SEAC 2012 Medical Director Potpourri BANNER. WILLIAM PENN. YOUR COMPANY FOR LIFE

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "SEAC 2012 Medical Director Potpourri BANNER. WILLIAM PENN. YOUR COMPANY FOR LIFE"

Transcription

1 SEAC 2012 Medical Director Potpourri BANNER. WILLIAM PENN. YOUR COMPANY FOR LIFE

2 SEAC ML ENGMAN, MD Vice President and Chief Medical Director BANNER. WILLIAM PENN. YOUR COMPANY FOR LIFE

3 UNDERWRITING SLEEP APNEA BANNER. WILLIAM PENN. YOUR COMPANY FOR LIFE

4 Observation vs Polysomnography Spec = 100% Sens = 64.5% (Miss 35%) PVP = 100% NPV = 64.7% Accuracy = 70.3% Severity as judged clinically did not correlate with polysomnography Hoponik: Am J Med 1984;77:671 11/17/2012

5 POLSOMNOGRAPHY.

6 11/17/2012

7 NORMAL DISTRIBUTION OF SLEEP STAGES. REM: 25% Activated sleep Dream sleep Stage 1: 5% drowsiness Stage ¾: 25% deep sleep slow wave sleep Stage 2: 45% light sleep

8 SLEEP STAGE DISTRIBUTION THROUGH THE NIGHT. REM Wake Stage 1 Stage 2 Stage 3 Stage Hours of Sleep

9

10 SLEEP APNEA. Apnea: Cessation of airflow >10 secs Central (uncommon) Obstructive Mixed Hypopnea Partial Apnea >30% or 50% reduction in airflow 3% or 4% Desaturation + Associated with Arousal

11 CENTRAL SLEEP APNEA. NASAL/ORAL AIRFLOW THORACIC RESPIRATION O 2 SATURATION 100% SaO2 0% 10 SECONDS

12 OBSTRUCTIVE Sleep Apnea. NASAL/ORAL AIRFLOW THORACIC RESPIRATION O 2 SATURATION 100% SaO2 0% 10 SECONDS

13 MIXED SLEEP APNEA. NASAL/ORAL AIRFLOW THORACIC RESPIRATION O 2 SATURATION 100% SaO2 0% 10 SECONDS

14 SLEEP APNEA SYNDROME. Apnea Index (AI) Total # Apneas Total Sleep Time Hypopnea Index (HI) Tot # Hypopneas HI = Total Sleep Time Apnea Hypopnea Index (AHI) AHI = AI + HI Respiratory Disturbance Index (RDII) RDII = AI + HI + RERA 11/17/2012 AI = = = Apneas Hour Hypopneas Hour

15 SLEEP APNEA, SEVERITY. Normal: AHI <5 Mild: AHI 5-15 Moderate: AHI Severe: AHI >30

16 NOCTURNAL OXIMETRY.

17 SPECTRUM OF SLEEP RELATED OBSTRUCTIVE BREATHING Other excess mortality DISORDERS. Cardiovascular disease Accidents Cognitive dysfunction Excessive daytime sleepiness SEVERITY Diurnal hypertension Nocturnal hypertension Sleep fragmentation Social isolation 11/17/2012 Snoring UARS OSAS OHS UARS: upper airway resistance syndrome; OSAS: obstructive sleep apnea syndrome; OHS: obesity-hypoventilation syndrome

18 COMPLICATIONS OF SAS. Excessive daytime sleepiness (EDS) Cognitive dysfunction Polycythemia Hypertension Pulmonary Systemic Cor Pulmonale Elevated NTproBNP Arrhythmias (Atrial and Ventricular) LVH Left Heart Failure Sudden Death 11/17/2012

19 Treatment for OSAS Position therapy Weight loss Medications protriptyline medroxyprogesterone theophylline almitrine oxygen modafinil Surgery uvulopalatopharyngoplasty (UPPP) nasal surgery maxillary surgery mandibular surgery tracheostomy Oral Appliances Positive airway pressure (ncpap, BiPAP, etc) Hypoglossal Nerve Pacemaker 11/17/2012 Effectiveness +/- +/- No No No No? May help EDS +/- +/- +/- +/- + +/- + Experimental

20 POSITIVE AIRWAY PRESSURE (PAP). CPAP, ncpap, BiPAP, EPAP, BiFlex; APAP 11/17/2012

21 OSA OSA CSA CSA All events Events per hour Legal & General America NCPAP IMPROVES APNEAS Control NCPAP 11/17/2012 Rajagopal: Chest 1986;90:172

22 NCPAP IMPROVES SLEEP. REM=25% Stage 1=5% NORMAL Stage 3/4=25% Stage 2 =45% 12% 1% 16% 5% OSAS NCPAP 11/17/ % 48%

23 Sleepiness Score Legal & General America NCPAP IMPROVES SLEEPINESS. 11/17/ Patients Control NCPAP Rajagopal: Chest 1986;90:172

24 Percent Compliant Legal & General America NCPAP COMPLIANCE IS POOR Months of Follow-up 11/17/2012 Somniloquy, V3,No3

25 He (1988): Age < % compared to USLT Age 50+ No XS mortality Lavie (1995): Age No XS mortality Age Age % compared to pop (Univariate) No XS mortality Bliwise (1988): Age 66 No XS mortality Mant (1995): Age 80 No XS mortality Ancoli-Israel (1989): Nursing Home XS mortality in women Pollack (1990): Community Dwelling Elderly, Questionnaire. No XS Mortality 25

26 Marti (2001): Ages 17-50: RMR=1,606 (603%-4,280%) Ages51-60 RMR=595% ( ) Age 60+ RMR=336% ( ) Marin (2005): Snoring RMR=103% (31%-184%)) Mild-Mod (AHI=5-30) RMR=115% (34%-260%) Severe (AHI>30) RMR=287% (117%-751%) ncpap RMR=105% (59%-221%) Young (2008): Mild (AHI 5-15) RMR=150% (80%-280%) Moderate (AHI 15-30) RMR=130% (50%-320%) Severe (AHI >30) RMR=270% (130%-570%) Johansson (2011): Ages No XS Mortality 26

