Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download ""

Transcription

1

2

3

4

5

6

7

8

9

10

11

12

13

14

15 DNA pol RNA pol ARS trna Ribosome DNA mrna Protein Transcription Translation Replication

16

17 A B Acceptor stem D-loop T C loop Anticodon loop Variable loop

18

19

20

21

22

23

24

25 Relative trna gene copy number box codons 3 box codons 4 box codons 6 box codons A A A A A V V A AG AG A AGG A V A L AG AGA L Relative codon frequency

26

27

28

29

30

31 i j c a o ac c a c c =[o 1,...,o 64 ] o o C a C a k a L A A 1 ˆr C A c a C a k a o ac L F a f ac r ac a a c a a c a c a

32 g c = o c o c c C g o ac g ac = o ac a A c C a f ac = o ac c C a o ac f r ac = 1 k a o ac c C a o ac = o ac o a k a r

33 w ac o ac w ac = c C a o ac

34 = o o o = c C o c C C o = o e o e o o e e e = a A n a o a k a

35 o a a o a a k a f f = a A F a ( a, a ) F a a a a a ( ) a ( a, a )= ac c C a f ac,f B(z z all ) = ( ) ( )

36 = { c C } = (, ) E c = f c e c f c e c = b 1 b 2 b 3 c

37 L L L L w ac w ac = f ac e ac w f ac e ac = b 1 b 2 b 3 b i i L =( wc(i)) 1 1 L = ( L i=1 L wc(i)) i=1

38 w ac = ( L w c (i) ) 1 L = ( 1 L w c (i) ) L i=1 i=1 = ( 1 L L i=1 o ac(i)) ( 1 L L i=1 o a, (i)) = ( 1 o c w c ) o c C w c = o c E[o c ] E[o c ] o c c E[o c ] (b 1 b 2 b 3 )

39 = ( 1 o c C w c ) 1 wc w c = w 0 c w +1 c w +2 c

40 c w c = f c fc fc fc c = 1 wc o c C w W c c t c W c = t (1 s ct )T ct s ct T ct t c W c W ac wac = W ac c C a W c w n = ( 1 ) o c wc o c C

41 s ct = U U σ U U U = M( ) M( ) = o! (o c!) c C c C f oc c

42 o c f c o c o = a A B a o a o o a a o B a B a = (o c e c )2 e c c C a χ 2 o c e c c χ 2 χ 2

43 χ 2 = 1 o a A o ac k 1 a k c C a 1 a o ac c a k a a χ 2 Z a f ac Z a = o a c C a fac 2 1 o a 1 N a = Z 1 a N a k a N a Z a k K = k K n k N a=k N a=k = 1 N a n k a K k

44 > Z Z k=3 = 1 ( 2 ( 1) 1 2 +( Z k=2 3Z k=4 3 ) 1 +( 3 5Z k=6 5 ) 1) = a A N a χ 2

45 X x 1,x 2,...x k X = I(o c ) c C a o c c C a a I( ) 1 o c 1 0 o =[5, 4, 0, 1] x a p x 2 k 1 [p 1,p 2,p 1 +p 2,p 3,...,p 1 +p p k ] 1 T i+1 = T i n 1 n n n = T n 1 1 T = QΛQ T Λ n = QΛ (n 1) Q T 1

46 p 1 p 2 p 1 p 1 D 0 p T Compute new state vector s p 2 p 1 +p 2 p T 1 +p 2 c 1 p 3 p 1 +p 3 p 2 +p 3 p 1 +p 2 +p 3 Repeat until end of sequence p 2 p 3 p 1 +p 3 p 2 +p 3 p 1 +p 2 +p 3 Sum the state vector c 2 c 3 s 1 s i+1 s n D 2 k 1 k = D n p z (z) =p x (x) p y (y) = i {k y,...,k} p x (i) p y (k i + 1) k p z p x + p y 1 k 1 x + y 1 x y

47 n = i o a > 0 i=1 x = a A x a x n nk =1 P (X x),

48 = a A F a E a F a E a H a (H a )= 2 k a E a = H a (H a ) = H a 2 k a H a a H a = f ac 2 f ac c C a a n H a = p a (c)p a (c c ) ka p a (c c ), i=2 p a (c) c p a (c c ) c c a

49 (H a )= o 1 k a. E a = (H a) H a (H a ) = 2 k a H a 2 k a = a A F a E a

50 p c c p c f c = c C f c p c = o + o o + o

51 =1 2p

52 = o o o = 1 M a K L a A L M a K M a M a =2 o ac o ac e ac c C a e ac K K = 1 (k a 1) 1 L 2 a A 1 /2 =

53 S k k S a = 1 k a (k a 1) c C a (r ac 1) 2 r ac k a a = a A F a S a F a 1/18

54 v(c) c 9 v(c) = (A(c i ),A(c)) i=1 A(c) d

55 β i i(g) g i E i (c) i c β 1 β 3

56 w ac w ac = o ac o ac o ac o ac

57 = 2 G(G 1) G i,j {1 ( (i), (j) )}

58 (x x)/s x s x / x Normalized mean CAI Fop CBI Nc Coefficient of variation CAI Fop CBI Nc GC content GC content (x x)/s x s x / x

59 Normalized mean CAI Fop CBI Nc Coefficient of variation CAI Fop CBI Nc Length Length

60 Normalized mean CAI Fop CBI Nc log CV CAI Fop CBI Nc Fraction of 4 & 6 degenerate codons Fraction of 4 & 6 degenerate codons d i d i 1 d = 1 2 {( 1 2 )0, ( 1 2 )1, ( 1 2 )2, ( 1 2 )3 } { 8 15, 4 15, 2 15, 1 15 }

61 Normalized mean CAI Fop CBI Nc log CV CAI Fop CBI Nc Degree of codon discrepancy Degree of codon discrepancy Y = a A F a Y a F a Y a

