mrna EDITING Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005
|
|
|
- Patricia Park
- 8 years ago
- Views:
Transcription
1 mrna EDITING
2
3 mrna EDITING
4
5 The number of A to I sites in the human transcriptome >15;000 the vast majority of these sites occurring in Alu repeats 6
6 glutamate receptor serotonin (5-HT) receptor-2c Ion-channel receptors that contain the edited GluR2 subunit are impermeable to Ca2+ the potency of the agonist-stimulated G-protein coupling activity of the fully edited receptor isoform (Val-Gly-Val) is reduced by 20-fold compared with the unedited receptor
7 RNA editing changes the lesion specificity for the DNA repair enzyme NEIL1 Whole transcriptome sequence analysis from various human tissues identified over 200 possible A to I editing sites in non repeat sequences, including a site predicted to cause recoding in the mrna for the DNA repair enzyme NEIL1 (lysine 242 AAA codon edited to AIA codon for arginine) NEIL1 plays a key role in the initiation of base excision repair of oxidized base lesions by catalyzing the cleavage of the N-glycosidic linkage to the 2 -deoxyribose
8 Known substrates for the base excision repair glycosylase NEIL1.
9 NEIL1 mrna sequencing mrna Editing A to G AAA to AIA (AGA) R to K
10 (A) Superposition of human NEIL1 structure (dark gray) with that of E. coli Fpg (green) bound to 8-oxoguanine-containing DNA. Red open arrow indicates lesion recognition loop of Fpg. (B) B) Sequence alignment of Fpg/Nei family of DNA repair glycosylases indicating the position of the hneil1 recoding site and lesion recognition loop. Editing of the pre-mrna for the DNA repair enzyme NEIL1 causes a lysine to arginine change in the lesion recognition loop of the protein.
11 Three human ADAR (adenosine deaminase acting on RNA)-family members cytoplasm nucleoplasm and nucleolus ADAR1L is detected mainly in the, whereas ADAR1S localizes in the s40,44,45. ADAR2 localizes predominantly in the nucleolus44,46
12 Sequence of products from reaction of 1 µm human ADAR central A and third A of K242 codon Editing of the pre-mrna for the DNA repair enzyme NEIL1 causes a lysine to arginine change in the lesion recognition loop of the protein.
13 NEIL1 editing in response to IFN-α. (Left) Sequence at the recoding site in NEIL1 cdna from U87 human glioblastoma cells cultured in the absence of IFN-α. (Right) NEIL1 cdna sequence from U87 cells treated with IFN-α.
14 Known substrates for the base excision repair glycosylase NEIL1. thymine glycol guanidinohydantoin
15 The two forms of NEIL1 have distinct enzymatic properties. The edited form removes thymine glycol from duplex DNA 30 times more slowly than the form encoded in the genome, whereas editing enhances repair of the guanidinohydantoin lesion by NEIL1.
16 ADAR1-catalyzed editing of the NEIL1 mrna causes the genomically encoded AAA lysine codon, corresponding to amino acid position 242 in the lesion recognition loop of the protein, to be converted to a codon for arginine. The two forms of the NEIL1 protein (edited and unedited) have distinct enzymatic properties with changes observed for both glycosylase activity and lesion specificity. Editing occurs in a hairpin duplex structure formed near the intron 5/exon 6 boundary in the NEIL1pre-mRNA. Furthermore, NEIL1 mrna recoding is regulated extracellularly by interferon, as predicted for an ADAR1-catalyzed reaction. These results suggest a unique regulatory mechanism for DNA repair and extend our understanding of the impact of RNA editing.
17 Regulation of microrna processing and expression by RNA editing
18 Extensive A I RNA editing of non-coding repeat sequences
19 Extensive A I RNA editing of non-coding repeat sequences
20 RNA EDITING RNA editing in trypanosomes creates functional mitochondrial mrnas by extensive uridylate (U) insertion and deletion The precursors of messenger RNAs (pre-mrnas) have their coding information remodeled by RNA editing Pre-mRNAs are encoded in the maxicircle DNA RNA editing creates initiation and termination codons, corrects frameshifts and even builds entire open-reading frames from nonsense sequences. The edited transcripts are translated into components of the oxidative phosphorylation: subunits of complex I (NADH-UQ reductase), III (Cyt bc1), IV (cyt oxidase) and V (ATP synthase) Minicircles encode guide RNAs (grnas) that specify the editing. Other types of editing includes changes in nucleotide identity. It occurs in other protozoa, mammals, plants and viruses. 1
21
22 mrna EDITING
23 The RNA editing process. The catalysis cycle of editing
24 the APOBEC3 (A3) family of cytidine deaminases has specificity for singlestranded DNA (ssdna). APOBEC3G restricts the replication of human immunodeficiency virus (HIV), hepatitis B virus and retroelements by cytidine deamination on single-stranded DNA or by RNA binding
25
26
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
Protein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
Gene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
Transcription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled
Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino
PRACTICE TEST QUESTIONS
PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.