27 An 18 year follow-up of the Wisconsin Sleep Cohort Observational study of 1522 subjects begun in 1988 Random sample of men and women age recruited from several Wisconsin State agencies Mostly untreated (126 treated with ncpap) RMR adjusted for age, sex, BMI, BP, SBP, DBP, use of antihypertensive mediations, diabetes, CAD, CV disease, CHF, MI, cardiac surgery, stroke RMR = 1.0 (reference group) RMR = 1.5 ( ) RMR = 1.3 ( ) RMR = 2.7 ( ) 27 Young: Sleep. 2008;31:

28 871 Patients with OSAS followed for mean of 4 years Mean Age = ; 80% Males CPAP compliance: <1h/d; 1-6h/d; >6h/d CPAP >6h/d; AHI= CPAP 1-6h/d RMR = 2.4 ( ) AHI= CPAP <1h/d RMR = 4 ( ) AHI= Campos-Rodriguez. Chest 2005;128:

29 Summary Types of Sleep Apnea: Central, Mixed, Obstructive Central Sleep Apnea: Rare Mortality risk is largely that of underlying cause Diagnosis: Observation is 90% accurate; Polysomnography is necessary to quantify severity Treatment: Medications are ineffective Tracheostomy is universally effective ncpap is almost universally effective All other treatments may be effective in selected patients 11/17/2012

30 Summary Weight Loss: 10% reduction in BMI = 20% reduction in AHI UPPP: Cures snoring in 100% Improves Sleep Apnea in 50% (carefully selected patients)) Cures Sleep Apnea in 25% (carefully selected patients) ncpap compliance: First 6 months: 6% quit per month Then then 6% quit per year Mortality (OSAS) Pickwickian : Very high Untreated: ~ 150% if mild to 300%+ if severe Inversely related to age (Higher in younger subjects) 11/17/2012

31 Family History of Cancer BANNER. WILLIAM PENN. YOUR COMPANY FOR LIFE

32 Cancer Genetics The etiology of Cancer is Multifactorial Interaction of Environmental and Genetic Factors Environmental Factors Chemicals and Toxins Benzene Radiation UV, Radon, X-ray Tobacco Smoke Cigarette Smoke Passive Exposure Silicates (Asbestos, Silicates) Genetics

33 Proteins: the product of genes Proteins Responsible for all anatomic and metabolic characteristics Formed by combining amino acids Sequence of DNA base pairs determines the order that amino acids are combined to form a protein Transcription and Translation Gene Portion of DNA forming coding sequence 20,000 to 25,000 genes Chromosome Coiled strand of DNA, 23 pairs of chromosomes, one of each pair inherited from each parent 22 pairs of autosomes, 1 pair of sex chromosomes (XX or XY)

34 The Genetic Code Amino Acid Abb. mrna codons Stop codons UAA UAG UGA Alanine Ala GCA GCC GCG GCU Arginine AGA AGG CGA Arg CGC CGG CGU Asparagine Asn AAC AAU Aspartic acid Asp GAC GAU Cysteine Cys UGC UGU Glutamic acid Glu GAA GAG Glutamine Gln CAA CAG Glycine Gly GGA GGC GGG GGU Histidine His CAC CAU Isoleucine Ile AUA AUC AUU Amino Acid Abb. mrna codons Leucine CUA CUC CUG Leu CUU UUA UUG Lysine Lys AAA AAG Methionine* Met AUG Phenylalanine Phe UUC UUU Proline Pro CCA CCC CCG CCU Serine AGC AGU UCA Ser UCC UCG UCU Threonine Thr ACA ACC ACG ACU Tryptophan Trp UGG Tyrosine Tyr UAC UAU Valine Val GUA GUC GUG GUU

35 Mutations Permanent Changes in DNA sequence Inherited Changes carried in gem cells (sperm and egg) All resulting cells in the body will carry the mutation Acquired Caused by DNA damage: Radiation Chemicals Toxins Spontaneous during replication Types: Missense, Nonsense, Stop Codons

36 Karyotype: the Normal Set of Chromosomes: Normal Male Karyotype Normal Female Karyotype One of each pair of chromosomes from each parent means 2 copies of each gene, one from each parent

37 Cancer Genes Oncogenes Mutation of a proto-oncogene to an active oncogene promotes cancer development Tumor suppressor Genes Inactivation of a tumor suppressor gene allows cancer to develop Mismatch Repair Genes Failure to repair spontaneous gene mutations allows cancer to develop

38 Hereditary Cancer Syndromes, some examples Syndrome Gene Cancer Lifetime Risk Other Cancers Hereditary Breast Ovarian Cancer Syndrome HNPCC BRCA1 BRCA2 MLH1 MSH2&6 PMS1&2 Breast Ovarian Breast Ovarian 50-80% (Breast) 20-40% (Ovarian) 50-80% ( Breast) 6-10% ( Breast) 10-20% (Ovarian) Ovarian, prostate, pancreatic, peritoneal Prostate Colon 80% Endometrial, Ovarian, GI, Urinary Tract FAP APC Colon 100% Duodenal, Gastric, Desmoid Familial Melanoma 5-7% Dysplastic Nevi, Pancreatic, neural Li-Fraumeni P53 many 50% by age 30 Brain, Leukemia, Sarcoma

39 Family History, a primary risk assessment tool Male Female Br 65 A 67 A 65 A 35 A 37 A 42

40 Family History, a primary risk assessment tool Br 65 A 67 A 65 A 35 A 37 A 42

41 Family History, a primary risk assessment tool D Unk Br 50s D 60s D Unk CRC 50 D 95 Br 50s D 50s A 90 Br 55 D 56 Br 65 A 67 Ov 50 D 52 A 65 A 35 A 37 A 42 A 87 Br 40 Ov 45 D 45 MI 80 D 80 Pr 70 D 78 Breast and/or Ovarian Cancer affecting every generation Male breast cancer Single lineage

42 Family Histories Size Age Density Large Small Young Small Smaller Families Younger Families Fewer Cancers Larger Families Older Families More Cancers