62 Normalized mean CAI Fop CBI Nc log CV CAI Fop CBI Nc Degree of amino acid discrepancy Degree of amino acid discrepancy = a A φ F a A φ F a

63

64 k s

65 k s k s d = k s [ ] k d [ ]. dt k s = k d [ ] [ ] k d = 2/t 1 2 k s k d

66 Transcription [mrna] Translation [Protein] Protein turnover mrna decay k s k d k s k d

67

68

69

70

71 A Bias towards reuse (standard deviations) Distance between codons (number of intervening amino acids) B C D

72

73

74

75

76 16 A B C Frequency Standard Deviations Standard Deviations Standard Deviations <

77 <

78

79

80 Slow translation (GFP1) Rapid translation (GFP2) Rapid translation (GFP2) Slow translation (GFP1)

81

82 Alanine normal autocorrelation shuffled within gene shuffled within genome Arginine Glycine Isoleucine 20 Leucine 20 Proline Serine Threonine percent deviation from expected Valine distance between codons (number of intervening amino acids) All >

83

84 S. cerevisiae 15 C. glabrata 10 D. melanogaster A. gossypii 10 A. thaliana 15 H. sapiens percent deviation from expected 5 0 S. pombe distance between codons (number of intervening amino acids) C. elegans

85

86

87

88 61 Anticodon-codon mapping AA-tRNA charging mrna trnas Amino acids Genetic code

89 B Anticodon A Anticodon Codon Codon A(I) U A U G C G C U A U A C G C G

90

91

92 π t e E j e ij =1 E T j t ij =1 T α β

93 π = [π 1,π 2 ] λ = {E,T,π} O P (O λ) P = P (O i λ), i P (O λ) P (λ O) P (M) P (O)

94 1 t 2 12 t trna AGC trna UGC 11 t 22 t e e 21 e 22 e 11 e 12 e 13 e 23 e 24 GCU GCC GCA GCG t π e x i i x i = c i n c c,

95 n c i n c = r c t r, t r c i c n c =( 1 /4)/( 1 /4 + 1 /3) = 3 /7 x i i i γx 2 i + ɛ i γ ɛ i Z =(X E[X])/σ X

96 AGC UGC trna 11 5 GCU GCC Codon GCA GCG trna 11 R 2 = p = Ala UGC Ala AGC Reading = = γx 2 + e s X s = i C ij X ij, i j, C ij +1 1 j

97 Consecutive codon GCU GCC GCA GCG GCU Leading codon GCC GCA GCG s n =(s s)/( s s)

98 ˆp = r +1 n +1, n r

99 1.0 Normalized Score CC REG HMM

100 <

101 Number of predictions Diffr. to random +/- HMM REG CC

102 a b c d e f a a a a a a a a a a a e e e d c b f

103 ψ ψ

104 2nd 1st T C A G Val Met Ile Leu Leu Phe T C A G GmAA ncm 5 UmAA m 5 CAA GAG UAG IAU A CAU init CAU IAC ncm 5 UAC CAC Ala Thr Pro Ser IGA ncm 5 UGA CGA AGG ncm 5 UGG IGU ncm 5 UGU CAU IGC ncm 5 UGC His Stop Tyr Glu Asp Lys Asn Gln G A GUG mcm 5 s 2 UUG CUG GUU mcm 5 s 2 UUU CUU GUC mcm 5 s 2 UUC CUC Gly Arg Ser Arg Trp Stop Cys GCA CmCA ICG CCG GCU mcm 5 UCU CCU GCC mcm 5 UCC CCC 2nd 3rd T C A G T C A G T C A G T C A G

105

106

107

108 Anticodon A G U C Pyr Pur Ile 4-box Gly ψ ψ

109

110

111

112

113 All Pairs All x All Comparison Candidate Pairs Formation of Stable Pairs Stable Pairs Verification of Stable Pairs Verified Pairs Clustering of Orthologs Group Pairs Broken Pairs Orthologous Groups >

114 l ( a 1, a 2 ) >l ( s 1, s 2 ) a 1 a 2 s 1 s 2 l d d + d

115 Triangle test [%] Domain test [%] Number of orthologous relations Fraction of genes with same number of domains Fraction of genes that pass triangle test Length Tolerance Orthologous relations [10 6 ] l

116 < l< l

117 No Tolerance Tolerance Score BBH RBH Distance RSD SP i, i j, j d j d >k σ 2 (d j d ) d i d >k σ 2 (d i d ) d k σ 2 (d j d )=σ 2 (d j )+σ 2 (d ) (d j,d ) k k

118 A x y 1? y 2 B C z x y 1 y 2 z x y 1 y 2 D z x d > 0 y 1 y 2 d

119 d d = d + d + d + d d d > 0 k k 1 2 d d d d

120 90 Fraction of SP passing test [%] l = 0.70 l = 0.65 l = 0.60 l = SP tolerance 2.4 l = 0.50 A B C x 1 y 2 dx 1 z 2 dy 2 z 1 dx 1 z 1 d y2 z 2 x 1 y 2 x 1 x 2 z 1 z 2 y 1 y 2 z 1 z 2 z 1 z 2

121 k

122 Fraction of VP passing test [%] l = 0.61, k SP = 1.81 l = 0.72, k SP = 1.67 l = 0.58, k SP = VP tolerance

123 A 800 w B x y w 1 x 1 z 1 z 2 y 2 z 1 z 2

124 ( n 2)

125 = Paralogs = Orthologs AP CP SP VP GP BP = SP minus VP Relative Amount [%] CP SP VP GP Type of Connection

126

127 i,j j i

128 Number of members Class All Bacteria Firmicutes Eukaryota Archaea Vertebrates Mammalia Group Size Genomes Orthologs Ave. groupsize Full

