How To Understand How Gene Expression Is Regulated
|
|
|
- Spencer Newman
- 5 years ago
- Views:
Transcription
1 What makes cells different from each other? How do cells respond to information from environment? Regulation of: - Transcription - prokaryotes - eukaryotes - mrna splicing - mrna localisation and translation
2 Diversity of cell types and functions Red blood cells Hair cells in cochlea Cardiac muscle cells Skin cells Nerve cells What makes cells different is they make different proteins Some proteins made only in specific cell types: e.g., hemoglobin, insulin
3 Why do different cells make different proteins? They all have the same genes or do they? How do we know that s the case? Can clone a new animal from many different types of cells: Each cell has all genes necessary to make whole animal (and all cell types within it) Cloning => all cells have same genes All cells have same genes but not all genes expressed in each cell Housekeeping genes: - expressed in all cells (e.g., enzymes for cellular metabolism, structural proteins) Tissue-specific genes: - expressed in just some cell types (e.g., haemoglobin, insulin, liver enzymes, neurotransmitter receptors, etc.) Each cell type has a characteristic profile of expression of different subsets of the 30,000 genes in the genome
4 How is production of proteins regulated? How is each protein regulated? How is the regulation of all proteins coordinated? (differentiation) How do cells know which proteins to make? (development) How is protein expression modulated? (cellular metabolism / response to environment) Various steps in protein expression can all be regulated: - Transcription (in which cells or under what conditions does mrna get made for gene X?) - mrna splicing (many mrnas must be spliced together from separate exons to make mature message). - mrna localisation and translation (where and when do you make protein X from the mrna?) Core principles: Regulatory proteins bind control elements in DNA or RNA Control elements defined by specific sequences Both positive and negative regulation Mutations in either regulatory proteins or control elements can cause defects in regulation
5 Fundamental principles of differential gene expression first worked out in bacteria in the study of the response to nutrient availability Basic principles apply to all organisms and to different mechanisms of regulation Differential gene regulation: the lac operon Escherichia coli: preferred food source is glucose Will grow on other sugars like lactose Break it down to glucose and galactose Induction of β-galactosidase β-galactosidase protein normally hardly made at all (in presence of glucose and absence of lactose) But, in absence of glucose and presence of lactose: 10,000-fold induction in levels of β-galactosidase:
6 Growth on lactose depends on three enzymes: β-galactosidase (lacz) Permease (laca) Thiogalactoside transacetylase (lacy) Each encoded by a different gene, but: (i) Genes are tightly linked on chromosome (ii) All are induced coordinately (iii) Ratio of Z:A:Y proteins remains constant Conclude: under a common control system (an operon ) Lac genes are co-transcribed in a single mrna promoter Three proteins are translated separately How does the induction occur? How is the expression of these genes regulated in response to environmental conditions?