43 Prevalence of Any Family History of Cancer Ages Sex Lung Colon Breast Ovarian Prostate Total M 1.4% 0.4% 2.9% 0.7% 0.7% 5.7% F 1.8% 1.0% 2.7% 1.8% 1.2% 7.9% M 7.5% 4.6% 7.2% 2.0% 6.4% 24.5% F 8.0% 6.3% 8.7% 2.0% 5.7% 26.7% M 10.7% 10.5% 14.1% 2.2% 7.0% 36.0% F 11.7% 9.6% 13.1% 2.3% 7.0% 34.4% M 10.0% 9.3% 13.1% 1.8% 8.3% 34.8% F 12.1% 10.2% 15.5% 2.7% 7.9% 38.2% Total M 6.7% 4.5% 7.1% 1.5% 4.8% 21.2% F 7.5% 5.4% 8.4% 2.0% 4.6% 23.5% Ramsay: Genetics in Med 2006; 8:

44 Percentage of Cases based on Number of First Degree Relatives with Cancer Cancer One first degree Relative Two first degree Relatives Three or more first degree Relatives Lung 93.6% 5.2% 1.2% Colon 93.1% 5.0% 1.8% Breast 91.8% 7.2% 1.0% Ovarian 94.9% 4.5% 0.6% Prostate 93.5% 5.5% 1.0% Ramsay: Genetics in Med 2006; 8:

45 Odds Ratios for Developing Specific Cancers based on Family History Ages Family History Prevalence Odds Ratio relative to no family history (95% CI) Breast Strong 5.0% 1.51 ( ) Moderate 5.0% 1.97 ( ) Ovarian Strong 6.7% 2.6% ( ) Moderate 1.6% 3.27 ( ) Prostate Strong 0.7% 1.59 ( ) Moderate 4.5% 2.03 ( ) Colon Strong 1.1% 1.47 ( ) Moderate 4.2% 1.76 ( ) Scheuner: Genetics in Med 2010; 12:

46 Hazard Ratio for Concordant Cancer Death in Offspring Ages Family History Hazard Ratio relative to no family history (95% CI) Breast Nonfatal 1.51 ( ) Fatal 1.97 ( ) Ovarian Nonfatal 2.6% ( ) Fatal 3.27 ( ) Prostate Nonfatal 1.59 ( ) Fatal 2.03 ( ) Colon Nonfatal 1.47 ( ) Fatal 1.76 ( ) Hemminki: J Clin Oncol 2011;29:

47 Hazard Ratio for Concordant Cancer Death in Offspring Number of Affected Family Members Family History Score >=3 Total 0 420, ,136 Low ,979 Medium 0 10, ,975 High 0 9,266 1, ,983 Total 420,136 31,118 1, ,073 Yang: Am J Epidemiol 1998; 147:652-9

48 Hazard Ratio for Dying from Breast Cancer based on Number Family Members with Breast Cancer and Family History Score Number of Breast Cancers in Family 1 2 Ages HR (95% CI) HR (95% CI) <= (2-11.8) ( ) 1.0 ( ) ( ) 1.1 ( ) >= ( ) 1.1 ( ) All Ages 1.6 ( ) 1.7 ( ) Family History Score Low Med High HR (95% CI) HR (95% CI) HR (95% CI) ( ) 0.8 ( ) 1.7 ( ) 3.3 ( ) 1.4 ( ) 1.9 ( ) 1.9 ( ) 1.0 ( ) 1.5 ( ) 1.7 ( ) 1.0 ( ) 1.6 ( ) 2.3 ( ) Yang: Am J Epidemiol 1998; 147:652-9

49 Family History, Summary All Cancer is ultimately Genetic A Moderate to Strong Family History of Cancer is associated a 1.5 to 2 fold increased risk of a family member developing cancer Hereditary Cancer syndromes are uncommon (prevalence = 1% to 2%) but are associated with a 6 to 8 fold or higher relative risk of developing cancer Not all Family Histories are created equal The Significance of a Family History depends on the age and size of the family, the density of the impairment and the lineage

50 SEAC 2012 Medical Director Potpourri BANNER. WILLIAM PENN. YOUR COMPANY FOR LIFE

51 Medical Underwriting Actuarial Collaboration Actuaries decide on the desired composition and mortality parameters defining a block of business or class the blueprint Underwriters and Medical Directors build that block of business or class, one case at a time It is surprising how closely the closely the completed block of business resembles the desired outcome considering the builders usually never see the blueprint

52 Areas for Further Dialogue and Collaboration Mortality Assumptions Impairment Ratings EDR Mortality Multiples (Table Ratings) Mortality Modeling Uncommon Impairments Genetic Impairments Life Expectancies Back Calculate Mortality Multiples Protective Value Projections and Studies Mortality Savings Claims Analysis Data Mining Multivariate Analysis

53 Areas for Further Dialogue and Collaboration Mortality Assumptions Impairment Ratings EDR Mortality Multiples (Table Ratings) Mortality Modeling Uncommon Impairments Genetic Impairments Life Expectancies Back Calculate Mortality Multiples Protective Value Projections and Studies Mortality Savings Claims Analysis Data Mining Multivariate Analysis

54 Protective Value, Caveat Mortality Savings Can Be Demonstrated for Almost Every underwriting Requirement The Cost of Good Business Lost due to false positive results must be considered Test Sensitivity = TP/(TP+FN) = TPR Test Specificity = TN/(TN+FP); FPR= 1-Specificity= FP/(TN+FP) 1.0 Ideal Test TPR Mediocre Test Worthless Test 0 FPR 1.0

55 DISCLOSURE. DISCLOSURE. Legal & General America life insurance products are underwritten and issued by Banner Life Insurance Company, Urbana, MD and William Penn Life Insurance Company of New York, Garden City, NY. Banner products are distributed in 49 states and in DC. William Penn products are available exclusively in New York; Banner does not solicit business there. Not for public distribution. For agent/broker use only.

Hands on Simulation of Mutation

Hands on Simulation of Mutation Hands on Simulation of Mutation Charlotte K. Omoto P.O. Box 644236 Washington State University Pullman, WA 99164-4236 omoto@wsu.edu ABSTRACT This exercise is a hands-on simulation of mutations and their

More information

In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA.