129

130

131 Codon 1st position T C A G Codon 2nd position T C A G Phe Leu Leu Ile Met + Init Val Ser Pro Thr Ala Tyr Stop His Gln Asn Lys Asp Glu Cys Stop Trp Arg Ser Arg Gly = 6 box = 4 box = 3 box = 2 box = 1 box T C A G T C A G T C A G T C A G Codon 3rd position

132 Cysteine Stop Tryptophan Threonine Tyrosine Stop Isoleucine Leucine A UC G U C A G G C U C A G C U A G Methionine Phenylalanine Asparagine A U C G C A U U A Lysine Serine Arginine A U C G G A U C G Glutamine A U C G C G U A A UC U G U C A C U C G G A A G U C A G A A U U G C C G A U G C U A G C U A G C Serine Arginine Alanine Valine Histidine Leucine Aspartic acid Proline Glycine Glutamic acid

133

134 1st Position T C A G Genetic code F S Y C T F S Y C C L $ S $ $ Q Y $ W W W W W C W W W A L S $ Q Q L L W G L T P H R T L T P H R C L T P Q R A L T S P Q R G I T N S T I T N S C I M M M M M T K N N N R $ S S G S S A M T K R $ S S G S S G V A D G T V A D G C V A E G A V A E G G T C A G 2nd Position 2nd Position

135

136 N N N H N NH 2 NH N N H N O NH 2 N N H NH 2 O NH N H O O S Strong M amino K Keto W Weak W Weak M amino K Keto S Strong Y pyrimidine C Cytosine T Thymine Y pyrimidine R purine A Adenine G Guanine R purine H not-g V not-t D not-c B not-a N any

137 Electricaly charged side chains Positive Negative Arginine Histidine Lysine Aspartic acid Glutamic acid Polar uncharged side chains Special cases Serine Threonine Asparagine Glutamine Cysteine Selenocysteine Glycine Proline Pyrrolysine Hydrophobic side chains Alanine Valine Leucine Isoleucine Methionine Phenylalanine Tyrosine Tryptophan

138 ψ

139

140

141 TPI = L - R (L + R = 1) Probability L R Changes 4 Valine A A A R M R R A V C V V C V A R 4 Arginine 5 Alanine Count the number of changes Calculate the distribution of changes

142 A B C GFP1 GFP1GFP2 GFP2GFP2 GFP2GFP1 TPI construct 2GFP GFP Intensity (arbitrary units) GFP2GFP1 GFP2GFP2 Position on gel GFP GFP Velocity ratio correlated vs. anti-correlated GFP1 GFP1 GFP1 All GFP2 GFP2 GFP2 TPI construct

143 Amino acid sequence MGCANLVSRLENNSRLLNRDLIAVTIGAIVYKDPHAGALRS... Subsequence of consecutive synonymous codons GCA GCA GCT GCG GCC... Observable output sequence 1, 1, 4, 3, 2,... 1 Count matrix of consecutive codon 1 1 1

144 Alanine Arginine Glutamine trna gene copy number GCA R squared = p val= GCT trna gene copy number R squared = p val= CGT CGG AGG AGA trna gene copy number CAG R squared = p val= CAA Codon frequency Glutamic acid Codon frequency Glycine Codon frequency Isoleucine trna gene copy number GAG R squared = p val= GAA trna gene copy number R squared = p val= GGA GGG GGC trna gene copy number ATA R squared = 1 p val= ATT Codon frequency Leucine 0e+00 4e+04 8e+04 Codon frequency Lysine Codon frequency Proline trna gene copy number R squared = p val= CTA CTC TTG TTA trna gene copy number R squared = AAG p val= AAA trna gene copy number CCT R squared = p val= CCA Codon frequency Serine Codon frequency Threonine Codon frequency Valine trna gene copy number R squared = p val= TCA AGC TCG TCT trna gene copy number R squared = p val= ACA ACG ACT trna gene copy number R squared = p val= 7e 04 GTG GTA GTT Codon frequency 2e+04 6e+04 1e+05 Codon frequency 4e+04 6e+04 8e+04 1e+05 Codon frequency

145 GCT GCC GCA GCG Alanine Arginine GCT GCC GCA GCG CGT CGC CGA CGG AGA AGG CGT CGC CGA CGG AGA AGG GGT GGC GGA GGG Glycine GGT GGC GGA GGG CCT CCC CCA CCG Proline CCT CCC CCA CCG CTT CTC CTA CTG TTA TTG Leucine Serine CTT CTC CTA CTG TTA TTG TCT TCC TCA TCG AGT AGC TCT TCC TCA TCG AGT AGC ACT ACC ACA ACG Threonine Valine ACT ACC ACA ACG GTT GTC GTA GTG GTT GTC GTA GTG

146 Alanine Arginine Glutamine HMM REG CC HMM REG CC HMM REG CC Glutamic acid Glycine Isoleucine HMM REG CC HMM REG CC HMM REG CC Leucine Lysine Proline HMM REG CC HMM REG CC HMM REG CC Serine Threonine Valine HMM REG CC HMM REG CC HMM REG CC

147 ψ ψ ψ

148

149

150

151

152

153

154

155

156

157

158

159

160

161

162

163

164

165

166

167

168

169

170

171

172

173

174

Molecular Facts and Figures

Molecular Facts and Figures Nucleic Acids Molecular Facts and Figures DNA/RNA bases: DNA and RNA are composed of four bases each. In DNA the four are Adenine (A), Thymidine (T), Cytosine (C), and Guanine (G). In RNA the four are

More information

Hands on Simulation of Mutation

Hands on Simulation of Mutation Hands on Simulation of Mutation Charlotte K. Omoto P.O. Box 644236 Washington State University Pullman, WA 99164-4236 omoto@wsu.edu ABSTRACT This exercise is a hands-on simulation of mutations and their

More information

Transcription and Translation. Chapter Ten

Transcription and Translation. Chapter Ten Transcription and Translation Chapter Ten Central Dogma DNA Transcription RNA Translation Protein Definitions Transcription To copy down, within the same language Language = Nucleic Acids DNA to RNA Translation

More information

In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA.

