An example of bioinformatics application on plant breeding projects in Rijk Zwaan
|
|
|
- Noah McCormick
- 10 years ago
- Views:
Transcription
1 An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao
2 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on the development of high-quality vegetable varieties for professional growers in food-producing horticulture, be that in glasshouses, tunnels or outdoors. Middle position in world top 10 globally-operating vegetable breeding companies Around1900 employees all over the world varieties in approximately 30 different vegetable crops Sell seeds in more than 100 different countries all over the world
3 RZ NGS projects overview. Gene prediction. SNP calling: RNA-seq, DNA. Gene expression analysis. Transcription binding site Prediction (mirna). Protein functional analysis (domain prediction, structural analysis). Orthologue gene prediction.server maintenance.g browser.snp database.species: Tomato Cucumber Melon / water melon Pepper Lettuce
4 SNP Identification for watermelon Single-nucleotide polymorphism (SNP, pronounced snip) is a DNA sequence variation occurring when a single nucleotide A, T, C or G in the genome (or other shared sequence) differs between members of a biological species or paired chromosomes in an individual. Genetic marker
5 General information Resources: RZ 900 RZ 901 (parents lines with different Phenotypes) Illumina hiseq 2000 paired end reads Reference assembly version: Watermelon V70 Purposes *Used as genetic markers for genetic mapping. *Used as genetic markers associate with certain genes or phenotypes The interesting SNPs 1. Homozygous SNPs which are different between 2 parents lines 2. Evenly distributed on the Chromosome 3. Can be uniquely amplified by PCR, then proper for SNP validation assey
6 SNP Identification workflow for watermelon BWA + picard + GATK SNP validation
7 SNP calling by GATK BWA picard
8 SNP calling result VCF format scaffold T C AC=2;AF=0.50;AN=4;BaseQRankSum=1.087;DP=34;Dels=0.00;FS=25.118;HRun=1;HaplotypeScore=1.4816;MQ=59.32;MQ0=0;MQRankSum= ;QD=41.83;ReadPosRankSum=-0.742;SB= GT:AD:DP:GQ:PL 1/1:0,18:18:54.18:794,54,0 0/0:16,0:16:48.16:0,48,716 SNPs selection criteria 1. DP > 10 GT:AD:DP:GQ:PL 1/1:0,18:18:54.18:794,54,0 0/0:16,0:16:48.16:0,48, AD ratio <=0.2 GT:AD:DP:GQ:PL 1/1:0,18:18:54.18:794,54,0 0/0:16,0:16:48.16:0,48,716 AD ratio sample1: 0/(0+18) < 0.2 alternative homozygous AD ratio sample1: 16/(0+16) > 0.8 reference homozygous homozygous SNPs found differing between RZ900 and RZ901
9 SNPs chromosome distribution
10 SNP selection Step1. generating maker sequence without flanking SNP Length: 101bp, SNP in middle with 50bp flanking marker Format: >scaffold1_10477 TAGTACATTTCTATTATTCAACTGTGAGTTATTTTCGAAGTTTTATTAAT[T/G]TTCGTTTTTTATTTATAACTTTCAATTAATTAGAAAAATAGTAAAAACT Excluding the markers with flanking SNPs >scaffold1_13888 AAATATTTTTAAATATAAGAAAGTGTCATTGTTTATCAATAATAGACACT[G/A]ATGGATAAAnATTTTGTTATGTTTGTAACTATTTTGGTTTATTGCTGT
11 SNP selection Step2. Marker selection Doing the Blast of markers against v1 genome Excluding the repetitive marker With 100% identical hits in v1 genome database
12 SNP selection Step 1 Step 2
13 SNPs Calling Reads preprocess & alignment BWA Samtools SNP calling & genotyping GATK Picard Last step selection 840 SNPs 11 Chr
14 SNP calling question 1 How to define the DP cutoff? Minimum? Maximum?
15 SNP calling question 2 What is the best measurement for the SNP quality? QUAL: The Phred scaled probability of Probability that REF/ALT polymorphism exists at this site given sequencing data. DP: The DP field describe the total depth of reads that passed the Unified Genotypers internal quality control metrics GQ: The Genotype Quality, or Phred-scaled confidence that the true genotype is the one provided in GT MQ: Root Mean Square of the mapping quality of the reads across all samples QUAL vs MQ QUAL vs DP RZ900 QUAL vs GQ RZ900
16 Conflicting between GT and AD? SNP flanking consensus sequence quality? Using non-redundant reads?
17 Other Markers (Genetic variation)? Identification of : InDels Structural variants Copy number variants Transposable elements And the prediction of their functional consequences.
