Statistical modeling of non-coding DNA
|
|
|
- Philip Hunt
- 8 years ago
- Views:
Transcription
1 Statistical modeling of non-coding DNA 25/06/03 Infmeeting, Genova June 2003
2 Overview Investigation of Inverted Repeats (IRs) in complete genomes of bacteria; IReD a web server of Inverted Repeats in Bacteria; Density and robustness of coding information in the human complete genome; Inverted repeats in complete genomes of Viruses; 25/06/03 Infmeeting, Genova June
3 The OCS team Fabrizio Lillo Salvatore Miccichè Markus Kollmann Rosario N. Mantegna 25/06/03 Infmeeting, Genova June
4 Inverted Repeats in Bacteria TGGGTCTGCTAAATATTTAGCAGACCAAAGTTG GGTCTGCTAAATATTTAGCAGACCCAA A single strand DNA (or RNA) can present a nucleotide sequence (IR) allowing the formation of a hairpin structure (in RNA) or of a cruciform structure (in DNA). work done by F. Lillo and S. Basile 25/06/03 Infmeeting, Genova June
5 Stem Loop Statistical modeling of non-coding DNA Stem and loop in IRs T T A T C C T A G T T A T A G G A T G G 25/06/03 Infmeeting, Genova June
6 Statistical modeling of non-coding DNA Biological role of Irs in bacteria Inverted repeats may form hairpin structures in mrna and play the role of Rho-independent transcription terminator 25/06/03 Infmeeting, Genova June
7 IRs might have regulatory function Example: In the presence of tryptophan, E. coli makes an RNA corresponding to about the 5' most 140 nt of trp operon mrna. In the absence of tryptophan, a full length RNA is made. 25/06/03 Infmeeting, Genova June
8 8 archaebacteria The set of investigated genomes A. pernix B. fulgidus Halobacterium M. jannaschii M. thermoautotrophicum P. abyssi P. horikoshii T. acidophilum 5 chlamydiales C. pneumoniae AR39 C. pneumoniae CWL029 C. pneumoniae J138 C. trachomatis C. trachomatis ser D 6 firmicutes B. halodurans B. subtilis M. genitalium M. pneumoniae U. urealyticum M. tubercolosis 25/06/03 Infmeeting, Genova June
9 The set of investigated genomes 12 proteobacteria R. prowazekii N. meningitidis ser A N. meningitidis ser B C. jejuni H. pylori H. pylory J99 Buchnera sp. E. coli H. influenzae P. aeruginosa V. cholerae Chr I V. cholerae Chr II X. fastidiosa 6 others A. aeolicus B. burgdorferi T. pallidum D. radiodurans Chr I D. radiodurans Chr II Synechocystis sp. T. maritima 37 complete genomes! 77.8 million base pairs 25/06/03 Infmeeting, Genova June
10 ex Null hypothesis A null hypothesis for the expected number n ex of IRs of stem length l and loop length m can be done by assuming a Bernoullian DNA ( ) ( ) 2 l, m = N 1 2P P 2P P ( 2P P + P P ) l n 2 A T N is the length of the genome and P x is the probability of nucleotide x C G A T C G 25/06/03 Infmeeting, Genova June
11 l l a 5 10 m 5 10 m Number of detected IRs b c d e 5 10 m 5 10 m 5 10 m (a) A. fulgidus (b) C. pneumoniae CWL029 (c) E. coli (d) B. subtilis (e) Synechocystis sp. In most cases (but not all) IRs are more abundant than expected by the null hypothesis. The number of IRs depends on m!! 25/06/03 Infmeeting, Genova June
12 % of IR in ncdna Coding vs noncoding I II III IV V ratio nc/cod đ l=6 đ l=7 đ l=8 đ l>8 In eubacteris IRs with a long stem are preferentially located in noncoding regions 25/06/03 Infmeeting, Genova June
13 Is there a preferential location of IRs? For different regions of intergenic DNA exist (ii) cn intergenic (5 5 ) e s s e (i) nn intergenic (3 5 ) s e s e (ii) cc intergenic (5 3 ) e s e s (ii) nc intergenic (3 3 ) s e e s 25/06/03 Infmeeting, Genova June