In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA. In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA. For each student: Science notebook Reproducible Master 6, Cooking Up a Protein

More information

(http://genomes.urv.es/caical) TUTORIAL. (July 2006)

(http://genomes.urv.es/caical) TUTORIAL. (July 2006) (http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA

More information

The Structure and Function of DNA

The Structure and Function of DNA Chapter 0 The Structure and Function of PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey,

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:

More information

Gene Translation:RNA -> Protein

Gene Translation:RNA -> Protein Gene Translation:RN -> Protein How does a particular sequence of nucleotides specify a particular sequence of amino acids? The answer: by means of transfer RN molecules, each specific for one amino acid

More information

DNA and Protein Synthesis Grade 10

DNA and Protein Synthesis Grade 10 Ohio Standards Connection: Life Sciences Benchmark C Explain the genetic mechanisms and molecular basis of inheritance. Indicator 5 Illustrate the relationship of the structure and function of DNA to protein

More information

Grundlagen der Bioinformatik, SS 08, D. Huson, April 21,

Grundlagen der Bioinformatik, SS 08, D. Huson, April 21, Grundlagen der Bioinformatik, SS 08, D. Huson, April 21, 2008 7 2 Introduction to Molecular Biology We will start with a very short repetition of the basics of molecular biology, including a summary of

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:.

More information

Just One Nucleotide! Exploring the Effects of Random Single Nucleotide Mutations

Just One Nucleotide! Exploring the Effects of Random Single Nucleotide Mutations Just One Nucleotide! Exploring the Effects of Random Single Nucleotide Mutations By Beatriz Gonzalez beatriz.gonzalez@sfcollege.edu Associate Professor, Santa Fe College, Gainesville, Florida In this exercise,

More information

Chapter 1: Bio Primer

Chapter 1: Bio Primer Chapter 1: Bio Primer 1.1 Cell Structure; DNA; RNA; transcription; translation; proteins Prof. Yechiam Yemini (YY) Computer Science Department Columbia University COMS 4761 --2007 Overview Cell structure

More information

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects Mutation Mutation provides raw material to evolution Different kinds of mutations have different effects Mutational Processes Point mutation single nucleotide changes coding changes (missense mutations)

More information

2. Describe (draw) the structure of a chromosome. Identify: DNA, proteins + a gene.

2. Describe (draw) the structure of a chromosome. Identify: DNA, proteins + a gene. Biology 12 DNA Functions Practice Exam - KEY A. DNA Structure 1. DNA is often called the "code of life". Actually it contains the code for a) the sequence of amino acids in a protein b) the sequence of

More information

Cathryn Kurkjian, PhD Postdoctoral Trainee University of North Carolina, Chapel Hill.

Cathryn Kurkjian, PhD Postdoctoral Trainee University of North Carolina, Chapel Hill. [Type here] [Type here] [Type here], PhD Postdoctoral Trainee University of North Carolina, Chapel Hill Email: kurkjiancj@gmail.com Twitter: @Cate_Kurkjian Image from: http://icsjournal.org/2015/03/02/dna-building-blocks-of-nanotechnology/

More information

Solution Key Problem Set 3

Solution Key Problem Set 3 Solution Key- 7.016 Problem Set 3 Question 1 The following human pedigree shows the inheritance pattern of a specific disease within a family. Assume that the individuals marrying into the family for all

More information

Gene Finding CMSC 423

Gene Finding CMSC 423 Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher

More information

Section 1 Workbook (unit 2) ANSWERS

Section 1 Workbook (unit 2) ANSWERS Section 1 Workbook (unit 2) ANSWERS Complete the following table: nucleotide DNA RN Name: B5. Describe DNA replication 1) Label each base given in the diagram below and describe the 4 primary characteristics

More information

DNA Lecture II Protein Synthesis Notes. Using the Code of Life DNA & RNA. Page #1 (Stratton 2010) Name: 2. : production of proteins

DNA Lecture II Protein Synthesis Notes. Using the Code of Life DNA & RNA. Page #1 (Stratton 2010) Name: 2. : production of proteins Page #1 Using the Code of Life DNA & RNA Slide #2 Two process involve DNA : making an copy of DNA a. purpose: b. occurs: c. uses: DNA : production of proteins a. purpose: & b. occurs: between nucleus &

More information

Mutations and Genetic Variability. 1. What is occurring in the diagram below?

Mutations and Genetic Variability. 1. What is occurring in the diagram below? Mutations and Genetic Variability 1. What is occurring in the diagram below? A. Sister chromatids are separating. B. Alleles are independently assorting. C. Genes are replicating. D. Segments of DNA are

More information

Beloit College BIOL Emerging Infectious Diseases

Beloit College BIOL Emerging Infectious Diseases Virus classification and life cycle activity For reference Transcription: Krasner p 131 Translation: Krasner p 132-135 Genetic code: Krasner p 135 A virus is an obligate intracellular parasite, meaning

More information

www.lessonplansinc.com Topic: Gene Mutations WS Summary: Students will learn about frame shift mutations and base substitution mutations. Goals & Objectives: Students will be able to demonstrate how mutations

More information

Aipotu Part III: Molecular Biology

Aipotu Part III: Molecular Biology Aipotu Part III: Molecular Biology Introduction: The Biological Phenomenon Under Study In this lab, you will continue to explore the biological mechanisms behind the expression of flower color in a hypothetical

