How To Understand How Gene Expression Is Regulated

Size: px
Start display at page:

Download "How To Understand How Gene Expression Is Regulated"

Transcription

1 What makes cells different from each other? How do cells respond to information from environment? Regulation of: - Transcription - prokaryotes - eukaryotes - mrna splicing - mrna localisation and translation

2 Diversity of cell types and functions Red blood cells Hair cells in cochlea Cardiac muscle cells Skin cells Nerve cells What makes cells different is they make different proteins Some proteins made only in specific cell types: e.g., hemoglobin, insulin

3 Why do different cells make different proteins? They all have the same genes or do they? How do we know that s the case? Can clone a new animal from many different types of cells: Each cell has all genes necessary to make whole animal (and all cell types within it) Cloning => all cells have same genes All cells have same genes but not all genes expressed in each cell Housekeeping genes: - expressed in all cells (e.g., enzymes for cellular metabolism, structural proteins) Tissue-specific genes: - expressed in just some cell types (e.g., haemoglobin, insulin, liver enzymes, neurotransmitter receptors, etc.) Each cell type has a characteristic profile of expression of different subsets of the 30,000 genes in the genome

4 How is production of proteins regulated? How is each protein regulated? How is the regulation of all proteins coordinated? (differentiation) How do cells know which proteins to make? (development) How is protein expression modulated? (cellular metabolism / response to environment) Various steps in protein expression can all be regulated: - Transcription (in which cells or under what conditions does mrna get made for gene X?) - mrna splicing (many mrnas must be spliced together from separate exons to make mature message). - mrna localisation and translation (where and when do you make protein X from the mrna?) Core principles: Regulatory proteins bind control elements in DNA or RNA Control elements defined by specific sequences Both positive and negative regulation Mutations in either regulatory proteins or control elements can cause defects in regulation

5 Fundamental principles of differential gene expression first worked out in bacteria in the study of the response to nutrient availability Basic principles apply to all organisms and to different mechanisms of regulation Differential gene regulation: the lac operon Escherichia coli: preferred food source is glucose Will grow on other sugars like lactose Break it down to glucose and galactose Induction of β-galactosidase β-galactosidase protein normally hardly made at all (in presence of glucose and absence of lactose) But, in absence of glucose and presence of lactose: 10,000-fold induction in levels of β-galactosidase:

6 Growth on lactose depends on three enzymes: β-galactosidase (lacz) Permease (laca) Thiogalactoside transacetylase (lacy) Each encoded by a different gene, but: (i) Genes are tightly linked on chromosome (ii) All are induced coordinately (iii) Ratio of Z:A:Y proteins remains constant Conclude: under a common control system (an operon ) Lac genes are co-transcribed in a single mrna promoter Three proteins are translated separately How does the induction occur? How is the expression of these genes regulated in response to environmental conditions?

7 How was this discovered? Jacob and Monod (1961) isolated mutant strains of E. coli with altered growth on lactose or altered induction of lac genes: Wild-type Growth on Biochemical gene Mutant lactose phenotype z + z - - no galactosidase y + y - - no permease a + a - - no transacetylase o + o c + constitutive - all enzymes always present i + i - + constitutive i s - repressed (non-inducible) Dominance relationships and complementation Used an episome F-lac to make a partial diploid (a heterogenote) Test whether mutation only has effect on genes linked to it on the DNA: - A mutation in a regulatory element should only affect expression of genes right next to it ( in cis ) - A mutation in a gene encoding a regulatory protein should affect expression of genes on another chromosome ( in trans )

8 F episome complementation I makes some kind of diffusible substance (LacI repressor protein) The operator mutations only affect the expression of genes with which they are linked i.e., they only work in cis O does NOT make a diffusible substance

9 Explanation of mutants Mutant Lactose Explanation z - - no galactosidase y - - no permease a - - no transacetylase o c constitutive Mutation in operator sequence - repressor can not bind i - constitutive Mutation in repressor - it cannot bind operator i s - Mutation in repressor - it cannot bind lactose (always binds operator) I s mutations block binding of lactose to repressor (always off)