In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA. In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA. For each student: Science notebook Reproducible Master 6, Cooking Up a Protein

More information

Molecular Facts and Figures

Molecular Facts and Figures Nucleic Acids Molecular Facts and Figures DNA/RNA bases: DNA and RNA are composed of four bases each. In DNA the four are Adenine (A), Thymidine (T), Cytosine (C), and Guanine (G). In RNA the four are

More information

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects Mutation Mutation provides raw material to evolution Different kinds of mutations have different effects Mutational Processes Point mutation single nucleotide changes coding changes (missense mutations)

More information

Gene Finding CMSC 423

Gene Finding CMSC 423 Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher

More information

Aipotu Part III: Molecular Biology

Aipotu Part III: Molecular Biology Aipotu Part III: Molecular Biology Introduction: The Biological Phenomenon Under Study In this lab, you will continue to explore the biological mechanisms behind the expression of flower color in a hypothetical

More information

Solution Key Problem Set 3

Solution Key Problem Set 3 Solution Key- 7.016 Problem Set 3 Question 1 The following human pedigree shows the inheritance pattern of a specific disease within a family. Assume that the individuals marrying into the family for all

More information

(http://genomes.urv.es/caical) TUTORIAL. (July 2006)

(http://genomes.urv.es/caical) TUTORIAL. (July 2006) (http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA

More information

Cathryn Kurkjian, PhD Postdoctoral Trainee University of North Carolina, Chapel Hill.

Cathryn Kurkjian, PhD Postdoctoral Trainee University of North Carolina, Chapel Hill. [Type here] [Type here] [Type here], PhD Postdoctoral Trainee University of North Carolina, Chapel Hill Email: kurkjiancj@gmail.com Twitter: @Cate_Kurkjian Image from: http://icsjournal.org/2015/03/02/dna-building-blocks-of-nanotechnology/

More information

Gene Finding. Slides by Carl Kingsford

Gene Finding. Slides by Carl Kingsford Gene Finding Slides by Carl Kingsford Genome of the Cow a sequence of 2.86 billion letters enough letters to fill a million pages of a typical book. TATGGAGCCAGGTGCCTGGGGCAACAAGACTGTGGTCACTGAATTCATCCTTCTTGGTCTAACAGAGAACATAG

More information

Section 1 Workbook (unit 2) ANSWERS

Section 1 Workbook (unit 2) ANSWERS Section 1 Workbook (unit 2) ANSWERS Complete the following table: nucleotide DNA RN Name: B5. Describe DNA replication 1) Label each base given in the diagram below and describe the 4 primary characteristics

More information

DNA pol RNA pol ARS trna Ribosome DNA mrna Protein Transcription Translation Replication A B Acceptor stem D-loop T C loop Anticodon loop Variable loop Relative trna gene copy number 0.0 0.2 0.4

More information

Cambridge International Examinations Cambridge International Advanced Level

Cambridge International Examinations Cambridge International Advanced Level Cambridge International Examinations Cambridge International Advanced Level CHEMISTRY 9701/42 Paper 4 Structured Questions May/June 2014 2 hours Candidates answer on the Question Paper. Additional Materials:

More information

DNA and Protein Synthesis Grade 10

DNA and Protein Synthesis Grade 10 Ohio Standards Connection: Life Sciences Benchmark C Explain the genetic mechanisms and molecular basis of inheritance. Indicator 5 Illustrate the relationship of the structure and function of DNA to protein

More information

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct

More information

Underwriting Sleep Apnea

Underwriting Sleep Apnea Underwriting Sleep Apnea Joel Weiner, MD, FLMI April 29, 2014 WAHLU The Northwestern Mutual Life Insurance Company Milwaukee, WI A Brief Survey Before We Get Started The Weiner Sleepiness Scale How likely

More information

Protein Synthesis Simulation

Protein Synthesis Simulation Protein Synthesis Simulation Name(s) Date Period Benchmark: SC.912.L.16.5 as AA: Explain the basic processes of transcription and translation, and how they result in the expression of genes. (Assessed

More information

trna and Protein Building Lab Date Period

trna and Protein Building Lab Date Period trna and Protein Building Lab Name Date Period Purpose: RNA produced in the nucleus of a cell moves out of the nucleus to the cell s ribosomes. This RNA is a specific sequence of bases copied from the

More information

Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell?

Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell? Pipe Cleaner Proteins GPS: SB1 Students will analyze the nature of the relationships between structures and functions in living cells. Essential question: How does the structure of proteins relate to their

More information

Biological One-way Functions

Biological One-way Functions Biological One-way Functions Qinghai Gao, Xiaowen Zhang 2, Michael Anshel 3 gaoj@farmingdale.edu zhangx@mail.csi.cuny.edu csmma@cs.ccny.cuny.edu Dept. Security System, Farmingdale State College / SUNY,

More information

Hiding Data in DNA. 1 Introduction

Hiding Data in DNA. 1 Introduction Hiding Data in DNA Boris Shimanovsky *, Jessica Feng +, and Miodrag Potkonjak + * XAP Corporation + Dept. Computer Science, Univ. of California, Los Angeles Abstract. Just like disk or RAM, DNA and RNA

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:

More information

CHAPTER 16: ANSWERS TO SELECTED PROBLEMS

CHAPTER 16: ANSWERS TO SELECTED PROBLEMS CATER 16: ASWERS T SELECTED RBLEMS SAMLE RBLEMS ( Try it yourself ) 16.1 Connecting the base guanine (shown in Table 16.1) with ribose and phosphate gives the structure of GM. C 2 2 16.2 The complementary

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information

Answers and Solutions to Text Problems

Answers and Solutions to Text Problems 22 Answers and Solutions to Text roblems 22.1 DA contains two purines, adenine (A) and guanine (G) and two pyrimidines, cytosine (C) and thymine (T). RA contains the same bases, except thymine (T) is replaced

More information

Insulin mrna to Protein Kit

Insulin mrna to Protein Kit Insulin mrna to Protein Kit A 3DMD Paper BioInformatics and Mini-Toober Folding Activity Teacher Key and Teacher Notes www. Insulin mrna to Protein Kit Contents Becoming Familiar with the Data... 3 Identifying

More information

Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus

Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus Synonymous Codon Usage Bias in Porcine Epidemic Diarrhea Virus Cao, H.W. and Zhang, H.* College of Biological Science and Technology, HeiLongJiang BaYi Agricultural University, DaQing 163319, China. *

More information

Review of Central Dogma; Simple Mendelian Inheritance

Review of Central Dogma; Simple Mendelian Inheritance . Genome 371 Spring, 2005 Review of Central Dogma; Simple Mendelian Inheritance Problem Set #1 (not for credit): Problems 1-18 test your knowledge of the central dogma. The remaining problems are related

More information

Ruth Sundeen. Lesson 9 Part 1. Help Your Students Learn. Greetings and felicitations from Mrs. Ruth!