18 Marcel Kerkveld Sara Movahedi Remco Ursem Raoul Frijters Xiangyu Rao
19
Towards Integrating the Detection of Genetic Variants into an In-Memory Database
Towards Integrating the Detection of Genetic Variants into an 2nd International Workshop on Big Data in Bioinformatics and Healthcare Oct 27, 2014 Motivation Genome Data Analysis Process DNA Sample Base
Focusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
Next Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University [email protected] http://tandem.bu.edu/ The Human Genome Project took
Practical Guideline for Whole Genome Sequencing
Practical Guideline for Whole Genome Sequencing Disclosure Kwangsik Nho Assistant Professor Center for Neuroimaging Department of Radiology and Imaging Sciences Center for Computational Biology and Bioinformatics
Introduction to NGS data analysis
Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High
How-To: SNP and INDEL detection
How-To: SNP and INDEL detection April 23, 2014 Lumenogix NGS SNP and INDEL detection Mutation Analysis Identifying known, and discovering novel genomic mutations, has been one of the most popular applications
-> Integration of MAPHiTS in Galaxy
Enabling NGS Analysis with(out) the Infrastructure, 12:0512 Development of a workflow for SNPs detection in grapevine From Sets to Graphs: Towards a Realistic Enrichment Analy species: MAPHiTS -> Integration
How Sequencing Experiments Fail
How Sequencing Experiments Fail v1.0 Simon Andrews [email protected] Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine
Analysis of NGS Data
Analysis of NGS Data Introduction and Basics Folie: 1 Overview of Analysis Workflow Images Basecalling Sequences denovo - Sequencing Assembly Annotation Resequencing Alignments Comparison to reference
School of Nursing. Presented by Yvette Conley, PhD
Presented by Yvette Conley, PhD What we will cover during this webcast: Briefly discuss the approaches introduced in the paper: Genome Sequencing Genome Wide Association Studies Epigenomics Gene Expression
Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment
Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249
A Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Genomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
Custom TaqMan Assays For New SNP Genotyping and Gene Expression Assays. Design and Ordering Guide
Custom TaqMan Assays For New SNP Genotyping and Gene Expression Assays Design and Ordering Guide For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in
Introduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]
Text file One header line meta information lines One line : variant/position
Software Calling: GATK SAMTOOLS mpileup Varscan SOAP VCF format Text file One header line meta information lines One line : variant/position ##fileformat=vcfv4.1! ##filedate=20090805! ##source=myimputationprogramv3.1!
New solutions for Big Data Analysis and Visualization
New solutions for Big Data Analysis and Visualization From HPC to cloud-based solutions Barcelona, February 2013 Nacho Medina [email protected] http://bioinfo.cipf.es/imedina Head of the Computational Biology
Assuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice. Supplementary Guidelines
Assuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice Next-generation Sequencing: Standardization of Clinical Testing (Nex-StoCT) Workgroup Principles and Guidelines Supplementary
Challenges associated with analysis and storage of NGS data
Challenges associated with analysis and storage of NGS data Gabriella Rustici Research and training coordinator Functional Genomics Group [email protected] Next-generation sequencing Next-generation sequencing
Next generation sequencing (NGS)
Next generation sequencing (NGS) Vijayachitra Modhukur BIIT [email protected] 1 Bioinformatics course 11/13/12 Sequencing 2 Bioinformatics course 11/13/12 Microarrays vs NGS Sequences do not need to be known
Single Nucleotide Polymorphisms (SNPs)
Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded
CloudMap: A Cloud-based Pipeline for Analysis of Mutant Genome Sequences
Genetics: Advance Online Publication, published on October 10, 2012 as 10.1534/genetics.112.144204 CloudMap: A Cloud-based Pipeline for Analysis of Mutant Genome Sequences Gregory Minevich 1,, Danny S.
8/7/2012. Experimental Design & Intro to NGS Data Analysis. Examples. Agenda. Shoe Example. Breast Cancer Example. Rat Example (Experimental Design)
Experimental Design & Intro to NGS Data Analysis Ryan Peters Field Application Specialist Partek, Incorporated Agenda Experimental Design Examples ANOVA What assays are possible? NGS Analytical Process
BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis
BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis By the end of this lab students should be able to: Describe the uses for each line of the DNA subway program (Red/Yellow/Blue/Green) Describe
Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
Big Data Healthcare. Fei Wang Associate Professor Department of Computer Science and Engineering School of Engineering University of Connecticut
Big Data Healthcare Fei Wang Associate Professor Department of Computer Science and Engineering School of Engineering University of Connecticut Healthcare Is in Crisis Hersh, W., Jacko, J. A., Greenes,
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
CHALLENGES IN NEXT-GENERATION SEQUENCING
CHALLENGES IN NEXT-GENERATION SEQUENCING BASIC TENETS OF DATA AND HPC Gray s Laws of data engineering 1 : Scientific computing is very dataintensive, with no real limits. The solution is scale-out architecture
2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
Typing in the NGS era: The way forward!