10 Lac operon also positively regulated Efficient binding of RNA polymerase to promoter requires another protein: - CAP (catabolite-activating protein) Binds to a specific sequence upstream of promoter Catabolite repression (inhibiting the activator) Induction of lac operon allows cell to make glucose from lactose But don t need to do that when have glucose around as well (don t need to make more glucose) Activator shut off when glucose high CAP must be bound to camp to be active Glucose inhibits production of camp by adenylyl cyclase Known as catabolite repression because high levels of catablolite (glucose) represses transcription Lac operon also positively regulated CAP

11 O 3 O 2 O 1 General principles from study of lac operon: Gene expression controlled by binding of proteins to upstream regulatory elements (operators/enhancers) Each gene controlled by both activators and repressors Separate response elements for different proteins Mutations in regulatory proteins or in the DNA elements can alter expression Expression regulated in response to external signals (from environment or from other cells in embryo) Lac operon is example of regulation of three linked genes How do you coordinate regulation of larger sets of (unlinked) genes? Will examine this in fruitfly Drosophila melanogaster

Gene Regulation -- The Lac Operon

Gene Regulation -- The Lac Operon Gene Regulation -- The Lac Operon Specific proteins are present in different tissues and some appear only at certain times during development. All cells of a higher organism have the full set of genes:

More information

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams. Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.

More information

Gene Switches Teacher Information

Gene Switches Teacher Information STO-143 Gene Switches Teacher Information Summary Kit contains How do bacteria turn on and turn off genes? Students model the action of the lac operon that regulates the expression of genes essential for

More information

Gene Transcription in Prokaryotes

Gene Transcription in Prokaryotes Gene Transcription in Prokaryotes Operons: in prokaryotes, genes that encode protein participating in a common pathway are organized together. This group of genes, arranged in tandem, is called an OPERON.

More information

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: [email protected].

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu. Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: [email protected] What is Gene Expression & Gene Regulation? 1. Gene Expression

More information

MICROBIAL GENETICS. Gene Regulation: The Operons

MICROBIAL GENETICS. Gene Regulation: The Operons MICROBIAL GENETICS Gene Regulation: The Operons Pradeep Kumar Burma Reader Department of Genetics University of Delhi South Campus Benito Juarez Road New Delhi-110021 E-mail: [email protected] 05-May-2006

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

Chapter 18 Regulation of Gene Expression

Chapter 18 Regulation of Gene Expression Chapter 18 Regulation of Gene Expression 18.1. Gene Regulation Is Necessary By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection

More information

Control of Gene Expression

Control of Gene Expression Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring

More information

GENE REGULATION. Teacher Packet

GENE REGULATION. Teacher Packet AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures

More information

Complex multicellular organisms are produced by cells that switch genes on and off during development.

Complex multicellular organisms are produced by cells that switch genes on and off during development. Home Control of Gene Expression Gene Regulation Is Necessary? By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

The Effects of Glycerol, Glucose, Galactose, Lactose and Glucose with Galactose on the Induction of β-galactosidase in Escherichia coli

The Effects of Glycerol, Glucose, Galactose, Lactose and Glucose with Galactose on the Induction of β-galactosidase in Escherichia coli The Effects of Glycerol, Glucose, Galactose, Lactose and Glucose with Galactose on the Induction of β-galactosidase in Escherichia coli VICKY CHAN, LISA F. DREOLINI, KERRY A. FLINTOFF, SONJA J. LLOYD,

More information

13.4 Gene Regulation and Expression

13.4 Gene Regulation and Expression 13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.

More information

Genetics Lecture Notes 7.03 2005. Lectures 1 2

Genetics Lecture Notes 7.03 2005. Lectures 1 2 Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several

More information

7. 2. Regulation of gene expression. Unit 7: Molecular biology and genetics

7. 2. Regulation of gene expression. Unit 7: Molecular biology and genetics 7. 2 Regulation of gene expression We all start off as one stem cell (a fertilised ovum) that divides to give a ball of cells. These cells then differentiate and become specialised to carry out specific