Ruth Sundeen. Lesson 9 Part 1. Help Your Students Learn. Greetings and felicitations from Mrs. Ruth! Ruth Sundeen Lesson 9 Part 1 Help Your Students Learn Ages: Eighth grade to high school senior Topics: Protein Synthesis Enzymes Experiment to demonstrate fragility of enzymes Greetings and felicitations

More information

Woods Biol Hmwk DNA & Genetic Engineering (key) Pg. 1

Woods Biol Hmwk DNA & Genetic Engineering (key) Pg. 1 Woods Biol Hmwk-6 10-1 DNA & Genetic Engineering (key) Pg. 1 NOTE: Unless otherwise indicated in the problem, DNA will be from the Template strand. Figure 1: Look carefully at Fig s 1 & 2 to determine

More information

Does sleep apnea cause heart disease?

Does sleep apnea cause heart disease? Does sleep apnea cause heart disease? Updates in Cardiology 2015 7 Mar 2015 Robert J Farney MD Intermountain Sleep Disorders Center LDSH Medical Director robertjfarney@gmail.com Does sleep apnea cause

More information

Synonymous Codon Usage in Lactococcus lactis: Mutational Bias Versus Translational Selection

Synonymous Codon Usage in Lactococcus lactis: Mutational Bias Versus Translational Selection Journal of Biomolecular Structure & Dynamics, ISSN 0739-1102 Volume 21, Issue Number 4, (2004) Adenine Press (2004) Abstract Synonymous Codon Usage in Lactococcus lactis: Mutational Bias Versus Translational

More information

Mutations and Genetic Variability. 1. What is occurring in the diagram below?

Mutations and Genetic Variability. 1. What is occurring in the diagram below? Mutations and Genetic Variability 1. What is occurring in the diagram below? A. Sister chromatids are separating. B. Alleles are independently assorting. C. Genes are replicating. D. Segments of DNA are

More information

Diseases and Health Conditions that can Lead to Daytime Sleepiness

Diseases and Health Conditions that can Lead to Daytime Sleepiness October 21, 2014 Diseases and Health Conditions that can Lead to Daytime Sleepiness Indira Gurubhagavatula, MD, MPH Associate Professor Director, Occupational Sleep Medicine University of Pennsylvania,

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:.

More information

Students complete all index cards. 10 min. Completion of the anticipation guide.

Students complete all index cards. 10 min. Completion of the anticipation guide. 1 Tuesday, June 9 Objective Domain: Cells and Heredity Students explain the process of inheritance of genetic traits. Students differentiate between DNA and RNA, recognizing the role of each in heredity.

More information

REVISING DNA AND PROTEIN SYNTHESIS (LIVE) 01 JULY 2015 Exam Questions

REVISING DNA AND PROTEIN SYNTHESIS (LIVE) 01 JULY 2015 Exam Questions REVISING DNA AND PROTEIN SYNTHESIS (LIVE) 01 JULY 2015 Exam Questions Question 1 (Adapted from Feb/March 2015 Paper 2 DBE, Question 1.4) The diagram below represents DNA replication. 1.1 Identify the following:

More information

Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook)

Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook) Name Date Per Look at the diagrams, then answer the questions. Gene Mutations affect a single gene by changing its base sequence, resulting in an incorrect, or nonfunctional, protein being made. (a) A

More information

UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS

UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS UIT (12) MLECULE F LIFE: UCLEIC ACID ucleic acids are extremely large molecules that were first isolated from the nuclei of cells. Two kinds of nucleic acids are found in cells: RA (ribonucleic acid) is

More information

Molecular Biology Basic Concepts

Molecular Biology Basic Concepts Molecular Biology Basic Concepts Prof. Dr. Antônio Augusto Fröhlich Charles Ivan Wust LISHA - UFSC {guto charles}@lisha.ufsc.br http://www.lisha.ufsc.br/~{guto charles} September 2003 September 2003 http://www.lisha.ufsc.br/~guto

More information

Diagnosis and Treatment

Diagnosis and Treatment Sleep Apnea: Diagnosis and Treatment Sleep Apnea Sleep Apnea is Common Dangerous Easily recognized Treatable Types of Sleep Disordered Breathing Apnea Cessation of airflow > 10 seconds Hypopnea Decreased

More information

BOC334 (Proteomics) Practical 1. Calculating the charge of proteins

BOC334 (Proteomics) Practical 1. Calculating the charge of proteins BC334 (Proteomics) Practical 1 Calculating the charge of proteins Aliphatic amino acids (VAGLIP) N H 2 H Glycine, Gly, G no charge Hydrophobicity = 0.67 MW 57Da pk a CH = 2.35 pk a NH 2 = 9.6 pi=5.97 CH

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

Introduction to Molecular Genetics

Introduction to Molecular Genetics Introduction to Molecular Genetics I. Introduction: A. ave you thought much about why you are like your parents, and your kids are (will be) like you? 1. Inherited traits result from the transfer of specific

More information

Snoring and Obstructive Sleep Apnea (updated 09/06)

Snoring and Obstructive Sleep Apnea (updated 09/06) Snoring and Obstructive Sleep Apnea (updated 09/06) 1. Define: apnea, hypopnea, RDI, obstructive sleep apnea, central sleep apnea and upper airway resistance syndrome. BG 2. What are the criteria for mild,

