7-1 Working with Troubleshooting
How To Test Your Web Site On Wapt On A Pc Or Mac Or Mac (Or Mac) On A Mac Or Ipad Or Ipa (Or Ipa) On Pc Or Ipam (Or Pc Or Pc) On An Ip
Load testing with WAPT: Quick Start Guide This document describes step by step how to create a simple typical test for a web application, execute it and interpret the results. A brief insight is provided
Instructions for installing Citrix Receiver
Instructions for installing Citrix Receiver Remote Access End User Reference Guide for Access to SJLinked Version 1.0 4/21/2014 Contents Introduction... 2 Installing Citrix Receiver for Windows... 3 Before
13 Managing Devices. Your computer is an assembly of many components from different manufacturers. LESSON OBJECTIVES
LESSON 13 Managing Devices OBJECTIVES After completing this lesson, you will be able to: 1. Open System Properties. 2. Use Device Manager. 3. Understand hardware profiles. 4. Set performance options. Estimated
User s Guide The SimSphere Biosphere/Atmosphere Modeling Tool
User s Guide The SimSphere Biosphere/Atmosphere Modeling Tool User s Guide Revision 11/1/00 Contents Introduction 3 1. SimSphere Modeling Tool Overview 4 System Requirements 4 Your User Status 4 Main Menu
17 April 2014. Remote Scan
17 April 2014 Remote Scan 2014 Electronics For Imaging. The information in this publication is covered under Legal Notices for this product. Contents 3 Contents...5 Accessing...5 Mailboxes...5 Connecting
UNICORN 7.0. Administration and Technical Manual
UNICORN 7.0 Administration and Technical Manual Page intentionally left blank Table of Contents Table of Contents 1 Introduction... 1.1 Administrator functions overview... 1.2 Network terms and concepts...