7 How was this discovered? Jacob and Monod (1961) isolated mutant strains of E. coli with altered growth on lactose or altered induction of lac genes: Wild-type Growth on Biochemical gene Mutant lactose phenotype z + z - - no galactosidase y + y - - no permease a + a - - no transacetylase o + o c + constitutive - all enzymes always present i + i - + constitutive i s - repressed (non-inducible) Dominance relationships and complementation Used an episome F-lac to make a partial diploid (a heterogenote) Test whether mutation only has effect on genes linked to it on the DNA: - A mutation in a regulatory element should only affect expression of genes right next to it ( in cis ) - A mutation in a gene encoding a regulatory protein should affect expression of genes on another chromosome ( in trans )
8 F episome complementation I makes some kind of diffusible substance (LacI repressor protein) The operator mutations only affect the expression of genes with which they are linked i.e., they only work in cis O does NOT make a diffusible substance
9 Explanation of mutants Mutant Lactose Explanation z - - no galactosidase y - - no permease a - - no transacetylase o c constitutive Mutation in operator sequence - repressor can not bind i - constitutive Mutation in repressor - it cannot bind operator i s - Mutation in repressor - it cannot bind lactose (always binds operator) I s mutations block binding of lactose to repressor (always off)
10 Lac operon also positively regulated Efficient binding of RNA polymerase to promoter requires another protein: - CAP (catabolite-activating protein) Binds to a specific sequence upstream of promoter Catabolite repression (inhibiting the activator) Induction of lac operon allows cell to make glucose from lactose But don t need to do that when have glucose around as well (don t need to make more glucose) Activator shut off when glucose high CAP must be bound to camp to be active Glucose inhibits production of camp by adenylyl cyclase Known as catabolite repression because high levels of catablolite (glucose) represses transcription Lac operon also positively regulated CAP
11 O 3 O 2 O 1 General principles from study of lac operon: Gene expression controlled by binding of proteins to upstream regulatory elements (operators/enhancers) Each gene controlled by both activators and repressors Separate response elements for different proteins Mutations in regulatory proteins or in the DNA elements can alter expression Expression regulated in response to external signals (from environment or from other cells in embryo) Lac operon is example of regulation of three linked genes How do you coordinate regulation of larger sets of (unlinked) genes? Will examine this in fruitfly Drosophila melanogaster
Gene Regulation -- The Lac Operon
Gene Regulation -- The Lac Operon Specific proteins are present in different tissues and some appear only at certain times during development. All cells of a higher organism have the full set of genes:
Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.
Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.
Gene Switches Teacher Information
STO-143 Gene Switches Teacher Information Summary Kit contains How do bacteria turn on and turn off genes? Students model the action of the lac operon that regulates the expression of genes essential for
Gene Transcription in Prokaryotes
Gene Transcription in Prokaryotes Operons: in prokaryotes, genes that encode protein participating in a common pathway are organized together. This group of genes, arranged in tandem, is called an OPERON.
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: [email protected].
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: [email protected] What is Gene Expression & Gene Regulation? 1. Gene Expression
MICROBIAL GENETICS. Gene Regulation: The Operons
MICROBIAL GENETICS Gene Regulation: The Operons Pradeep Kumar Burma Reader Department of Genetics University of Delhi South Campus Benito Juarez Road New Delhi-110021 E-mail: [email protected] 05-May-2006
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
Chapter 18 Regulation of Gene Expression
Chapter 18 Regulation of Gene Expression 18.1. Gene Regulation Is Necessary By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection
Control of Gene Expression
Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
GENE REGULATION. Teacher Packet
AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures
Complex multicellular organisms are produced by cells that switch genes on and off during development.
Home Control of Gene Expression Gene Regulation Is Necessary? By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
The Effects of Glycerol, Glucose, Galactose, Lactose and Glucose with Galactose on the Induction of β-galactosidase in Escherichia coli
The Effects of Glycerol, Glucose, Galactose, Lactose and Glucose with Galactose on the Induction of β-galactosidase in Escherichia coli VICKY CHAN, LISA F. DREOLINI, KERRY A. FLINTOFF, SONJA J. LLOYD,
13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
Genetics Lecture Notes 7.03 2005. Lectures 1 2
Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several
7. 2. Regulation of gene expression. Unit 7: Molecular biology and genetics
7. 2 Regulation of gene expression We all start off as one stem cell (a fertilised ovum) that divides to give a ball of cells. These cells then differentiate and become specialised to carry out specific
Sickle cell anemia: Altered beta chain Single AA change (#6 Glu to Val) Consequence: Protein polymerizes Change in RBC shape ---> phenotypes