More information

Obstructive Sleep Apnea (Not so) Sweet Dreams

Obstructive Sleep Apnea (Not so) Sweet Dreams Obstructive Sleep Apnea (Not so) Sweet Dreams Sleep, riches, and health, to be truly enjoyed, must be interrupted. -- Jean-Paul Richter Presented by: Brad Heltemes, M.D. VP & Chief Medical Director ING

More information

DELIVERY GUIDE Topic: You and your genes

DELIVERY GUIDE Topic: You and your genes DELIVERY GUIDE Topic: You and your genes June 2015 GCSE (9 1) Twenty First Century Biology B GCSE REFORM Oxford Cambridge and RSA We will inform centres about any changes to the specification. We will

More information

Shu-Ping Lin, Ph.D. E-mail: splin@dragon.nchu.edu.tw

Shu-Ping Lin, Ph.D. E-mail: splin@dragon.nchu.edu.tw Amino Acids & Proteins Shu-Ping Lin, Ph.D. Institute te of Biomedical Engineering ing E-mail: splin@dragon.nchu.edu.tw Website: http://web.nchu.edu.tw/pweb/users/splin/ edu tw/pweb/users/splin/ Date: 10.13.2010

More information

The amino acids differ in the properties of their side chains. Hydrophobic, non acidic (the H+ ion won t associate with water)

The amino acids differ in the properties of their side chains. Hydrophobic, non acidic (the H+ ion won t associate with water) Amino Acids 101 What is an amino acid? Amino acids, or alpha- amino acids, are the building blocks of peptides and proteins They are composed of amine and carboxylic acid groups, separated by the alpha-carbon

More information

Amino Acids, Peptides, Proteins

Amino Acids, Peptides, Proteins Amino Acids, Peptides, Proteins Functions of proteins: Enzymes Transport and Storage Motion, muscle contraction Hormones Mechanical support Immune protection (Antibodies) Generate and transmit nerve impulses

More information

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme. Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.

More information

Mutation, Repair, and Recombination

Mutation, Repair, and Recombination 16 Mutation, Repair, and Recombination WORKING WITH THE FIGURES 1. In Figure 16-3a, what is the consequence of the new 5 splice site on the open reading frame? In 16-3b, how big could the intron be to

More information

Concluding lesson. Student manual. What kind of protein are you? (Basic)

Concluding lesson. Student manual. What kind of protein are you? (Basic) Concluding lesson Student manual What kind of protein are you? (Basic) Part 1 The hereditary material of an organism is stored in a coded way on the DNA. This code consists of four different nucleotides:

More information

The p53 MUTATION HANDBOOK

The p53 MUTATION HANDBOOK The p MUTATION HANDBOOK Version 1. /7 Thierry Soussi Christophe Béroud, Dalil Hamroun Jean Michel Rubio Nevado http://p/free.fr The p Mutation HandBook By T Soussi, J.M. Rubio-Nevado, D. Hamroun and C.

More information

The Interface Between Sleep Apnea and Seizures. Hrayr Attarian M.D. Northwestern University Feinberg School of Medicine.

The Interface Between Sleep Apnea and Seizures. Hrayr Attarian M.D. Northwestern University Feinberg School of Medicine. The Interface Between Sleep Apnea and Seizures Hrayr Attarian M.D. Northwestern University Feinberg School of Medicine. What is Sleep Apnea? Obstructive sleep apnea syndrome (OSA) is characterized by repeated

More information

Grundlagen der Bioinformatik, SS 08, D. Huson, April 21,

Grundlagen der Bioinformatik, SS 08, D. Huson, April 21, Grundlagen der Bioinformatik, SS 08, D. Huson, April 21, 2008 7 2 Introduction to Molecular Biology We will start with a very short repetition of the basics of molecular biology, including a summary of

More information

HEALTH EVIDENCE REVIEW COMMISSION (HERC) COVERAGE GUIDANCE: DIAGNOSIS OF SLEEP APNEA IN ADULTS DATE: 5/9/2013 HERC COVERAGE GUIDANCE

HEALTH EVIDENCE REVIEW COMMISSION (HERC) COVERAGE GUIDANCE: DIAGNOSIS OF SLEEP APNEA IN ADULTS DATE: 5/9/2013 HERC COVERAGE GUIDANCE HEALTH EVIDENCE REVIEW COMMISSION (HERC) COVERAGE GUIDANCE: DIAGNOSIS OF SLEEP APNEA IN ADULTS DATE: 5/9/2013 HERC COVERAGE GUIDANCE The following diagnostic tests for Obstructive Sleep Apnea (OSA) should

More information

PRACTICE TEST QUESTIONS

PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon. V. Polypeptides and Proteins

IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon. V. Polypeptides and Proteins IV. -Amino Acids: carboxyl and amino groups bonded to -Carbon A. Acid/Base properties 1. carboxyl group is proton donor! weak acid 2. amino group is proton acceptor! weak base 3. At physiological ph: H

More information

MODULE. POSITIVE AIRWAY PRESSURE (PAP) Titrations

MODULE. POSITIVE AIRWAY PRESSURE (PAP) Titrations MODULE POSITIVE AIRWAY PRESSURE (PAP) Titrations POSITIVE AIRWAY PRESSURE (PAP) TITRATIONS OBJECTIVES At the end of this module the student must be able to: Identify the standards of practice for administering

More information

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations http://members.cox.net/amgough/mutation_chromosome_translocation.gif Introduction: In biology, mutations are changes to the base

More information

Changes in the Evaluation and Treatment of Sleep Apnea

Changes in the Evaluation and Treatment of Sleep Apnea Changes in the Evaluation and Treatment of Sleep Apnea Joseph DellaValla, MD FACP Medical Director Center for Sleep Medicine At Androscoggin Valley Hospital Sleep Related Breathing Problems Obstructive

More information

Guidelines for Writing a Scientific Paper

Guidelines for Writing a Scientific Paper Guidelines for Writing a Scientific Paper Writing an effective scientific paper is not easy. A good rule of thumb is to write as if your paper will be read by a person who knows about the field in general

More information

Oncology Update. Franklin Chen, MD. Novant Health Oncology Specialists. Making healthcare remarkable

Oncology Update. Franklin Chen, MD. Novant Health Oncology Specialists. Making healthcare remarkable Oncology Update Franklin Chen, MD Novant Health Oncology Specialists Making healthcare remarkable Disclosures Speakers Bureau Onyx Principal Investigator BMS, Genetech, EMD Serono, Incyte Objectives Lung

More information

Raising Sleep Apnea Awareness:

Raising Sleep Apnea Awareness: Raising Sleep Apnea Awareness: Among People with Diabetes in North Carolina, 2012 People with diabetes have more sleep problems than people without diabetes in the same age, sex, and race/ethnicity group.