14 P(d) P(d) P(d) P(d) Is there a preferential location of IRs? l=6 E. coli l= l= l> d 5 (nt) l= l= l= l> d 3 (nt) IRs with a long stem preferentially locate at approx 40 bp nearby a 3 end of a coding region 25/06/03 Infmeeting, Genova June
15 P(d 3 ) P(d 3 ) P(d 3 ) a b c d 3 (nt) Other examples d e d 3 (nt) f Legend (a) B. halodurans (b) B. subtilis (c) N. meningitidis ser B (d) E. coli (e) P. aeruginosa (f) V. cholerae Chr I 25/06/03 Infmeeting, Genova June
16 Are all this IRs transcription terminators? The set of IRs we find is bigger of the set of rho-independent transcription terminators found by Ermolaeva et al with bioinformatics methods based on biological information obtained from E. coli Ermolaeva M.D., Khalak H.G., White O., Smith H.O., Salzberg S.L., Prediction of transcription terminators in bacterial genomes, J. Mol. Biol. 301, (2000) 25/06/03 Infmeeting, Genova June
17 An IR web server: IReD Realized by: Tiziana Castrignanò 1, Fabrizio Lillo 2, Alessandro Canali 1, Antonella Pintus 1, Rosario N. Mantegna 2 1 Caspur ; 2 OCS INFM Palermo 25/06/03 Infmeeting, Genova June
18 IReD IReD is a large collection of inverted repeat DNA sequences. Information about the specific sequence, location and positioning with respect to nearby coding regions of each detected inverted repeat is provided. IReD makes use of completely sequenced genomes publicly available. The present release presents a large number of inverted repeats detected in complete genomes of 84 bacteria, 16 archaea and their plasmids. IReD allows searching and browsing inverted repeats in all investigated genomes. 25/06/03 Infmeeting, Genova June
19 Browsing IRed Aeropyrum pernix View of Locus in Archaea Domain, CRENARCHAEA Family Locus Name: NC_000854, DNA circular 25/06/03 Infmeeting, Genova June
20 Statistical modeling of non-coding DNA An example of a archaebacterium Listing of Inverted (Organism Aeropyrum pernix, Chromosome, Locus NC_000854); acgttaaa 8 aaag Intergenic_NC tgttaacc 8 tg Intergenic_NC cagccccc 8 ttgggcg Intergenic_NC accccgcc 8 cccgggat Intergenic_NC aagcgttt 8 tcc Intergenic_NC ctgcccgg 8 cccac Intergenic_NC cttttagg 8 actaccgcg Intergenic_NC taggccca 8 tt Intergenic_NC ccaggggc 8 tccgggg Intergenic_NC gccaagtc 8 gaatata Intergenic_NC agacgccc 8 cagacc Intergenic_NC tttacatg 8 ca Intergenic_NC ggaagcccc 9 tg Intergenic_NC cccccgcgg 9 gg Intergenic_NC ccagccccc 9 acaggcgc Intergenic_NC caaaacttc 9 ttgagg Intergenic_NC gcctcctag 9 cct Intergenic_NC ttagataggc 10 attcaacacca Intergenic_NC ccccccggcg 10 gg Intergenic_NC Total of 20 IRs ttagataggc 10 attcaacatca Intergenic_NC /06/03 Infmeeting, Genova June
21 Statistical modeling of non-coding DNA An example of a purple bacterium Escherichia coli K12 View of Locus in Bacteria Domain, PURPLE Family Locus Name: NC_000913, DNA circular 25/06/03 Infmeeting, Genova June
22 IRs in E. coli aatgccgg 8 gtaacaat Intergenic_NC ctccccca 8 aagttaagg Intergenic_NC ttgccgga 8 aca Intergenic_NC gcgcctgc 8 cgggtagta Intergenic_NC gcctgata 8 agcgcagcg Intergenic_NC ggggcaac 8 attta Intergenic_NC gccacggt 8 ataa Intergenic_NC aagtggct 8 tgaggg Intergenic_NC ggcttttt 8 tatggcatt Intergenic_NC gccggagg 8 aaacttg Intergenic_NC taagtaat 8 tattacagg Intergenic_NC 94 5 gcccgtcc 8 agtggc Intergenic_NC aagccctc 8 aacgc Intergenic_NC 9 19 aagccgca 8 tg Intergenic_NC aaccgggg 8 tttcgg Intergenic_NC agcccgct 8 tttc Intergenic_NC caaaatca 8 aaataatg Intergenic_NC accgccgg 8 taacc Intergenic_NC caactggc 8 tgtc Intergenic_NC gccggatg 8 cgacgtaacca Intergenic_NC The first 20 IRs of 294 found 25/06/03 Infmeeting, Genova June