Protein Structure Polypeptide: Protein: Therefore: Example: Single chain of amino acids 1 or more polypeptide chains All polypeptides are proteins Some proteins contain >1 polypeptide Hemoglobin (O 2 binding
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
Activity 7.21 Transcription factors
Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation
Trasposable elements: P elements
Trasposable elements: P elements In 1938 Marcus Rhodes provided the first genetic description of an unstable mutation, an allele of a gene required for the production of pigment in maize. This instability
Control of Gene Expression
Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure
The Making of the Fittest: Evolving Switches, Evolving Bodies
OVERVIEW MODELING THE REGULATORY SWITCHES OF THE PITX1 GENE IN STICKLEBACK FISH This hands-on activity supports the short film, The Making of the Fittest:, and aims to help students understand eukaryotic
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
Using chromosomal laci Q1 to control. high copy number plasmids in Escherichia coli. Weickert; Gene 223; 1998 : 221 231
Using chromosomal laci Q1 to control expression of genes on high copy number plasmids in Escherichia coli Christopher B Glascock Michael J Christopher B. Glascock, Michael J. Weickert; Gene 223; 1998 :
The world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
A N OVERVIEW OF GENE EXPRESSION
C H A P T E R E I G H T 8 C o n t r o l o f G e n e E x p r e s s i o n An organism's DNA encodes all of the RNA and protein molecules that are needed to make its cells. Yet a complete description of the
Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
Induction of Enzyme Activity in Bacteria:The Lac Operon. Preparation for Laboratory: Web Tutorial - Lac Operon - submit questions
Induction of Enzyme Activity in Bacteria:The Lac Operon Preparation for Laboratory: Web Tutorial - Lac Operon - submit questions I. Background: For the last week you explored the functioning of the enzyme
BioBoot Camp Genetics
BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before
Control of Gene Expression
Control of Gene Expression (Learning Objectives) Explain the role of gene expression is differentiation of function of cells which leads to the emergence of different tissues, organs, and organ systems
Gene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
Plant Growth & Development. Growth Stages. Differences in the Developmental Mechanisms of Plants and Animals. Development
Plant Growth & Development Plant body is unable to move. To survive and grow, plants must be able to alter its growth, development and physiology. Plants are able to produce complex, yet variable forms
Genetics 301 Sample Final Examination Spring 2003
Genetics 301 Sample Final Examination Spring 2003 50 Multiple Choice Questions-(Choose the best answer) 1. A cross between two true breeding lines one with dark blue flowers and one with bright white flowers
Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription
Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional
AP BIOLOGY 2009 SCORING GUIDELINES
AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following
Protein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
Actions of Hormones on Target Cells Page 1. Actions of Hormones on Target Cells Page 2. Goals/ What You Need to Know Goals What You Need to Know
Actions of Hormones on Target Cells Graphics are used with permission of: Pearson Education Inc., publishing as Benjamin Cummings (http://www.aw-bc.com) Page 1. Actions of Hormones on Target Cells Hormones
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
Mechanism of hormone action
Mechanism of hormone action ผศ.ดร.พญ.ส ว ฒณ ค ปต ว ฒ ภาคว ชาสร รว ทยา คณะแพทยศาสตร ศ ร ราชพยาบาล Aims What is hormone receptor Type of hormone receptors - cell surface receptor - intracellular receptor
GenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
Eukaryotes. www.njctl.org PSI Biology Eukaryotes & Gene Expression
Eukaryotes The Eukaryotic Cell Classwork 1. Identify two characteristics that are shared by all cells. 2. Suppose you are investigating a cell that contains a nucleus. Would you categorize this cell as
Transcription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
Genetics Test Biology I
Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.
Gene expression regulation and the lactase gene
Gene expression regulation and the lactase gene The human genome Organism Genome Size (Bases) Estimated Genes Human (Homo sapiens) ) 3 billion 30,000 Laboratory mouse (M. musculus) 2.6 billion 30,000 Mustard
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
Bacterial Transformation and Plasmid Purification. Chapter 5: Background
Bacterial Transformation and Plasmid Purification Chapter 5: Background History of Transformation and Plasmids Bacterial methods of DNA transfer Transformation: when bacteria take up DNA from their environment
DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA
DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence
Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
Human Genome Organization: An Update. Genome Organization: An Update
Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion
Chapter 6: Biological Networks
Chapter 6: Biological Networks 6.4 Engineering Synthetic Networks Prof. Yechiam Yemini (YY) Computer Science Department Columbia University Overview Constructing regulatory gates A genetic toggle switch;
CCR Biology - Chapter 8 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 8 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Hershey and Chase know
A and B are not absolutely linked. They could be far enough apart on the chromosome that they assort independently.