More information

Treatment for Snoring and Obstructive Sleep Apnea. Ri 林 鴻 錡 /AsP 譚 慶 鼎

Treatment for Snoring and Obstructive Sleep Apnea. Ri 林 鴻 錡 /AsP 譚 慶 鼎 Treatment for Snoring and Obstructive Sleep Apnea Ri 林 鴻 錡 /AsP 譚 慶 鼎 Nonsurgical treatment Weight loss Avoidance of alcohol,sedatives,tobacco Positional devices Oral or nasal appliances Nasal continuous

More information

Jennifer Wink, MD February 6, 2016 SLEEP APNEA: DEVICE AND DIAGNOSTIC UPDATE

Jennifer Wink, MD February 6, 2016 SLEEP APNEA: DEVICE AND DIAGNOSTIC UPDATE Jennifer Wink, MD February 6, 2016 SLEEP APNEA: DEVICE AND DIAGNOSTIC UPDATE I have no Conflict of Interest Objectives Participants will gain an understanding of the different types of diagnostic sleep

More information

Advanced Medicinal & Pharmaceutical Chemistry CHEM 5412 Dept. of Chemistry, TAMUK

Advanced Medicinal & Pharmaceutical Chemistry CHEM 5412 Dept. of Chemistry, TAMUK Advanced Medicinal & Pharmaceutical Chemistry CHEM 5412 Dept. of Chemistry, TAMUK Dai Lu, Ph.D. dlu@tamhsc.edu Tel: 361-221-0745 Office: RCOP, Room 307 Drug Discovery and Development Drug Molecules Medicinal

More information

Part A: Amino Acids and Peptides (Is the peptide IAG the same as the peptide GAI?)

Part A: Amino Acids and Peptides (Is the peptide IAG the same as the peptide GAI?) ChemActivity 46 Amino Acids, Polypeptides and Proteins 1 ChemActivity 46 Part A: Amino Acids and Peptides (Is the peptide IAG the same as the peptide GAI?) Model 1: The 20 Amino Acids at Biological p See

More information

Obstructive Sleep Apnea: Test and you will diagnose But what does that mean? A PCP s attempt to understand

Obstructive Sleep Apnea: Test and you will diagnose But what does that mean? A PCP s attempt to understand Obstructive Sleep Apnea: Test and you will diagnose But what does that mean? A PCP s attempt to understand John Koeppe, MD General Internal Medicine Grand Rounds March 18 th, 2014 Disclosures No financial

More information

CHALLENGES IN THE HUMAN GENOME PROJECT

CHALLENGES IN THE HUMAN GENOME PROJECT REPRINT: originally published as: Robbins, R. J., 1992. Challenges in the human genome project. IEEE Engineering in Biology and Medicine, (March 1992):25 34. CHALLENGES IN THE HUMAN GENOME PROJECT PROGRESS

More information

Treatment of Obstructive Sleep Apnea (OSA)

Treatment of Obstructive Sleep Apnea (OSA) MP9239 Covered Service: Prior Authorization Required: Additional Information: Yes when meets criteria below Yes as shown below None Prevea360 Health Plan Medical Policy: 1.0 A continuous positive airway

More information

Summary and Conclusions

Summary and Conclusions Summary and Conclusions Summary and Conclusions Conclusions Cardiovascular complications, diabetes mellitus and death q Obstructive sleep apnoea syndrome covaries with cardiovascular disease, including

More information

4 Titration Curve of an Amino Acid

4 Titration Curve of an Amino Acid p H 4 Titration Curve of an Amino Acid Simple amino acid Acidic amino acid Basic amino acid 7 OH - equivalents Objectives: A) To determine the titration curve for an amino acid and B) to use this curve

More information

From DNA to Protein. Chapter 14

From DNA to Protein. Chapter 14 From DNA to Protein Chapter 14 Impacts, Issues: Ricin and your Ribosomes Ricin is toxic because it inactivates ribosomes, the organelles which assemble amino acids into proteins, critical to life processes

More information

Chapter 9. Applications of probability. 9.1 The genetic code

Chapter 9. Applications of probability. 9.1 The genetic code Chapter 9 Applications of probability In this chapter we use the tools of elementary probability to investigate problems of several kinds. First, we study the language of life by focusing on the universal

More information

Mutations. Section 6.3

Mutations. Section 6.3 Section 6.3 Mutations Objectives Identify different changes to DNA within both genes and chromosomes Evaluate effects of changes to DNA on proteins produced and organisms overall survival New Vocabulary

More information

The heart of the matter. Sleep apnea and cardiovascular disease

The heart of the matter. Sleep apnea and cardiovascular disease The heart of the matter Sleep apnea and cardiovascular disease The cardiologist s role Obstructive Sleep Apnea (OSA) is a common breathing disorder that has been associated with an increased risk of hypertension,

More information

Obstructive Sleep Apnea Syndrome

Obstructive Sleep Apnea Syndrome Obstructive Sleep Apnea Syndrome Prof. A K Janmeja Head, department of Pulmonary Medicine & Medical Superintendent, Govt. Medical College & Hospital, Chandigarh Objectives What is sleep? Common sleep disorders

More information

Department of Pulmonology, Critical Care and Sleep Medicine, Bolan Medical College, Pakistan

Department of Pulmonology, Critical Care and Sleep Medicine, Bolan Medical College, Pakistan Cronicon OPEN ACCESS PULMONOLOGY AND RESPIRATORY MEDICINE Review Article Sleep Apnea Sanaullah Tareen Department of Pulmonology, Critical Care and Sleep Medicine, Bolan Medical College, Pakistan *Corresponding