More information

Sickle cell anemia: Altered beta chain Single AA change (#6 Glu to Val) Consequence: Protein polymerizes Change in RBC shape ---> phenotypes

Sickle cell anemia: Altered beta chain Single AA change (#6 Glu to Val) Consequence: Protein polymerizes Change in RBC shape ---> phenotypes Protein Structure Polypeptide: Protein: Therefore: Example: Single chain of amino acids 1 or more polypeptide chains All polypeptides are proteins Some proteins contain >1 polypeptide Hemoglobin (O 2 binding

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Activity 7.21 Transcription factors

Activity 7.21 Transcription factors Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation

More information

Trasposable elements: P elements

Trasposable elements: P elements Trasposable elements: P elements In 1938 Marcus Rhodes provided the first genetic description of an unstable mutation, an allele of a gene required for the production of pigment in maize. This instability

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure

More information

The Making of the Fittest: Evolving Switches, Evolving Bodies

The Making of the Fittest: Evolving Switches, Evolving Bodies OVERVIEW MODELING THE REGULATORY SWITCHES OF THE PITX1 GENE IN STICKLEBACK FISH This hands-on activity supports the short film, The Making of the Fittest:, and aims to help students understand eukaryotic

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

Using chromosomal laci Q1 to control. high copy number plasmids in Escherichia coli. Weickert; Gene 223; 1998 : 221 231

Using chromosomal laci Q1 to control. high copy number plasmids in Escherichia coli. Weickert; Gene 223; 1998 : 221 231 Using chromosomal laci Q1 to control expression of genes on high copy number plasmids in Escherichia coli Christopher B Glascock Michael J Christopher B. Glascock, Michael J. Weickert; Gene 223; 1998 :

More information

The world of non-coding RNA. Espen Enerly

The world of non-coding RNA. Espen Enerly The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often

More information

A N OVERVIEW OF GENE EXPRESSION

A N OVERVIEW OF GENE EXPRESSION C H A P T E R E I G H T 8 C o n t r o l o f G e n e E x p r e s s i o n An organism's DNA encodes all of the RNA and protein molecules that are needed to make its cells. Yet a complete description of the

More information

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed

More information

Induction of Enzyme Activity in Bacteria:The Lac Operon. Preparation for Laboratory: Web Tutorial - Lac Operon - submit questions

Induction of Enzyme Activity in Bacteria:The Lac Operon. Preparation for Laboratory: Web Tutorial - Lac Operon - submit questions Induction of Enzyme Activity in Bacteria:The Lac Operon Preparation for Laboratory: Web Tutorial - Lac Operon - submit questions I. Background: For the last week you explored the functioning of the enzyme

More information

BioBoot Camp Genetics

BioBoot Camp Genetics BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression (Learning Objectives) Explain the role of gene expression is differentiation of function of cells which leads to the emergence of different tissues, organs, and organ systems

More information

Gene Models & Bed format: What they represent.

Gene Models & Bed format: What they represent. GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

Plant Growth & Development. Growth Stages. Differences in the Developmental Mechanisms of Plants and Animals. Development

Plant Growth & Development. Growth Stages. Differences in the Developmental Mechanisms of Plants and Animals. Development Plant Growth & Development Plant body is unable to move. To survive and grow, plants must be able to alter its growth, development and physiology. Plants are able to produce complex, yet variable forms

More information

Genetics 301 Sample Final Examination Spring 2003

Genetics 301 Sample Final Examination Spring 2003 Genetics 301 Sample Final Examination Spring 2003 50 Multiple Choice Questions-(Choose the best answer) 1. A cross between two true breeding lines one with dark blue flowers and one with bright white flowers

More information

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional

More information

AP BIOLOGY 2009 SCORING GUIDELINES

AP BIOLOGY 2009 SCORING GUIDELINES AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following

More information

Protein Synthesis How Genes Become Constituent Molecules

Protein Synthesis How Genes Become Constituent Molecules Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein

More information

Actions of Hormones on Target Cells Page 1. Actions of Hormones on Target Cells Page 2. Goals/ What You Need to Know Goals What You Need to Know