Typing in the NGS era: The way forward! Valeria Michelacci NGS course, June 2015 Typing from sequence data NGS-derived conventional Multi Locus Sequence Typing (University of Warwick, 7 housekeeping genes)
Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center
Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing
Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples
DATA Sheet Single-Cell DNA Sequencing with the C 1 Single-Cell Auto Prep System Reveal hidden populations and genetic diversity within complex samples Single-cell sensitivity Discover and detect SNPs,
HiSeq Analysis Software v0.9 User Guide
HiSeq Analysis Software v0.9 User Guide FOR RESEARCH USE ONLY Quick Start 4 Introduction 5 Enrichment Analysis Workflow 6 Whole Genome Sequencing Analysis Workflow 8 Additional Software 12 Installing HiSeq
Genomic Testing: Actionability, Validation, and Standard of Lab Reports
Genomic Testing: Actionability, Validation, and Standard of Lab Reports emerge: Laura Rasmussen-Torvik Reaction: Heidi Rehm Summary: Dick Weinshilboum Panel: Murray Brilliant, David Carey, John Carpten,
Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe
Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. To published results faster With proven scalability To the forefront of discovery To limitless applications
Genetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
NECC History. Karl V. Steiner 2011 Annual NECC Meeting, Orono, Maine March 15, 2011
NECC History Karl V. Steiner 2011 Annual NECC Meeting, Orono, Maine March 15, 2011 EPSCoR Cyberinfrastructure Workshop First regional NENI (now NECC) Workshop held in Vermont in August 2007 Workshop heldinkentucky
Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation
PN 100-9879 A1 TECHNICAL NOTE Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation Introduction Cancer is a dynamic evolutionary process of which intratumor genetic and phenotypic
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data The Illumina TopHat Alignment and Cufflinks Assembly and Differential Expression apps make RNA data analysis accessible to any user, regardless
Accelerating variant calling
Accelerating variant calling Mauricio Carneiro GSA Broad Institute Intel Genomic Sequencing Pipeline Workshop Mount Sinai 12/10/2013 This is the work of many Genome sequencing and analysis team Mark DePristo
SAP HANA Enabling Genome Analysis
SAP HANA Enabling Genome Analysis Joanna L. Kelley, PhD Postdoctoral Scholar, Stanford University Enakshi Singh, MSc HANA Product Management, SAP Labs LLC Outline Use cases Genomics review Challenges in
Biomedical Big Data and Precision Medicine
Biomedical Big Data and Precision Medicine Jie Yang Department of Mathematics, Statistics, and Computer Science University of Illinois at Chicago October 8, 2015 1 Explosion of Biomedical Data 2 Types
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
Research Roadmap for the Future. National Grape and Wine Initiative March 2013
Research Roadmap for the Future National Grape and Wine Initiative March 2013 Objective of Today s Meeting Our mission drives the roadmap Our Mission Drive research to maximize productivity, sustainability
Delivering the power of the world s most successful genomics platform
Delivering the power of the world s most successful genomics platform NextCODE Health is bringing the full power of the world s largest and most successful genomics platform to everyday clinical care NextCODE
SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications
Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each
Welcome to the Plant Breeding and Genomics Webinar Series
Welcome to the Plant Breeding and Genomics Webinar Series Today s Presenter: Dr. Candice Hansey Presentation: http://www.extension.org/pages/ 60428 Host: Heather Merk Technical Production: John McQueen
The Human Genome Project. From genome to health From human genome to other genomes and to gene function Structural Genomics initiative
The Human Genome Project From genome to health From human genome to other genomes and to gene function Structural Genomics initiative June 2000 What is the Human Genome Project? U.S. govt. project coordinated
Next Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
Data Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
NGS data analysis. Bernardo J. Clavijo
NGS data analysis Bernardo J. Clavijo 1 A brief history of DNA sequencing 1953 double helix structure, Watson & Crick! 1977 rapid DNA sequencing, Sanger! 1977 first full (5k) genome bacteriophage Phi X!