Translation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
The Steps. 1. Transcription. 2. Transferal. 3. Translation
Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order
2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription
Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional
Ms. Campbell Protein Synthesis Practice Questions Regents L.E.
Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide
Concluding lesson. Student manual. What kind of protein are you? (Basic)
Concluding lesson Student manual What kind of protein are you? (Basic) Part 1 The hereditary material of an organism is stored in a coded way on the DNA. This code consists of four different nucleotides:
From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
The world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
AP BIOLOGY 2009 SCORING GUIDELINES
AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following
Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein
Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of
Molecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
RNA & Protein Synthesis
RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.au What is Gene Expression & Gene Regulation? 1. Gene Expression
RNA and Protein Synthesis
Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic
2007 7.013 Problem Set 1 KEY
2007 7.013 Problem Set 1 KEY Due before 5 PM on FRIDAY, February 16, 2007. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Where in a eukaryotic cell do you
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
Chapter 18 Regulation of Gene Expression
Chapter 18 Regulation of Gene Expression 18.1. Gene Regulation Is Necessary By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection
13.2 Ribosomes & Protein Synthesis
13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
Sample Questions for Exam 3
Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.
RNA Structure and folding
RNA Structure and folding Overview: The main functional biomolecules in cells are polymers DNA, RNA and proteins For RNA and Proteins, the specific sequence of the polymer dictates its final structure
1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
NO CALCULATORS OR CELL PHONES ALLOWED
Biol 205 Exam 1 TEST FORM A Spring 2008 NAME Fill out both sides of the Scantron Sheet. On Side 2 be sure to indicate that you have TEST FORM A The answers to Part I should be placed on the SCANTRON SHEET.
DNA and the Cell. Version 2.3. English version. ELLS European Learning Laboratory for the Life Sciences
DNA and the Cell Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Version 2.3 English version ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra Manaia and
Control of Gene Expression
Control of Gene Expression (Learning Objectives) Explain the role of gene expression is differentiation of function of cells which leads to the emergence of different tissues, organs, and organ systems
Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown
1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains
2013 W. H. Freeman and Company. 26 RNA Metabolism
2013 W. H. Freeman and Company 26 RNA Metabolism CHAPTER 26 RNA Metabolism Key topics: Transcription: DNA-dependent synthesis of RNA Capping and splicing: RNA processing Overview of RNA Function Ribonucleic
DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3
DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can
2006 7.012 Problem Set 3 KEY
2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each
The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:
Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How
Bio 102 Practice Problems Genetic Code and Mutation
Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine
To be able to describe polypeptide synthesis including transcription and splicing
Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain
Control of Gene Expression
Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure
Translation. Translation: Assembly of polypeptides on a ribosome
Translation Translation: Assembly of polypeptides on a ribosome Living cells devote more energy to the synthesis of proteins than to any other aspect of metabolism. About a third of the dry mass of a cell
Basic Principles of Transcription and Translation
The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific traits by dictating the synthesis of
Gene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
Basic Concepts of DNA, Proteins, Genes and Genomes
Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate
Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.
Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.
Post-transcriptional control of gene expression
Post-transcriptional control of gene expression Possible post-transcriptional controls on gene expression Only a few of these controls are likely to be important for any one gene Mecanismo de processamento
Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary
Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page
Genetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
Sickle cell anemia: Altered beta chain Single AA change (#6 Glu to Val) Consequence: Protein polymerizes Change in RBC shape ---> phenotypes
Protein Structure Polypeptide: Protein: Therefore: Example: Single chain of amino acids 1 or more polypeptide chains All polypeptides are proteins Some proteins contain >1 polypeptide Hemoglobin (O 2 binding
Control of Gene Expression
Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
Outline. interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work?