More information

Molecular Biology Basic Concepts

Molecular Biology Basic Concepts Molecular Biology Basic Concepts Prof. Dr. Antônio Augusto Fröhlich Charles Ivan Wust LISHA - UFSC {guto charles}@lisha.ufsc.br http://www.lisha.ufsc.br/~{guto charles} September 2003 September 2003 http://www.lisha.ufsc.br/~guto

More information

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct

More information

Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae

Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae Journal of Cell and Molecular Research (2011) 3 (1), 1-11 Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae Fatemeh Moosavi 1, Hassan Mohabatkar

More information

Chapter 9. Applications of probability. 9.1 The genetic code

Chapter 9. Applications of probability. 9.1 The genetic code Chapter 9 Applications of probability In this chapter we use the tools of elementary probability to investigate problems of several kinds. First, we study the language of life by focusing on the universal

More information

Codon usage bias is correlated with gene expression levels in the fission yeast Schizosaccharomyces pombe

Codon usage bias is correlated with gene expression levels in the fission yeast Schizosaccharomyces pombe Codon usage bias is correlated with gene expression levels Blackwell Y Hiraoka usage Publishing et al. bias in fission Inc yeast in the fission yeast Schizosaccharomyces pombe Yasushi Hiraoka 1,2,3, *,

More information

Ruth Sundeen. Lesson 9 Part 1. Help Your Students Learn. Greetings and felicitations from Mrs. Ruth!

Ruth Sundeen. Lesson 9 Part 1. Help Your Students Learn. Greetings and felicitations from Mrs. Ruth! Ruth Sundeen Lesson 9 Part 1 Help Your Students Learn Ages: Eighth grade to high school senior Topics: Protein Synthesis Enzymes Experiment to demonstrate fragility of enzymes Greetings and felicitations

More information

Answers and Solutions to Text Problems

Answers and Solutions to Text Problems 22 Answers and Solutions to Text roblems 22.1 DA contains two purines, adenine (A) and guanine (G) and two pyrimidines, cytosine (C) and thymine (T). RA contains the same bases, except thymine (T) is replaced

More information

trna and Protein Building Lab Date Period

trna and Protein Building Lab Date Period trna and Protein Building Lab Name Date Period Purpose: RNA produced in the nucleus of a cell moves out of the nucleus to the cell s ribosomes. This RNA is a specific sequence of bases copied from the

More information

Woods Biol Hmwk DNA & Genetic Engineering (key) Pg. 1

Woods Biol Hmwk DNA & Genetic Engineering (key) Pg. 1 Woods Biol Hmwk-6 10-1 DNA & Genetic Engineering (key) Pg. 1 NOTE: Unless otherwise indicated in the problem, DNA will be from the Template strand. Figure 1: Look carefully at Fig s 1 & 2 to determine

More information

Unit 8 DNA Structure, Replication, and Protein Synthesis

Unit 8 DNA Structure, Replication, and Protein Synthesis Unit 8 DNA Structure, Replication, and Protein Synthesis Objective 3.01 Analyze the molecular basis of heredity including DNA replication, protein synthesis, and gene regulation 1. Which series is arranged

More information

HP22.1 Roth Random Primer Kit A für die RAPD-PCR

HP22.1 Roth Random Primer Kit A für die RAPD-PCR HP22.1 Roth Random Kit A für die RAPD-PCR Kit besteht aus 20 Einzelprimern, jeweils aufgeteilt auf 2 Reaktionsgefäße zu je 1,0 OD Achtung: Angaben beziehen sich jeweils auf ein Reaktionsgefäß! Sequenz

More information

1) The first codon translated by all eukaryotes is a. 2) The corresponding amino acid is.

1) The first codon translated by all eukaryotes is a. 2) The corresponding amino acid is. 1) The first codon translated by all eukaryotes is a. 2) The corresponding amino acid is. 3) Translation is terminated when the ribosome encounters. 4) Nucleic acid chains are synthesized in the to direction.

More information

7.012 Practice Quiz

7.012 Practice Quiz MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel 7.012 Practice Quiz 2 2004 Actual Quiz 2 (closed book)

More information

Gene Finding. Slides by Carl Kingsford

Gene Finding. Slides by Carl Kingsford Gene Finding Slides by Carl Kingsford Genome of the Cow a sequence of 2.86 billion letters enough letters to fill a million pages of a typical book. TATGGAGCCAGGTGCCTGGGGCAACAAGACTGTGGTCACTGAATTCATCCTTCTTGGTCTAACAGAGAACATAG

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information

BOC334 (Proteomics) Practical 1. Calculating the charge of proteins

BOC334 (Proteomics) Practical 1. Calculating the charge of proteins BC334 (Proteomics) Practical 1 Calculating the charge of proteins Aliphatic amino acids (VAGLIP) N H 2 H Glycine, Gly, G no charge Hydrophobicity = 0.67 MW 57Da pk a CH = 2.35 pk a NH 2 = 9.6 pi=5.97 CH

More information

Cambridge International Examinations Cambridge International Advanced Level

Cambridge International Examinations Cambridge International Advanced Level Cambridge International Examinations Cambridge International Advanced Level CHEMISTRY 9701/42 Paper 4 Structured Questions May/June 2014 2 hours Candidates answer on the Question Paper. Additional Materials:

More information

The amino acids differ in the properties of their side chains. Hydrophobic, non acidic (the H+ ion won t associate with water)

The amino acids differ in the properties of their side chains. Hydrophobic, non acidic (the H+ ion won t associate with water) Amino Acids 101 What is an amino acid? Amino acids, or alpha- amino acids, are the building blocks of peptides and proteins They are composed of amine and carboxylic acid groups, separated by the alpha-carbon

More information

Package acide-amine.sty

Package acide-amine.sty Package acide-amine.sty This package provide commands who draw an amino acid. You will nd below the list of amino acids available. Molecules were initialy drawn by Florian Hollandt, see : http://www.texample.net/tikz/examples/author/florian-hollandt/