23 Human-mouse genomes comparison The idea is to use the human-mouse most conserved DNA regions to select regions of the human genomes whose function may or may not be known There are highly conserved sequences both in coding and in noncoding regions 25/06/03 Infmeeting, Genova June
24 Statistical modeling of non-coding DNA Extreme value statistics of n-gram Shannon Entropy Human complete genome DNA sequences highly conserved (>75%) between mouse and human DNA work done by Markus Kollmann 25/06/03 Infmeeting, Genova June
25 IRs in complete genomes of viruses There are 746 complete genomes of viruses completely sequenced They are classified as D satellite 40 D retroid 76 D ss RNA D ss RNA - 33 D ds RNA 20 D ss DNA 99 D ds DNA 198 D others 8 The length is varying from a minimum of 220 bps to a maximum of bp work done by S.Miccichè and F. Lillo 25/06/03 Infmeeting, Genova June
26 p value Cumulative probability IRs in complete genomes of viruses Complete genomes of viruses (746) p value We perform a χ 2 test to evaluate if the number of detected IRs is compatible with the null hypothesis of Bernoullian DNA p-values are less than 0.05 in 67% of genomes 25/06/03 Infmeeting, Genova June
27 Conclusion DNon coding DNA sequences have interesting statistical properties in Bacteria, Eukaryotes and viruses; Dnoncoding DNA regions present a dishomogeneity in the density of information. Physicists can contribute to the dtection of this dishomogeneity to locate DNA sequences of potential biological importance. 25/06/03 Infmeeting, Genova June
28 References Fabrizio Lillo, Salvatore Basile and Rosario N. Mantegna, Comparative genomics study of inverted repeats in bacteria, Bioinformatics 18, (2002). T. Castrignanò, F. Lillo, A. Canali, A. Pintus, R.N. Mantegna, IReD Server: an Inverted Repeat Server on the web, manuscript in preparation Database: OCS pre-prints and re-prints can be downloaded at: 25/06/03 Infmeeting, Genova June
29 Acknowledge of funding: - PA Sez. G INFM; - Marie Curie host development Fellowship; - FISR A novel approach to drug design: from statistical mechanics to the screening of anti-viral drugs 25/06/03 Infmeeting, Genova June
Congruent evolution of different classes of non-coding DNA in prokaryotic genomes
4264±4271 Nucleic Acids Research, 2002, Vol. 30 No. 19 Congruent evolution of different classes of non-coding DNA in prokaryotic genomes Igor B. Rogozin, Kira S. Makarova, Darren A. Natale, Alexey N. Spiridonov,
Ecologic Genomics of DNA: Upstream Bending in Prokaryotic Promoters
Letter Ecologic Genomics of DNA: Upstream Bending in Prokaryotic Promoters Alexander Bolshoy 1,2 and Eviatar Nevo 1 1 Institute of Evolution, University of Haifa, Haifa, 31905 Israel After our analysis
Protein Structure Prediction and Analysis Tools Jianlin Cheng, PhD
Protein Structure Prediction and Analysis Tools Jianlin Cheng, PhD Assistant Professor Department of Computer Science & Informatics Institute University of Missouri, Columbia 2011 Sequence, Structure and
Genome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009
Genome and DNA Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Admin Reading: Chapters 1 & 2 Notes available in PDF format on-line (see class calendar page): http://www.soe.ucsc.edu/classes/bme110/spring09/bme110-calendar.html
Inferred thermophily of the last universal ancestor based on estimated
1 Inferred thermophily of the last universal ancestor based on estimated amino acid composition Dawn J. Brooks and Eric A. Gaucher Address: Foundation for Applied Molecular Evolution, Gainesville, Florida
Figure 1: Genome sizes of different organisms.