Outline Outline interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work? What is RNA interference? Recently discovered regulatory level. Genome immune system.
Chapter 17: From Gene to Protein
AP Biology Reading Guide Fred and Theresa Holtzclaw Julia Keller 12d Chapter 17: From Gene to Protein 1. What is gene expression? Gene expression is the process by which DNA directs the synthesis of proteins
13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
BCH401G Lecture 39 Andres
BCH401G Lecture 39 Andres Lecture Summary: Ribosome: Understand its role in translation and differences between translation in prokaryotes and eukaryotes. Translation: Understand the chemistry of this
Complex multicellular organisms are produced by cells that switch genes on and off during development.
Home Control of Gene Expression Gene Regulation Is Necessary? By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
Lecture 8. Protein Trafficking/Targeting. Protein targeting is necessary for proteins that are destined to work outside the cytoplasm.
Protein Trafficking/Targeting (8.1) Lecture 8 Protein Trafficking/Targeting Protein targeting is necessary for proteins that are destined to work outside the cytoplasm. Protein targeting is more complex
MUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
Genomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
Chapter 9 Mitochondrial Structure and Function
Chapter 9 Mitochondrial Structure and Function 1 2 3 Structure and function Oxidative phosphorylation and ATP Synthesis Peroxisome Overview 2 Mitochondria have characteristic morphologies despite variable
Transcription in prokaryotes. Elongation and termination
Transcription in prokaryotes Elongation and termination After initiation the σ factor leaves the scene. Core polymerase is conducting the elongation of the chain. The core polymerase contains main nucleotide
GENE REGULATION. Teacher Packet
AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures
trna Processing and Modification
trna Processing and Modification RNA POL III - TRANSCRIPTS 5S RNA, trna, repetitive Sequenzen (Alu-typ), versch. kleine stabile RNAs (7SL - RNA vom signal recognition particle (SRP)), U6 RNA 5S RNA nicht
Lecture 6. Regulation of Protein Synthesis at the Translational Level
Regulation of Protein Synthesis (6.1) Lecture 6 Regulation of Protein Synthesis at the Translational Level Comparison of EF-Tu-GDP and EF-Tu-GTP conformations EF-Tu-GDP EF-Tu-GTP Next: Comparison of GDP
Cellular Respiration Worksheet 1. 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain.
Cellular Respiration Worksheet 1 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain. 2. Where in the cell does the glycolysis part of cellular
Lab # 12: DNA and RNA
115 116 Concepts to be explored: Structure of DNA Nucleotides Amino Acids Proteins Genetic Code Mutation RNA Transcription to RNA Translation to a Protein Figure 12. 1: DNA double helix Introduction Long
Replication Study Guide
Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have
Nucleotides and Nucleic Acids
Nucleotides and Nucleic Acids Brief History 1 1869 - Miescher Isolated nuclein from soiled bandages 1902 - Garrod Studied rare genetic disorder: Alkaptonuria; concluded that specific gene is associated
Introduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH)
DNA, RNA, replication, translation, and transcription Overview Recall the central dogma of biology: DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) DNA structure
4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?
Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes
ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination
Student name ID # 2. (4 pts) What is the terminal electron acceptor in respiration? In photosynthesis? O2, NADP+
1. Membrane transport. A. (4 pts) What ion couples primary and secondary active transport in animal cells? What ion serves the same function in plant cells? Na+, H+ 2. (4 pts) What is the terminal electron
AP BIOLOGY 2010 SCORING GUIDELINES (Form B)
AP BIOLOGY 2010 SCORING GUIDELINES (Form B) Question 2 Certain human genetic conditions, such as sickle cell anemia, result from single base-pair mutations in DNA. (a) Explain how a single base-pair mutation
Bio 102 Practice Problems Recombinant DNA and Biotechnology
Bio 102 Practice Problems Recombinant DNA and Biotechnology Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which of the following DNA sequences could be the recognition site
PRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY
Name PRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY Cell Structure Identify animal, plant, fungal and bacterial cell ultrastructure and know the structures functions. Plant cell Animal cell
Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook)
Name Date Per Look at the diagrams, then answer the questions. Gene Mutations affect a single gene by changing its base sequence, resulting in an incorrect, or nonfunctional, protein being made. (a) A
How To Understand How Gene Expression Is Regulated
What makes cells different from each other? How do cells respond to information from environment? Regulation of: - Transcription - prokaryotes - eukaryotes - mrna splicing - mrna localisation and translation
Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
CCR Biology - Chapter 8 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 8 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Hershey and Chase know
mirnaselect pep-mir Cloning and Expression Vector
Product Data Sheet mirnaselect pep-mir Cloning and Expression Vector CATALOG NUMBER: MIR-EXP-C STORAGE: -80ºC QUANTITY: 2 vectors; each contains 100 µl of bacterial glycerol stock Components 1. mirnaselect
Catalysis by Enzymes. Enzyme A protein that acts as a catalyst for a biochemical reaction.