Module 1. Sequence Formats and Retrieval. Charles Steward
The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
Commonly Used STR Markers
Commonly Used STR Markers Repeats Satellites 100 to 1000 bases repeated Minisatellites VNTR variable number tandem repeat 10 to 100 bases repeated Microsatellites STR short tandem repeat 2 to 6 bases repeated
DNA Sequencing & The Human Genome Project
DNA Sequencing & The Human Genome Project An Endeavor Revolutionizing Modern Biology Jutta Marzillier, Ph.D Lehigh University Biological Sciences November 13 th, 2013 Guess, who turned 60 earlier this
Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University
Genotyping by sequencing and data analysis Ross Whetten North Carolina State University Stein (2010) Genome Biology 11:207 More New Technology on the Horizon Genotyping By Sequencing Timeline 2007 Complexity
European Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
SEQUENCING. From Sample to Sequence-Ready
SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major
Innovations in Molecular Epidemiology
Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether
G E N OM I C S S E RV I C ES
GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E
Bioinformatics Unit Department of Biological Services. Get to know us
Bioinformatics Unit Department of Biological Services Get to know us Domains of Activity IT & programming Microarray analysis Sequence analysis Bioinformatics Team Biostatistical support NGS data analysis
Next generation DNA sequencing technologies. theory & prac-ce
Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing
Workflow. Reference Genome. Variant Calling. Galaxy Format Conversion --------- Groomer. Mapping --------- BWA GATK --------- Preprocess
Workflow Fastq Reference Genome Galaxy Format Conversion --------- Groomer Quality Control --------- FastQC Mapping --------- BWA Format conversion --------- Sam-to-Bam Removing PCR duplicates ---------
Next Generation Sequence Analysis and Computational Genomics Using Graphical Pipeline Workflows
Genes 2012, 3, 545-575; doi:10.3390/genes3030545 Article OPEN ACCESS genes ISSN 2073-4425 www.mdpi.com/journal/genes Next Generation Sequence Analysis and Computational Genomics Using Graphical Pipeline
DNA-Analytik III. Genetische Variabilität
DNA-Analytik III Genetische Variabilität Genetische Variabilität Lexikon Scherer et al. Nat Genet Suppl 39:s7 (2007) Genetische Variabilität Sequenzvariation Mutationen (Mikro~) Basensubstitution Insertion
Genomic Selection in. Applied Training Workshop, Sterling. Hans Daetwyler, The Roslin Institute and R(D)SVS
Genomic Selection in Dairy Cattle AQUAGENOME Applied Training Workshop, Sterling Hans Daetwyler, The Roslin Institute and R(D)SVS Dairy introduction Overview Traditional breeding Genomic selection Advantages
Milk protein genetic variation in Butana cattle
Milk protein genetic variation in Butana cattle Ammar Said Ahmed Züchtungsbiologie und molekulare Genetik, Humboldt Universität zu Berlin, Invalidenstraβe 42, 10115 Berlin, Deutschland 1 Outline Background
Arabidopsis. A Practical Approach. Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham
Arabidopsis A Practical Approach Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham OXPORD UNIVERSITY PRESS List of Contributors Abbreviations xv xvu
Overview of Next Generation Sequencing platform technologies
Overview of Next Generation Sequencing platform technologies Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Outline 1. Technologies
Version 5.0 Release Notes
Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com
Simplifying Data Interpretation with Nexus Copy Number
Simplifying Data Interpretation with Nexus Copy Number A WHITE PAPER FROM BIODISCOVERY, INC. Rapid technological advancements, such as high-density acgh and SNP arrays as well as next-generation sequencing
Leading Genomics. Diagnostic. Discove. Collab. harma. Shanghai Cambridge, MA Reykjavik
Leading Genomics Diagnostic harma Discove Collab Shanghai Cambridge, MA Reykjavik Global leadership for using the genome to create better medicine WuXi NextCODE provides a uniquely proven and integrated
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms
Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).