Name Section 7.014 Problem Set 5 Please print out this problem set and record your answers on the printed copy. Answers to this problem set are to be turned in to the box outside 68-120 by 5:00pm on Friday
Introduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
Given these characteristics of life, which of the following objects is considered a living organism? W. X. Y. Z.
Cell Structure and Organization 1. All living things must possess certain characteristics. They are all composed of one or more cells. They can grow, reproduce, and pass their genes on to their offspring.
Modeling and Simulation of Gene Regulatory Networks
Modeling and Simulation of Gene Regulatory Networks Hidde de Jong INRIA Grenoble - Rhône-Alpes [email protected] http://ibis.inrialpes.fr INRIA Grenoble - Rhône-Alpes and IBIS IBIS: systems biology
(1-p) 2. p(1-p) From the table, frequency of DpyUnc = ¼ (p^2) = #DpyUnc = p^2 = 0.0004 ¼(1-p)^2 + ½(1-p)p + ¼(p^2) #Dpy + #DpyUnc
Advanced genetics Kornfeld problem set_key 1A (5 points) Brenner employed 2-factor and 3-factor crosses with the mutants isolated from his screen, and visually assayed for recombination events between
Biotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
Lecture 3: Mutations
Lecture 3: Mutations Recall that the flow of information within a cell involves the transcription of DNA to mrna and the translation of mrna to protein. Recall also, that the flow of information between
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
IP-Free E. coli Inducible Expression Vectors. E. coli Secretion Signals. IP-Free E. coli Expression Vectors with the IPTG-inducible T5 Promoter
IP-Free E. coli Inducible Expression Vectors E. coli expression vectors are available with the following promoters: T5 or T7 (IPTG-inducible), rhabad (rhamnose-inducible), ara (arabinose and IPTG-inducible)
Chem 465 Biochemistry II
Chem 465 Biochemistry II Name: 2 points Multiple choice (4 points apiece): 1. Formation of the ribosomal initiation complex for bacterial protein synthesis does not require: A) EF-Tu. B) formylmethionyl
To be able to describe polypeptide synthesis including transcription and splicing
Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain
Chapter 5: Organization and Expression of Immunoglobulin Genes
Chapter 5: Organization and Expression of Immunoglobulin Genes I. Genetic Model Compatible with Ig Structure A. Two models for Ab structure diversity 1. Germ-line theory: maintained that the genome contributed
Sample Questions for Exam 3
Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.
Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.
Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,
BCH401G Lecture 39 Andres
BCH401G Lecture 39 Andres Lecture Summary: Ribosome: Understand its role in translation and differences between translation in prokaryotes and eukaryotes. Translation: Understand the chemistry of this
from Cloned Genes Learning outcomes: By the end of this chapter you will have an understanding of:
9 Production of Proteins from Cloned Genes Learning outcomes: By the end of this chapter you will have an understanding of: the reasons for producing proteins from cloned genes some of the more common
Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary
Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page
Gene expression and regulation
PYF12 3/21/05 8:04 PM Page 191 Chapter 12 Gene expression and regulation Bacterial genomes usually contain several thousand different genes. Some of the gene products are required by the cell under all
European Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
Lecture 8. Protein Trafficking/Targeting. Protein targeting is necessary for proteins that are destined to work outside the cytoplasm.