How big are genomes? Genomes are now being sequenced at such a rapid rate that it is fair to say that it is becoming routine. As a result, there is a growing interest in trying to understand the meaning
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
GENE REGULATION. Teacher Packet
AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures
The Ins and Outs of DNA Transfer in Thermus thermophilus
Zur Anzeige wird der QuickTime Dekompressor benötigt. Campus Riedberg, Biocenter Molecular Microbiology & Bioenergetics The Ins and Outs of DNA Transfer in Thermus thermophilus Beate Averhoff Institute
The world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.au What is Gene Expression & Gene Regulation? 1. Gene Expression
Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription
Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional
Localised Sex, Contingency and Mutator Genes. Bacterial Genetics as a Metaphor for Computing Systems
Localised Sex, Contingency and Mutator Genes Bacterial Genetics as a Metaphor for Computing Systems Outline Living Systems as metaphors Evolutionary mechanisms Mutation Sex and Localized sex Contingent
Restriction Endonucleases
Nucleic Acids and Molecular Biology 14 Restriction Endonucleases Bearbeitet von Alfred Pingoud 1. Auflage 2004. Buch. xxvi, 443 S. Hardcover ISBN 978 3 540 20502 9 Format (B x L): 15,5 x 23,5 cm Gewicht:
Coordination entre réplication et transcription: organisation du génome humain
Coordination entre réplication et transcription: organisation du génome humain Claude Thermes Centre de Génétique Moléculaire, CNRS, Gif-sur-Yvette, FRANCE 23/09/2009 REPLICATION AND GENOME ORGANIZATION
Basic Concepts of DNA, Proteins, Genes and Genomes
Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate
Gene Transcription in Prokaryotes
Gene Transcription in Prokaryotes Operons: in prokaryotes, genes that encode protein participating in a common pathway are organized together. This group of genes, arranged in tandem, is called an OPERON.
GenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
Human Genome Organization: An Update. Genome Organization: An Update
Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion
GenBank: A Database of Genetic Sequence Data
GenBank: A Database of Genetic Sequence Data Computer Science 105 Boston University David G. Sullivan, Ph.D. An Explosion of Scientific Data Scientists are generating ever increasing amounts of data. Relevant
Working with Molecular Genetics Chapter 4: Genomes and Chromosomes CHAPTER 4 GENOMES AND CHROMOSOMES
CHAPTER 4 GENOMES AND CHROMOSOMES This chapter will cover: Distinct components of genomes Abundance and complexity of mrna Normalized cdna libraries and ESTs Genome sequences: gene numbers Comparative
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
mirnaselect pep-mir Cloning and Expression Vector
Product Data Sheet mirnaselect pep-mir Cloning and Expression Vector CATALOG NUMBER: MIR-EXP-C STORAGE: -80ºC QUANTITY: 2 vectors; each contains 100 µl of bacterial glycerol stock Components 1. mirnaselect
Milestones of bacterial genetic research:
Milestones of bacterial genetic research: 1944 Avery's pneumococcal transformation experiment shows that DNA is the hereditary material 1946 Lederberg & Tatum describes bacterial conjugation using biochemical
Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.
Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.
1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
Modeling and Simulation of Gene Regulatory Networks
Modeling and Simulation of Gene Regulatory Networks Hidde de Jong INRIA Grenoble - Rhône-Alpes Hidde.de-Jong@inria.fr http://ibis.inrialpes.fr INRIA Grenoble - Rhône-Alpes and IBIS IBIS: systems biology
13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Human-Mouse Synteny in Functional Genomics Experiment
Human-Mouse Synteny in Functional Genomics Experiment Ksenia Krasheninnikova University of the Russian Academy of Sciences, JetBrains krasheninnikova@gmail.com September 18, 2012 Ksenia Krasheninnikova
Chapter 18 Regulation of Gene Expression
Chapter 18 Regulation of Gene Expression 18.1. Gene Regulation Is Necessary By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
HIGH DENSITY DATA STORAGE IN DNA USING AN EFFICIENT MESSAGE ENCODING SCHEME Rahul Vishwakarma 1 and Newsha Amiri 2
HIGH DENSITY DATA STORAGE IN DNA USING AN EFFICIENT MESSAGE ENCODING SCHEME Rahul Vishwakarma 1 and Newsha Amiri 2 1 Tata Consultancy Services, India derahul@ieee.org 2 Bangalore University, India ABSTRACT
Introduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
How To Understand How Gene Expression Is Regulated
What makes cells different from each other? How do cells respond to information from environment? Regulation of: - Transcription - prokaryotes - eukaryotes - mrna splicing - mrna localisation and translation
Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.
Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,
Title: Surveying Genome to Identify Origins of DNA Replication In Silico
Title: Surveying Genome to Identify Origins of DNA Replication In Silico Abstract: DNA replication origins are the bases to realize the process of chromosome replication and analyze the progress of cell
MATCH Commun. Math. Comput. Chem. 61 (2009) 781-788
MATCH Communications in Mathematical and in Computer Chemistry MATCH Commun. Math. Comput. Chem. 61 (2009) 781-788 ISSN 0340-6253 Three distances for rapid similarity analysis of DNA sequences Wei Chen,
BME 42-620 Engineering Molecular Cell Biology. Lecture 02: Structural and Functional Organization of
BME 42-620 Engineering Molecular Cell Biology Lecture 02: Structural and Functional Organization of Eukaryotic Cells BME42-620 Lecture 02, September 01, 2011 1 Outline A brief review of the previous lecture
A Tutorial in Genetic Sequence Classification Tools and Techniques
A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University jakemdrew@gmail.com www.jakemdrew.com Sequence Characters IUPAC nucleotide
FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem
FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert September 24, 2013 Abstract FlipFlop implements a fast method for de novo transcript
Complex multicellular organisms are produced by cells that switch genes on and off during development.