More information

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core DNA Sequencing Services Pre-Mixed o Provide template and primer, mixed into the same tube* Pre-Defined o Provide template and primer in separate tubes* Custom o Full-service for samples with unknown concentration

More information

CHAPTER 16: ANSWERS TO SELECTED PROBLEMS

CHAPTER 16: ANSWERS TO SELECTED PROBLEMS CATER 16: ASWERS T SELECTED RBLEMS SAMLE RBLEMS ( Try it yourself ) 16.1 Connecting the base guanine (shown in Table 16.1) with ribose and phosphate gives the structure of GM. C 2 2 16.2 The complementary

More information

Blue Heron, Your Gene Synthesis Partner

Blue Heron, Your Gene Synthesis Partner Blue Heron, Your Gene Synthesis Partner You Design it We Build it Simple to Complex Sequences Codon Optimization Any species Variants Single or pooled clone libraries Antibody Affinity Optimization Whole

More information

Review of Central Dogma; Simple Mendelian Inheritance

Review of Central Dogma; Simple Mendelian Inheritance . Genome 371 Spring, 2005 Review of Central Dogma; Simple Mendelian Inheritance Problem Set #1 (not for credit): Problems 1-18 test your knowledge of the central dogma. The remaining problems are related

More information

The p53 MUTATION HANDBOOK

The p53 MUTATION HANDBOOK The p MUTATION HANDBOOK Version 1. /7 Thierry Soussi Christophe Béroud, Dalil Hamroun Jean Michel Rubio Nevado http://p/free.fr The p Mutation HandBook By T Soussi, J.M. Rubio-Nevado, D. Hamroun and C.

More information

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme. Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.

More information

REVISING DNA AND PROTEIN SYNTHESIS (LIVE) 01 JULY 2015 Exam Questions

REVISING DNA AND PROTEIN SYNTHESIS (LIVE) 01 JULY 2015 Exam Questions REVISING DNA AND PROTEIN SYNTHESIS (LIVE) 01 JULY 2015 Exam Questions Question 1 (Adapted from Feb/March 2015 Paper 2 DBE, Question 1.4) The diagram below represents DNA replication. 1.1 Identify the following:

More information

Concept 5.4: Proteins include a diversity of structures, resulting in a wide range of functions

Concept 5.4: Proteins include a diversity of structures, resulting in a wide range of functions Concept 5.4: Proteins include a diversity of structures, resulting in a wide range of functions Proteins account for more than 50% of the dry mass of most cells Some proteins speed up chemical reactions

More information

Global aspects in the algebraic approach to the genetic code

Global aspects in the algebraic approach to the genetic code PHYSICAL REVIEW E VOLUME 56, NUMBER 6 DECEMBER 1997 Global aspects in the algebraic approach to the genetic code Michael Forger Departamento de Matemática Aplicada, Instituto de Matemática e Estatística,

More information

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors.

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. Legends of supplemental figures and tables Figure 1: Overview of study design and results. (A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. After raw data gene expression

More information

Lecture 1 Introduction to Bioinformatics. Burr Settles IBS Summer Research Program 2008

Lecture 1 Introduction to Bioinformatics. Burr Settles IBS Summer Research Program 2008 Lecture 1 Introduction to Bioinformatics Burr Settles IBS Summer Research Program 2008 bsettles@cs.wisc.edu www.cs.wisc.edu/~bsettles/ibs08/ About Me instructor: Burr Settles 7 th year graduate student

More information

MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE 6 AND ATPASE 8 GENES IN DIFFERENT MAMMALIAN SPECIES

MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE 6 AND ATPASE 8 GENES IN DIFFERENT MAMMALIAN SPECIES , pp.-068-075. Available online at http://www.bioinfopublication.org/jouarchive.php?opt=&jouid=bpj0000220 MUTATION PRESSURE AND NATURAL SELECTION AFFECT PATTERN OF CODON USAGE BIAS IN MITOCHONDRIAL ATPASE

More information

UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS

UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS UIT (12) MLECULE F LIFE: UCLEIC ACID ucleic acids are extremely large molecules that were first isolated from the nuclei of cells. Two kinds of nucleic acids are found in cells: RA (ribonucleic acid) is

More information

DNA MUTATION, REPAIR, AND TRANSPOSITION

DNA MUTATION, REPAIR, AND TRANSPOSITION Hyde Chapter 18 Solutions 135 18 DNA MUTATION, REPAIR, AND TRANSPOSITION CHAPTER SUMMARY QUESTIONS 2. Silent mutations are those that do not produce a detectable phenotypic change. They can occur in the

More information

Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell?

Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell? Pipe Cleaner Proteins GPS: SB1 Students will analyze the nature of the relationships between structures and functions in living cells. Essential question: How does the structure of proteins relate to their

More information

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations http://members.cox.net/amgough/mutation_chromosome_translocation.gif Introduction: In biology, mutations are changes to the base

More information

Synonymous Codon Usage in Lactococcus lactis: Mutational Bias Versus Translational Selection

Synonymous Codon Usage in Lactococcus lactis: Mutational Bias Versus Translational Selection Journal of Biomolecular Structure & Dynamics, ISSN 0739-1102 Volume 21, Issue Number 4, (2004) Adenine Press (2004) Abstract Synonymous Codon Usage in Lactococcus lactis: Mutational Bias Versus Translational

More information

Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus

Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus Cao, H.W. and Zhang, H.* College of Biological Science and Technology, HeiLongJiang BaYi Agricultural University, DaQing 163319, China. *

More information

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C)

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C) TECHNICAL DATA SHEET BIOLUMINESCENCE RESONANCE ENERGY TRANSFER RENILLA LUCIFERASE FUSION PROTEIN EXPRESSION VECTOR Product: prluc-c Vectors Catalog number: Description: Amount: The prluc-c vectors contain