Protein Trafficking/Targeting (8.1) Lecture 8 Protein Trafficking/Targeting Protein targeting is necessary for proteins that are destined to work outside the cytoplasm. Protein targeting is more complex
RNA: Transcription and Processing
8 RNA: Transcription and Processing WORKING WITH THE FIGURES 1. In Figure 8-3, why are the arrows for genes 1 and 2 pointing in opposite directions? The arrows for genes 1 and 2 indicate the direction
MCAS Biology. Review Packet
MCAS Biology Review Packet 1 Name Class Date 1. Define organic. THE CHEMISTRY OF LIFE 2. All living things are made up of 6 essential elements: SPONCH. Name the six elements of life. S N P C O H 3. Elements
Translation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS
Period Date REGENTS REVIEW: PROTEIN SYNTHESIS 1. The diagram at the right represents a portion of a type of organic molecule present in the cells of organisms. What will most likely happen if there is
Question 4 /29 points. Total /100 points
MIT Department of Biology 7.28, Spring 2005 - Molecular Biology 7.28 Spring 2005 Exam Three Question 1 Question 2 Question 3 /30 points /20 points /21 points Question 4 /29 points Total /100 points 1 Question
Molecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
AP BIOLOGY 2007 SCORING GUIDELINES
AP BIOLOGY 2007 SCORING GUIDELINES Question 4 A bacterial plasmid is 100 kb in length. The plasmid DNA was digested to completion with two restriction enzymes in three separate treatments: EcoRI, HaeIII,
2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
Enzymes. A. a lipid B. a protein C. a carbohydrate D. a mineral
Enzymes 1. All cells in multicellular organisms contain thousands of different kinds of enzymes that are specialized to catalyze different chemical reactions. Given this information, which of the following
Name Date Period. Keystone Review Enzymes
Name Date Period Keystone Review Enzymes 1. In order for cells to function properly, the enzymes that they contain must also function properly. What can be inferred using the above information? A. Cells
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the
Lecture 6. Regulation of Protein Synthesis at the Translational Level
Regulation of Protein Synthesis (6.1) Lecture 6 Regulation of Protein Synthesis at the Translational Level Comparison of EF-Tu-GDP and EF-Tu-GTP conformations EF-Tu-GDP EF-Tu-GTP Next: Comparison of GDP
What are the particular activities designed to do?
Notes to Instructors Chapter 16 The Molecular Basis of Inheritance What is the focus of these activities? Almost all introductory biology students know that DNA is the hereditary material in living cells.
Replication Study Guide
Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have
Genetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
Recombinant DNA Technology
Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium
AP BIOLOGY 2010 SCORING GUIDELINES (Form B)
AP BIOLOGY 2010 SCORING GUIDELINES (Form B) Question 2 Certain human genetic conditions, such as sickle cell anemia, result from single base-pair mutations in DNA. (a) Explain how a single base-pair mutation
Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein
Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of
Feed Forward Loops in Biological Systems
Feed Forward Loops in Biological Systems Dr. M. Vijayalakshmi School of Chemical and Biotechnology SASTRA University Joint Initiative of IITs and IISc Funded by MHRD Page 1 of 7 Table of Contents 1 INTRODUCTION...
Multiple Choice Write the letter that best answers the question or completes the statement on the line provided.
Name lass Date hapter 12 DN and RN hapter Test Multiple hoice Write the letter that best answers the question or completes the statement on the line provided. Pearson Education, Inc. ll rights reserved.
Name: Date: Period: DNA Unit: DNA Webquest
Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History http://www.dnaftb.org/dnaftb/1/concept/index.html Read the text and answer the following questions.
Control of Gene Expression
PER EIG 8 ontrol of Gene Expression n organism s D encodes all of the R and protein molecules that are needed to make its cells. Yet a complete description of the D sequence of an organism be it the few
Biology Final Exam Study Guide: Semester 2
Biology Final Exam Study Guide: Semester 2 Questions 1. Scientific method: What does each of these entail? Investigation and Experimentation Problem Hypothesis Methods Results/Data Discussion/Conclusion