Actions of Hormones on Target Cells Page 1. Actions of Hormones on Target Cells Page 2. Goals/ What You Need to Know Goals What You Need to Know Actions of Hormones on Target Cells Graphics are used with permission of: Pearson Education Inc., publishing as Benjamin Cummings (http://www.aw-bc.com) Page 1. Actions of Hormones on Target Cells Hormones

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

Mechanism of hormone action

Mechanism of hormone action Mechanism of hormone action ผศ.ดร.พญ.ส ว ฒณ ค ปต ว ฒ ภาคว ชาสร รว ทยา คณะแพทยศาสตร ศ ร ราชพยาบาล Aims What is hormone receptor Type of hormone receptors - cell surface receptor - intracellular receptor

More information

GenBank, Entrez, & FASTA

GenBank, Entrez, & FASTA GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

Eukaryotes. www.njctl.org PSI Biology Eukaryotes & Gene Expression

Eukaryotes. www.njctl.org PSI Biology Eukaryotes & Gene Expression Eukaryotes The Eukaryotic Cell Classwork 1. Identify two characteristics that are shared by all cells. 2. Suppose you are investigating a cell that contains a nucleus. Would you categorize this cell as

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

Genetics Test Biology I

Genetics Test Biology I Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.

More information

Gene expression regulation and the lactase gene

Gene expression regulation and the lactase gene Gene expression regulation and the lactase gene The human genome Organism Genome Size (Bases) Estimated Genes Human (Homo sapiens) ) 3 billion 30,000 Laboratory mouse (M. musculus) 2.6 billion 30,000 Mustard

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS

More information

Bacterial Transformation and Plasmid Purification. Chapter 5: Background

Bacterial Transformation and Plasmid Purification. Chapter 5: Background Bacterial Transformation and Plasmid Purification Chapter 5: Background History of Transformation and Plasmids Bacterial methods of DNA transfer Transformation: when bacteria take up DNA from their environment

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold

More information

Human Genome Organization: An Update. Genome Organization: An Update

Human Genome Organization: An Update. Genome Organization: An Update Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion

More information

Chapter 6: Biological Networks

Chapter 6: Biological Networks Chapter 6: Biological Networks 6.4 Engineering Synthetic Networks Prof. Yechiam Yemini (YY) Computer Science Department Columbia University Overview Constructing regulatory gates A genetic toggle switch;

More information

CCR Biology - Chapter 8 Practice Test - Summer 2012

CCR Biology - Chapter 8 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 8 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Hershey and Chase know

More information

A and B are not absolutely linked. They could be far enough apart on the chromosome that they assort independently.

A and B are not absolutely linked. They could be far enough apart on the chromosome that they assort independently. Name Section 7.014 Problem Set 5 Please print out this problem set and record your answers on the printed copy. Answers to this problem set are to be turned in to the box outside 68-120 by 5:00pm on Friday

More information

Introduction to Genome Annotation

Introduction to Genome Annotation Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT

More information

Given these characteristics of life, which of the following objects is considered a living organism? W. X. Y. Z.

Given these characteristics of life, which of the following objects is considered a living organism? W. X. Y. Z. Cell Structure and Organization 1. All living things must possess certain characteristics. They are all composed of one or more cells. They can grow, reproduce, and pass their genes on to their offspring.

More information

Modeling and Simulation of Gene Regulatory Networks

Modeling and Simulation of Gene Regulatory Networks Modeling and Simulation of Gene Regulatory Networks Hidde de Jong INRIA Grenoble - Rhône-Alpes [email protected] http://ibis.inrialpes.fr INRIA Grenoble - Rhône-Alpes and IBIS IBIS: systems biology

More information

(1-p) 2. p(1-p) From the table, frequency of DpyUnc = ¼ (p^2) = #DpyUnc = p^2 = 0.0004 ¼(1-p)^2 + ½(1-p)p + ¼(p^2) #Dpy + #DpyUnc