Home Control of Gene Expression Gene Regulation Is Necessary? By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
Molecular Cell Biology WS2011
Molecular Cell Biology WS2011 Lecturer: Dr. Andreas Prokesch, Inst. for Genomics and Bioinformatics, TUG Purpose of this series of lectures: to offer you the basic knowledge required to know and understand
Microarray Data Analysis Workshop. Custom arrays and Probe design Probe design in a pangenomic world. Carsten Friis. MedVetNet Workshop, DTU 2008
Microarray Data Analysis Workshop MedVetNet Workshop, DTU 2008 Custom arrays and Probe design Probe design in a pangenomic world Carsten Friis Media glna tnra GlnA TnrA C2 glnr C3 C5 C6 K GlnR C1 C4 C7
Gene Switches Teacher Information
STO-143 Gene Switches Teacher Information Summary Kit contains How do bacteria turn on and turn off genes? Students model the action of the lac operon that regulates the expression of genes essential for
Control of Gene Expression
Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
DNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
Self-identification of protein-coding regions in microbial genomes
Proc. Natl. Acad. Sci. USA Vol. 95, pp. 10026 10031, August 1998 Genetics Self-identification of protein-coding regions in microbial genomes STÉPHANE AUDIC* AND JEAN-MICHEL CLAVERIE Structural and Genetic
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
RNA: Transcription and Processing
8 RNA: Transcription and Processing WORKING WITH THE FIGURES 1. In Figure 8-3, why are the arrows for genes 1 and 2 pointing in opposite directions? The arrows for genes 1 and 2 indicate the direction
Molecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
AP BIOLOGY 2007 SCORING GUIDELINES
AP BIOLOGY 2007 SCORING GUIDELINES Question 4 A bacterial plasmid is 100 kb in length. The plasmid DNA was digested to completion with two restriction enzymes in three separate treatments: EcoRI, HaeIII,
Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011
Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear
Genetics Test Biology I
Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the
Chapter 11: Molecular Structure of DNA and RNA
Chapter 11: Molecular Structure of DNA and RNA Student Learning Objectives Upon completion of this chapter you should be able to: 1. Understand the major experiments that led to the discovery of DNA as
DNA as a Mass-Storage Device: 1
DNA as a Mass-Storage Device Robert J. Robbins Johns Hopkins University rrobbins@gdb.org DNA as a Mass-Storage Device: 1 Goals of the Genome Project Sequence the Genome equivalent to obtaining an image
Title : Parallel DNA Synthesis : Two PCR product from one DNA template
Title : Parallel DNA Synthesis : Two PCR product from one DNA template Bhardwaj Vikash 1 and Sharma Kulbhushan 2 1 Email: vikashbhardwaj@ gmail.com 1 Current address: Government College Sector 14 Gurgaon,
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
trna Processing and Modification
trna Processing and Modification RNA POL III - TRANSCRIPTS 5S RNA, trna, repetitive Sequenzen (Alu-typ), versch. kleine stabile RNAs (7SL - RNA vom signal recognition particle (SRP)), U6 RNA 5S RNA nicht
Module 1. Sequence Formats and Retrieval. Charles Steward
The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.
Given these characteristics of life, which of the following objects is considered a living organism? W. X. Y. Z.
Cell Structure and Organization 1. All living things must possess certain characteristics. They are all composed of one or more cells. They can grow, reproduce, and pass their genes on to their offspring.
Frequently Asked Questions Next Generation Sequencing
Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided
Recombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA
DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence
Outline. MicroRNA Bioinformatics. microrna biogenesis. short non-coding RNAs not considered in this lecture. ! Introduction
Outline MicroRNA Bioinformatics Rickard Sandberg Dept. of Cell and Molecular Biology (CMB) Karolinska Institutet! Introduction! microrna target site prediction! Useful resources 2 short non-coding RNAs
Introduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
Special report. Chronic Lymphocytic Leukemia (CLL) Genomic Biology 3020 April 20, 2006
Special report Chronic Lymphocytic Leukemia (CLL) Genomic Biology 3020 April 20, 2006 Gene And Protein The gene that causes the mutation is CCND1 and the protein NP_444284 The mutation deals with the cell
HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:
HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone
Next Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?
Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.
Transmission of genetic variation: conjugation. Transmission of genetic variation: conjugation
Transmission of genetic variation: conjugation Transmission of genetic variation: conjugation Bacterial Conjugation is genetic recombination in which there is a transfer of DNA from a living donor bacterium
MIBIE Summer School 2014. Molecular diagnostics of UTI & STI by using PCR, DHPLC and NGS
MIBIE Summer School 2014 Molecular diagnostics of UTI & STI by using PCR, DHPLC and NGS Eugen Domann Institute for Medical Microbiology Justus-Liebig University Gießen Human microbiome 14 Superorganism
MICROBIAL GENETICS. Gene Regulation: The Operons
MICROBIAL GENETICS Gene Regulation: The Operons Pradeep Kumar Burma Reader Department of Genetics University of Delhi South Campus Benito Juarez Road New Delhi-110021 E-mail: pburma@hotmail.com 05-May-2006
Sample Questions for Exam 3
Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.