Catalysis by Enzymes Enzyme A protein that acts as a catalyst for a biochemical reaction. Enzymatic Reaction Specificity Enzyme Cofactors Many enzymes are conjugated proteins that require nonprotein portions
TRANSCRIPTION TRANSLATION - GENETIC CODE AND OUTLINE OF PROTEIN SYNTHESIS
TRANSCRIPTION TRANSLATION - GENETIC CODE AND OUTLINE OF PROTEIN SYNTHESIS Central Dogma of Protein Synthesis Proteins constitute the major part by dry weight of an actively growing cell. They are widely
Supplementary materials showing the Forrester diagram structure of the models: Sector 1: EXPRESSION
Supplementary materials showing the Forrester diagram structure of the models: Gene 1 Gene 2 Gene 3 Sector 1: EXPRESSION Gene 1 Gene 2 Gene 3 Enzyme 1 Enzyme 2 Enzyme 3 Sector 2: TRANSLATION Precursor
European Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
Mechanism of hormone action
Mechanism of hormone action ผศ.ดร.พญ.ส ว ฒณ ค ปต ว ฒ ภาคว ชาสร รว ทยา คณะแพทยศาสตร ศ ร ราชพยาบาล Aims What is hormone receptor Type of hormone receptors - cell surface receptor - intracellular receptor
Transcription: RNA Synthesis, Processing & Modification
Transcription: RNA Synthesis, Processing & Modification 1 Central dogma DNA RNA Protein Reverse transcription 2 Transcription The process of making RNA from DNA Produces all type of RNA mrna, trna, rrna,
Eukaryotes. www.njctl.org PSI Biology Eukaryotes & Gene Expression
Eukaryotes The Eukaryotic Cell Classwork 1. Identify two characteristics that are shared by all cells. 2. Suppose you are investigating a cell that contains a nucleus. Would you categorize this cell as
Specific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons
Tutorial II Gene expression: mrna translation and protein synthesis Piergiorgio Percipalle, PhD Program Control of gene transcription and RNA processing mrna translation and protein synthesis KAROLINSKA
Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.
Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.
Luísa Romão. Instituto Nacional de Saúde Dr. Ricardo Jorge Av. Padre Cruz, 1649-016 Lisboa, Portugal. Cooper et al (2009) Cell 136: 777
Luísa Romão Instituto Nacional de Saúde Dr. Ricardo Jorge Av. Padre Cruz, 1649-016 Lisboa, Portugal Cooper et al (2009) Cell 136: 777 PTC = nonsense or stop codon = UAA, UAG, UGA PTCs can arise in a variety
Micro RNAs: potentielle Biomarker für das. Blutspenderscreening
Micro RNAs: potentielle Biomarker für das Blutspenderscreening micrornas - Background Types of RNA -Coding: messenger RNA (mrna) -Non-coding (examples): Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear
Lecture 3: Mutations
Lecture 3: Mutations Recall that the flow of information within a cell involves the transcription of DNA to mrna and the translation of mrna to protein. Recall also, that the flow of information between
Multiple Choice Write the letter that best answers the question or completes the statement on the line provided.
Name lass Date hapter 12 DN and RN hapter Test Multiple hoice Write the letter that best answers the question or completes the statement on the line provided. Pearson Education, Inc. ll rights reserved.
Mitochondrial DNA Analysis
Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)
HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:
HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone
Genetics 301 Sample Final Examination Spring 2003
Genetics 301 Sample Final Examination Spring 2003 50 Multiple Choice Questions-(Choose the best answer) 1. A cross between two true breeding lines one with dark blue flowers and one with bright white flowers