(1-p) 2. p(1-p) From the table, frequency of DpyUnc = ¼ (p^2) = #DpyUnc = p^2 = 0.0004 ¼(1-p)^2 + ½(1-p)p + ¼(p^2) #Dpy + #DpyUnc Advanced genetics Kornfeld problem set_key 1A (5 points) Brenner employed 2-factor and 3-factor crosses with the mutants isolated from his screen, and visually assayed for recombination events between

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

Lecture 3: Mutations

Lecture 3: Mutations Lecture 3: Mutations Recall that the flow of information within a cell involves the transcription of DNA to mrna and the translation of mrna to protein. Recall also, that the flow of information between

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

IP-Free E. coli Inducible Expression Vectors. E. coli Secretion Signals. IP-Free E. coli Expression Vectors with the IPTG-inducible T5 Promoter

IP-Free E. coli Inducible Expression Vectors. E. coli Secretion Signals. IP-Free E. coli Expression Vectors with the IPTG-inducible T5 Promoter IP-Free E. coli Inducible Expression Vectors E. coli expression vectors are available with the following promoters: T5 or T7 (IPTG-inducible), rhabad (rhamnose-inducible), ara (arabinose and IPTG-inducible)

More information

Chem 465 Biochemistry II

Chem 465 Biochemistry II Chem 465 Biochemistry II Name: 2 points Multiple choice (4 points apiece): 1. Formation of the ribosomal initiation complex for bacterial protein synthesis does not require: A) EF-Tu. B) formylmethionyl

More information

To be able to describe polypeptide synthesis including transcription and splicing

To be able to describe polypeptide synthesis including transcription and splicing Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain

More information

Chapter 5: Organization and Expression of Immunoglobulin Genes

Chapter 5: Organization and Expression of Immunoglobulin Genes Chapter 5: Organization and Expression of Immunoglobulin Genes I. Genetic Model Compatible with Ig Structure A. Two models for Ab structure diversity 1. Germ-line theory: maintained that the genome contributed

More information

Sample Questions for Exam 3

Sample Questions for Exam 3 Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.

More information

Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.

Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells. Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,

More information

BCH401G Lecture 39 Andres

BCH401G Lecture 39 Andres BCH401G Lecture 39 Andres Lecture Summary: Ribosome: Understand its role in translation and differences between translation in prokaryotes and eukaryotes. Translation: Understand the chemistry of this

More information

from Cloned Genes Learning outcomes: By the end of this chapter you will have an understanding of:

from Cloned Genes Learning outcomes: By the end of this chapter you will have an understanding of: 9 Production of Proteins from Cloned Genes Learning outcomes: By the end of this chapter you will have an understanding of: the reasons for producing proteins from cloned genes some of the more common

More information

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page

More information

Gene expression and regulation

Gene expression and regulation PYF12 3/21/05 8:04 PM Page 191 Chapter 12 Gene expression and regulation Bacterial genomes usually contain several thousand different genes. Some of the gene products are required by the cell under all

More information

European Medicines Agency

European Medicines Agency European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein

More information

Lecture 8. Protein Trafficking/Targeting. Protein targeting is necessary for proteins that are destined to work outside the cytoplasm.

Lecture 8. Protein Trafficking/Targeting. Protein targeting is necessary for proteins that are destined to work outside the cytoplasm. Protein Trafficking/Targeting (8.1) Lecture 8 Protein Trafficking/Targeting Protein targeting is necessary for proteins that are destined to work outside the cytoplasm. Protein targeting is more complex

More information

RNA: Transcription and Processing

RNA: Transcription and Processing 8 RNA: Transcription and Processing WORKING WITH THE FIGURES 1. In Figure 8-3, why are the arrows for genes 1 and 2 pointing in opposite directions? The arrows for genes 1 and 2 indicate the direction

More information

MCAS Biology. Review Packet

MCAS Biology. Review Packet MCAS Biology Review Packet 1 Name Class Date 1. Define organic. THE CHEMISTRY OF LIFE 2. All living things are made up of 6 essential elements: SPONCH. Name the six elements of life. S N P C O H 3. Elements