More information

Proteins. Amino Acids. Chapter 3. Molecular Diagnostics Fundamentals, Methods and Clinical Applications Second Edition 2/5/2013

Proteins. Amino Acids. Chapter 3. Molecular Diagnostics Fundamentals, Methods and Clinical Applications Second Edition 2/5/2013 Proteins Chapter 3 Amino Acids Nonpolar Alanine, Ala, A Isoleucine, Ile, I Leucine, Leu, L Methionine, Met, M Phenylalanine, Phe, F Tryptophan,Trp, W Valine, Val, V Negatively Charged (Acidic) Aspartic

More information

Hiding Data in DNA. 1 Introduction

Hiding Data in DNA. 1 Introduction Hiding Data in DNA Boris Shimanovsky *, Jessica Feng +, and Miodrag Potkonjak + * XAP Corporation + Dept. Computer Science, Univ. of California, Los Angeles Abstract. Just like disk or RAM, DNA and RNA

More information

PRACTICE TEST QUESTIONS

PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

Module 6: Digital DNA

Module 6: Digital DNA Module 6: Digital DNA Representation and processing of digital information in the form of DNA is essential to life in all organisms, no matter how large or tiny. Computing tools and computational thinking

More information

4 Titration Curve of an Amino Acid

4 Titration Curve of an Amino Acid p H 4 Titration Curve of an Amino Acid Simple amino acid Acidic amino acid Basic amino acid 7 OH - equivalents Objectives: A) To determine the titration curve for an amino acid and B) to use this curve

More information

Shu-Ping Lin, Ph.D. E-mail: splin@dragon.nchu.edu.tw

Shu-Ping Lin, Ph.D. E-mail: splin@dragon.nchu.edu.tw Amino Acids & Proteins Shu-Ping Lin, Ph.D. Institute te of Biomedical Engineering ing E-mail: splin@dragon.nchu.edu.tw Website: http://web.nchu.edu.tw/pweb/users/splin/ edu tw/pweb/users/splin/ Date: 10.13.2010

More information

This activity will help you to learn how a gene provides the instructions for making a protein.

This activity will help you to learn how a gene provides the instructions for making a protein. NAME: PERIOD: From Gene to Protein Transcription and Translation By Dr. Ingrid Waldron and Jennifer Doherty, Department of Biology, University of Pennsylvania, Copyright, 2009 i This activity will help

More information

Concluding lesson. Student manual. What kind of protein are you? (Basic)

Concluding lesson. Student manual. What kind of protein are you? (Basic) Concluding lesson Student manual What kind of protein are you? (Basic) Part 1 The hereditary material of an organism is stored in a coded way on the DNA. This code consists of four different nucleotides:

More information

Conversion of nucleotides sequences into genomic signals

Conversion of nucleotides sequences into genomic signals J.Cell.Mol.Med. Vol 6, No 2, 2002 pp. 279-303 Special Article: Getting DNA to numbers Conversion of nucleotides sequences into genomic signals P. D. Cristea * Bio-Medical Engineering Center, Politehnica

More information

Solution Key Problem Set

Solution Key Problem Set Solution Key- 7.013 Problem Set 3-2013 Question 1 You are analyzing the following human pedigree for a disease. Please note: The filled squares or circles represent the abnormal phenotype. The disease

More information

BIOLOGICAL BACKGROUND THE CENTRAL DOGMA OF MOLECULAR BIOLOGY

BIOLOGICAL BACKGROUND THE CENTRAL DOGMA OF MOLECULAR BIOLOGY BIOLOGICAL BACKGROUND Central Dogma DNA and RNA Structure Replication, Transcription and Translation Techniques of Molecular Genetics Using restriction enzymes Using PCR THE CENTRAL DOGMA OF MOLECULAR

More information

Introduction to Molecular Genetics

Introduction to Molecular Genetics Introduction to Molecular Genetics I. Introduction: A. ave you thought much about why you are like your parents, and your kids are (will be) like you? 1. Inherited traits result from the transfer of specific

More information

Students complete all index cards. 10 min. Completion of the anticipation guide.

Students complete all index cards. 10 min. Completion of the anticipation guide. 1 Tuesday, June 9 Objective Domain: Cells and Heredity Students explain the process of inheritance of genetic traits. Students differentiate between DNA and RNA, recognizing the role of each in heredity.

More information

Amino Acids, Peptides, Proteins

Amino Acids, Peptides, Proteins Amino Acids, Peptides, Proteins Functions of proteins: Enzymes Transport and Storage Motion, muscle contraction Hormones Mechanical support Immune protection (Antibodies) Generate and transmit nerve impulses

More information

Biology Genes

Biology Genes Slide 1 / 111 Slide 2 / 111 Biology Genes www.njctl.org Slide 3 / 111 Vocabulary Click on each word below to go to the definition. P site 3' end polymerase chain reaction 5' end parent strand A site promoter

More information

Protein Synthesis Simulation

Protein Synthesis Simulation Protein Synthesis Simulation Name(s) Date Period Benchmark: SC.912.L.16.5 as AA: Explain the basic processes of transcription and translation, and how they result in the expression of genes. (Assessed

More information

Translation. The process of converting the mrna base sequence into amino acid chains or proteins; occurs in the cytoplasm of the cell on ribosomes

Translation. The process of converting the mrna base sequence into amino acid chains or proteins; occurs in the cytoplasm of the cell on ribosomes The process of converting the mrna base sequence into amino acid chains or proteins; occurs in the cytoplasm of the cell on ribosomes The process of converting the mrna base sequence into amino acid chains

More information

IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon. V. Polypeptides and Proteins

IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon. V. Polypeptides and Proteins IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon A. Acid/Base properties 1. carboxyl group is proton donor! weak acid 2. amino group is proton acceptor! weak base 3. At physiological ph: H

More information

Unit 6 Study Guide Protein Name pg I can tell the difference between mrna, trna, and rrna.