Gene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
mrna EDITING Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005
mrna EDITING mrna EDITING http://dbb.urmc.rochester.edu/labs/smith/research_2.htm The number of A to I sites in the human transcriptome >15;000 the vast majority of these sites occurring in Alu repeats
The search process for small targets in cellular microdomains! Jürgen Reingruber
The search process for small targets in cellular microdomains! Jürgen Reingruber Department of Computational Biology Ecole Normale Supérieure Paris, France Outline 1. Search processes in cellular biology
CCR Biology - Chapter 8 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 8 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Hershey and Chase know
MORPHEUS. http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix.
MORPHEUS http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix. Reference: MORPHEUS, a Webtool for Transcripton Factor Binding Analysis Using
The 8th Leading Special Lecture
The 8th Leading Special Lecture X ray crystal structure determination of bacterial RNA polymerase toward better understandings of antibiotic mechanism of action, resistance and new antibiotic development
OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation
OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation -Optimal strategies to a successful mirna research project Optimal strategies to a successful mirna research
Grids & Life Sciences
Grids & Life Sciences Dr Richard Sinnott Technical Director National e-science Centre Deputy Director Technical Bioinformatics Research Centre University of Glasgow 26 th March 2004 Outline What is e-science?
Transcription: RNA Synthesis, Processing & Modification
Transcription: RNA Synthesis, Processing & Modification 1 Central dogma DNA RNA Protein Reverse transcription 2 Transcription The process of making RNA from DNA Produces all type of RNA mrna, trna, rrna,
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
1.5 page 3 DNA Replication S. Preston 1
AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 3 l. DNA Replication 1. Go through PowerPoint 2. Read notes p2 and then watch the animation
Analytical Study of Hexapod mirnas using Phylogenetic Methods
Analytical Study of Hexapod mirnas using Phylogenetic Methods A.K. Mishra and H.Chandrasekharan Unit of Simulation & Informatics, Indian Agricultural Research Institute, New Delhi, India akmishra@iari.res.in,
Transcription in prokaryotes. Elongation and termination
Transcription in prokaryotes Elongation and termination After initiation the σ factor leaves the scene. Core polymerase is conducting the elongation of the chain. The core polymerase contains main nucleotide
PROYECTO GENOMA HUMANO. Medicina Molecular 2011 Maestría en Biología Molecular Médica- UBA
PROYECTO GENOMA HUMANO Medicina Molecular 2011 Maestría en Biología Molecular Médica- UBA GENOMA HUMANO Medicina Molecular 2011 Maestría en Biología Molecular Médica- UBA Some landmarks on the way to 1940s
restriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
VIRUSES. Basic virus structure. Obligate intracellular parasites. Enveloped Viruses. Classification of Viruses. Viruses. Heyer 1
Viruses VIRUSES Viruses are small packages of genes Consist of protein coat around nucleic acids ( or RNA) Viruses measured in nanometers (nm). Require electron microscopy. Obligate intracellular parasites
CRAC: An integrated approach to analyse RNA-seq reads Additional File 3 Results on simulated RNA-seq data.
: An integrated approach to analyse RNA-seq reads Additional File 3 Results on simulated RNA-seq data. Nicolas Philippe and Mikael Salson and Thérèse Commes and Eric Rivals February 13, 2013 1 Results
Biotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
Gymnázium, Brno, Slovanské nám. 7, WORKBOOK - Biology WORKBOOK. http://agb.gymnaslo.cz
WORKBOOK http://agb.gymnaslo.cz Biology Subject: Teacher: Iva Kubištová Student:.. School year:../ This material was prepared with using http://biologygmh.com/ Topics: 1. 2. 3. 4. 5. 6. Viruses and Bacteria
An example of bioinformatics application on plant breeding projects in Rijk Zwaan
An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on