Accelerating Data-Intensive Genome Analysis in the Cloud
Accelerating Data-Intensive Genome Analysis in the Cloud Nabeel M Mohamed Heshan Lin Wu-chun Feng Department of Computer Science Virginia Tech Blacksburg, VA 24060 {nabeel, hlin2, wfeng}@vt.edu Abstract
New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova
New generation sequencing: current limits and future perspectives Giorgio Valle CRIBI Università di Padova Around 2004 the Race for the 1000$ Genome started A few questions... When? How? Why? Standard
Biological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
Molecular typing of VTEC: from PFGE to NGS-based phylogeny
Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing
Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling
Lectures 1 and 8 15 February 7, 2013 This is a review of the material from lectures 1 and 8 14. Note that the material from lecture 15 is not relevant for the final exam. Today we will go over the material
A Complete Example of Next- Gen DNA Sequencing Read Alignment. Presentation Title Goes Here
A Complete Example of Next- Gen DNA Sequencing Read Alignment Presentation Title Goes Here 1 FASTQ Format: The de- facto file format for sharing sequence read data Sequence and a per- base quality score
Comparing Methods for Identifying Transcription Factor Target Genes
Comparing Methods for Identifying Transcription Factor Target Genes Alena van Bömmel (R 3.3.73) Matthew Huska (R 3.3.18) Max Planck Institute for Molecular Genetics Folie 1 Transcriptional Regulation TF
Data Analysis & Management of High-throughput Sequencing Data. Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute
Data Analysis & Management of High-throughput Sequencing Data Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute Current Issues Current Issues The QSEQ file Number files per
Services. Updated 05/31/2016
Updated 05/31/2016 Services 1. Whole exome sequencing... 2 2. Whole Genome Sequencing (WGS)... 3 3. 16S rrna sequencing... 4 4. Customized gene panels... 5 5. RNA-Seq... 6 6. qpcr... 7 7. HLA typing...
How To Find Rare Variants In The Human Genome
UNIVERSITÀ DEGLI STUDI DI SASSARI Scuola di Dottorato in Scienze Biomediche XXV CICLO DOTTORATO DI RICERCA IN SCIENZE BIOMEDICHE INDIRIZZO DI GENETICA MEDICA, MALATTIE METABOLICHE E NUTRIGENOMICA Direttore:
Recombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
UKB_WCSGAX: UK Biobank 500K Samples Genotyping Data Generation by the Affymetrix Research Services Laboratory. April, 2015
UKB_WCSGAX: UK Biobank 500K Samples Genotyping Data Generation by the Affymetrix Research Services Laboratory April, 2015 1 Contents Overview... 3 Rare Variants... 3 Observation... 3 Approach... 3 ApoE
SOP 3 v2: web-based selection of oligonucleotide primer trios for genotyping of human and mouse polymorphisms
W548 W552 Nucleic Acids Research, 2005, Vol. 33, Web Server issue doi:10.1093/nar/gki483 SOP 3 v2: web-based selection of oligonucleotide primer trios for genotyping of human and mouse polymorphisms Steven
What s New in Pathway Studio Web 11.1
1 1 What s New in Pathway Studio Web 11.1 Elseiver is pleased to announce the release of Pathway Studio Web 11.1 for all database subscriptions (Mammal, Mammal+ChemEffect+DiseaseFx, Plant). This release
Polymorphism of retrotransposons in Bos taurus
Polymorphism of retrotransposons in Bos taurus Bernt Guldbrandtsen Goutam Sahana Mogens Sandø Lund Center for Quantitative Genetics and Genomics Aarhus University Denmark Transposons Type of jumping genes
UNIVERSITÀ DEGLI STUDI DI SASSARI
UNIVERSITÀ DEGLI STUDI DI SASSARI Scuola di Dottorato in Scienze Biomediche Direttore: Prof. Andrea Piana XXVII CICLO DOTTORATO DI RICERCA IN SCIENZE BIOMEDICHE INDIRIZZO IN GENETICA MEDICA, MALATTIE METABOLICHE
Genomic Applications on Cray supercomputers: Next Generation Sequencing Workflow. Barry Bolding. Cray Inc Seattle, WA
Genomic Applications on Cray supercomputers: Next Generation Sequencing Workflow Barry Bolding Cray Inc Seattle, WA 1 CUG 2013 Paper Genomic Applications on Cray supercomputers: Next Generation Sequencing
Human Genome Organization: An Update. Genome Organization: An Update
Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion
NGS and complex genetics
NGS and complex genetics Robert Kraaij Genetic Laboratory Department of Internal Medicine [email protected] Gene Hunting Rotterdam Study and GWAS Next Generation Sequencing Gene Hunting Mendelian gene
Core Facility Genomics
Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray
Introduction To Epigenetic Regulation: How Can The Epigenomics Core Services Help Your Research? Maria (Ken) Figueroa, M.D. Core Scientific Director
Introduction To Epigenetic Regulation: How Can The Epigenomics Core Services Help Your Research? Maria (Ken) Figueroa, M.D. Core Scientific Director Gene expression depends upon multiple factors Gene Transcription