Unit 6 Study Guide Protein Name pg I can tell the difference between mrna, trna, and rrna. Unit 6 Study Guide Protein Name pg. 1 1. I can tell the difference between mrna, trna, and rrna. Messenger RNA (mrna) acts as a copy of the instructions for making a protein. mrna carries these instructions

More information

Insulin mrna to Protein Kit

Insulin mrna to Protein Kit Insulin mrna to Protein Kit A 3DMD Paper BioInformatics and Mini-Toober Folding Activity Teacher Key and Teacher Notes www. Insulin mrna to Protein Kit Contents Becoming Familiar with the Data... 3 Identifying

More information

From Gene to Protein Transcription and Translation i

From Gene to Protein Transcription and Translation i From Gene to Protein Transcription and Translation i How do the genes in our DNA influence our characteristics? For example, how can a gene determine whether a person is an albino with very pale skin and

More information

The effect of trna levels on decoding times of mrna codons Supplementary File

The effect of trna levels on decoding times of mrna codons Supplementary File The effect of trna levels on decoding times of mrna codons Supplementary File Authors: Alexandra Dana 1 and Tamir Tuller 1 *. 1 The Department of Biomedical Engineering, Tel-Aviv University, Tel-Aviv 69978,

More information

This activity will help you to learn how a gene provides the instructions for making a protein.

This activity will help you to learn how a gene provides the instructions for making a protein. From Gene to Protein Transcription and Translation By Dr. Ingrid Waldron and Jennifer Doherty, Department of Biology, University of Pennsylvania, Copyright, 2009 1 This activity will help you to learn

More information

To measure the expression and regulation of the srfa and myc operons, lacz-reporter gene

To measure the expression and regulation of the srfa and myc operons, lacz-reporter gene SUPPLEMENTAL MATERIAL 1 1 1 1 1 0 1 Construction of reporter gene fusions To measure the expression and regulation of the srfa and myc operons, lacz-reporter gene fusions were made. For this the plasmid

More information

Table S1. Related to Figure 4

Table S1. Related to Figure 4 Table S1. Related to Figure 4 Final Diagnosis Age PMD Control Control 61 15 Control 67 6 Control 68 10 Control 49 15 AR-PD PD 62 15 PD 65 4 PD 52 18 PD 68 10 AR-PD cingulate cortex used for immunoblot

More information

B5 B8 ANWERS DNA & ) DNA

B5 B8 ANWERS DNA & ) DNA Review sheet for test B5 B8 ANWERS DNA review 1. What bonds hold complementary bases between 2 strands of DNA together? Hydrogen bonds 2. What bonds exist between sugars and phosphates? Covalent bonds

More information

Biological One-way Functions

Biological One-way Functions Biological One-way Functions Qinghai Gao, Xiaowen Zhang 2, Michael Anshel 3 gaoj@farmingdale.edu zhangx@mail.csi.cuny.edu csmma@cs.ccny.cuny.edu Dept. Security System, Farmingdale State College / SUNY,

More information

Guidelines for Writing a Scientific Paper

Guidelines for Writing a Scientific Paper Guidelines for Writing a Scientific Paper Writing an effective scientific paper is not easy. A good rule of thumb is to write as if your paper will be read by a person who knows about the field in general

More information

DNA: Molecule of Life

DNA: Molecule of Life DNA: Molecule of Life History DNA Structure Protein Synthesis Gene Regulation History of DNA H I S T O By the 1940 s, scientists knew that chromosomes consisted of both DNA and protein but did not know

More information

Transcription, Translation & Protein Synthesis

Transcription, Translation & Protein Synthesis Transcription, Translation & Protein Synthesis Do you remember what proteins are made of? Hundreds of Amino Acids link together to make one Protein There are 20 types of amino acids, some we can make,

More information

DNA Sample preparation and Submission Guidelines

DNA Sample preparation and Submission Guidelines DNA Sample preparation and Submission Guidelines Requirements: Please submit samples in 1.5ml microcentrifuge tubes. Fill all the required information in the Eurofins DNA sequencing order form and send

More information

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain?

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain? Networked Systems, COMPGZ01, 2012 Answer TWO questions from Part ONE on the answer booklet containing lined writing paper, and answer ALL questions in Part TWO on the multiple-choice question answer sheet.

More information

Translation Activity Guide

Translation Activity Guide Translation Activity Guide Teacher Key β-globin Translation Translation occurs in the cytoplasm of the cell and is defined as the synthesis of a protein (polypeptide) using information encoded in an mrna

More information

Genetics. Instructor: Dr. Jihad Abdallah Topic 5: Translation of RNA (Protein synthesis)

Genetics. Instructor: Dr. Jihad Abdallah Topic 5: Translation of RNA (Protein synthesis) Genetics Instructor: Dr. Jihad Abdallah Topic 5: Translation of RNA (Protein synthesis) 1 Central dogma of genetics DNA In the nucleus Transcription mrna Translation In the cytoplasm Protein 2 3 The primary

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

Analysis of Synonymous Codon Usage Bias in Chlamydia

Analysis of Synonymous Codon Usage Bias in Chlamydia ISSN 1672-9145 Acta Biochimica et Biophysica Sinica 2005, 37(1): 1 10 CN 31-1940/Q Analysis of Synonymous Codon Usage Bias in Chlamydia Hui LÜ, Wei-Ming ZHAO*, Yan ZHENG, Hong WANG, Mei QI, and Xiu-Ping

More information

Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation. Beginning Perl, Chap 4 6. Example 1

Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation. Beginning Perl, Chap 4 6. Example 1 Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation Beginning Perl, Chap 4 6 Example 1 #!/usr/bin/perl -w use strict; # version 1: my @nt = ('A', 'C', 'G', 'T'); for

More information