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS

Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS Period Date REGENTS REVIEW: PROTEIN SYNTHESIS 1. The diagram at the right represents a portion of a type of organic molecule present in the cells of organisms. What will most likely happen if there is

More information

Question 4 /29 points. Total /100 points

Question 4 /29 points. Total /100 points MIT Department of Biology 7.28, Spring 2005 - Molecular Biology 7.28 Spring 2005 Exam Three Question 1 Question 2 Question 3 /30 points /20 points /21 points Question 4 /29 points Total /100 points 1 Question

More information

Molecular Genetics. RNA, Transcription, & Protein Synthesis

Molecular Genetics. RNA, Transcription, & Protein Synthesis Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and

More information

AP BIOLOGY 2007 SCORING GUIDELINES

AP BIOLOGY 2007 SCORING GUIDELINES AP BIOLOGY 2007 SCORING GUIDELINES Question 4 A bacterial plasmid is 100 kb in length. The plasmid DNA was digested to completion with two restriction enzymes in three separate treatments: EcoRI, HaeIII,

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

Enzymes. A. a lipid B. a protein C. a carbohydrate D. a mineral

Enzymes. A. a lipid B. a protein C. a carbohydrate D. a mineral Enzymes 1. All cells in multicellular organisms contain thousands of different kinds of enzymes that are specialized to catalyze different chemical reactions. Given this information, which of the following

More information

Name Date Period. Keystone Review Enzymes

Name Date Period. Keystone Review Enzymes Name Date Period Keystone Review Enzymes 1. In order for cells to function properly, the enzymes that they contain must also function properly. What can be inferred using the above information? A. Cells

More information

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the

More information

Lecture 6. Regulation of Protein Synthesis at the Translational Level

Lecture 6. Regulation of Protein Synthesis at the Translational Level Regulation of Protein Synthesis (6.1) Lecture 6 Regulation of Protein Synthesis at the Translational Level Comparison of EF-Tu-GDP and EF-Tu-GTP conformations EF-Tu-GDP EF-Tu-GTP Next: Comparison of GDP

More information

What are the particular activities designed to do?

What are the particular activities designed to do? Notes to Instructors Chapter 16 The Molecular Basis of Inheritance What is the focus of these activities? Almost all introductory biology students know that DNA is the hereditary material in living cells.

More information

Replication Study Guide

Replication Study Guide Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium

More information

AP BIOLOGY 2010 SCORING GUIDELINES (Form B)

AP BIOLOGY 2010 SCORING GUIDELINES (Form B) AP BIOLOGY 2010 SCORING GUIDELINES (Form B) Question 2 Certain human genetic conditions, such as sickle cell anemia, result from single base-pair mutations in DNA. (a) Explain how a single base-pair mutation

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information

Feed Forward Loops in Biological Systems

Feed Forward Loops in Biological Systems Feed Forward Loops in Biological Systems Dr. M. Vijayalakshmi School of Chemical and Biotechnology SASTRA University Joint Initiative of IITs and IISc Funded by MHRD Page 1 of 7 Table of Contents 1 INTRODUCTION...

More information

Multiple Choice Write the letter that best answers the question or completes the statement on the line provided.

Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. Name lass Date hapter 12 DN and RN hapter Test Multiple hoice Write the letter that best answers the question or completes the statement on the line provided. Pearson Education, Inc. ll rights reserved.

More information

Name: Date: Period: DNA Unit: DNA Webquest

Name: Date: Period: DNA Unit: DNA Webquest Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History http://www.dnaftb.org/dnaftb/1/concept/index.html Read the text and answer the following questions.

More information

Control of Gene Expression

Control of Gene Expression PER EIG 8 ontrol of Gene Expression n organism s D encodes all of the R and protein molecules that are needed to make its cells. Yet a complete description of the D sequence of an organism be it the few

More information

Biology Final Exam Study Guide: Semester 2

Biology Final Exam Study Guide: Semester 2 Biology Final Exam Study Guide: Semester 2 Questions 1. Scientific method: What does each of these entail? Investigation and Experimentation Problem Hypothesis Methods Results/Data Discussion/Conclusion

More information