More information

ROLE OF ORAL APPLIANCES TO TREAT OBSTRUCTIVE SLEEP APNEA

ROLE OF ORAL APPLIANCES TO TREAT OBSTRUCTIVE SLEEP APNEA 1 ROLE OF ORAL APPLIANCES TO TREAT OBSTRUCTIVE SLEEP APNEA There are three documented ways to treat obstructive sleep apnea: 1. CPAP device 2. Oral Appliances 3. Surgical correction of nasal and oral obstructions

More information

Obstructive Sleep Apnea:

Obstructive Sleep Apnea: Obstructive Sleep Apnea: Review of Screening and Management JOHN REID MD, FRCP(C), D.ABSM CSIM CONFERENCE CALGARY OCTOBER 2014 Disclosure Slide No financial or intellectual conflicts of interest to declare

More information

Obstructive Sleep Apnea Case Study

Obstructive Sleep Apnea Case Study Obstructive Sleep Apnea Case Study Shirin Shafazand, MD, MS Neomi Shah, MD for the Sleep Education for Pulmonary Fellows and Practitioners, SRN ATS Committee August 2014 Part 1: Case Presentation Mr. Simon

More information

Proteins. Amino Acids. Chapter 3. Molecular Diagnostics Fundamentals, Methods and Clinical Applications Second Edition 2/5/2013

Proteins. Amino Acids. Chapter 3. Molecular Diagnostics Fundamentals, Methods and Clinical Applications Second Edition 2/5/2013 Proteins Chapter 3 Amino Acids Nonpolar Alanine, Ala, A Isoleucine, Ile, I Leucine, Leu, L Methionine, Met, M Phenylalanine, Phe, F Tryptophan,Trp, W Valine, Val, V Negatively Charged (Acidic) Aspartic

More information

Unit 6 ~ Learning Guide

Unit 6 ~ Learning Guide Unit 6 ~ Learning Guide Name: INSTRUCTIONS Complete the following notes and questions as you work through the related lessons. You are required to have this package completed BEFORE you write your unit

More information

Math 30-1: Permutations and Combinations PRACTICE EXAM

Math 30-1: Permutations and Combinations PRACTICE EXAM A. B. C. D. Math 30-1: Permutations and Combinations PRACTICE EXAM n! 1. The expression is equivalent to: (n - 2)! 2. A Grade 12 student is taking Biology, English, Math, and Physics in her first term.

More information

CHILDHOOD OBSTRUCTIVE SLEEP APNEA SYNDROME

CHILDHOOD OBSTRUCTIVE SLEEP APNEA SYNDROME CHILDHOOD OBSTRUCTIVE SLEEP APNEA SYNDROME Chng Seo Yi Obstructive Sleep Apnea Syndrome (OSAS) in children is a disorder of breathing during sleep characterized by upper airway obstruction that disrupts

More information

CPAP Treats Muscle Cramps in Patients with Obstructive Sleep Apnea

CPAP Treats Muscle Cramps in Patients with Obstructive Sleep Apnea CPAP Treats Muscle Cramps in Patients with Obstructive Sleep Apnea Andrew J Westwood, M.D., MRCP(UK) 1, Andrew R Spector, M.D., 2 Sanford H Auerbach, M.D. 3 1 Columbia University College of Physicians

More information

Obstructive Sleep Apnoea

Obstructive Sleep Apnoea for health professionals Obstructive Sleep Apnoea Obstructive Sleep Apnoea Definition Sleep apnoea is a disorder in which breathing is repeatedly interrupted during sleep. The word apnoea literally means

More information

B5 B8 ANWERS DNA & ) DNA

B5 B8 ANWERS DNA & ) DNA Review sheet for test B5 B8 ANWERS DNA review 1. What bonds hold complementary bases between 2 strands of DNA together? Hydrogen bonds 2. What bonds exist between sugars and phosphates? Covalent bonds

More information

Keywords: synonymous codon usage, mutational bias, multivariate statistical analysis, optimal codons. ABSTRACT

Keywords: synonymous codon usage, mutational bias, multivariate statistical analysis, optimal codons. ABSTRACT Statistical Analysis of codon usage in extremely halophilic bacterium, Salinibacter ruber DSM 13855 Sanjukta RK 1, Farooqi MS 1*, Sharma N 1, Rai N 2, Mishra DC 1, Rai A 1, Singh DP 3 and Chaturvedi KK

More information

DNA: Molecule of Life

DNA: Molecule of Life DNA: Molecule of Life History DNA Structure Protein Synthesis Gene Regulation History of DNA H I S T O By the 1940 s, scientists knew that chromosomes consisted of both DNA and protein but did not know

More information

Lesson Overview. Fermentation. Lesson Overview 13.1 RNA

Lesson Overview. Fermentation. Lesson Overview 13.1 RNA Lesson Overview 13.1 RNA Similarities between DNA & RNA They are both nucleic acids They both have: a 5-carbon sugar, a phosphate group, a nitrogenous base. Comparing RNA and DNA There are three important

More information

BIOLÓGIA ANGOL NYELVEN

BIOLÓGIA ANGOL NYELVEN ÉRETTSÉGI VIZSGA 2012. május 15. BIOLÓGIA ANGOL NYELVEN EMELT SZINTŰ ÍRÁSBELI VIZSGA 2012. május 15. 8:00 Az írásbeli vizsga időtartama: 240 perc Pótlapok száma Tisztázati Piszkozati NEMZETI ERŐFORRÁS

More information

Obstructive sleep apnea and type 2 diabetes Obstructive Sleep Apnea (OSA) may contribute to or exacerbate type 2 diabetes for some of your patients.

Obstructive sleep apnea and type 2 diabetes Obstructive Sleep Apnea (OSA) may contribute to or exacerbate type 2 diabetes for some of your patients. Obstructive sleep apnea and type 2 diabetes Obstructive Sleep Apnea (OSA) may contribute to or exacerbate type 2 diabetes for some of your patients. Prevalence of OSA and diabetes Prevalence of OSA Five

More information

BRCA in Men. Mary B. Daly,M.D.,Ph.D. June 25, 2010

BRCA in Men. Mary B. Daly,M.D.,Ph.D. June 25, 2010 BRCA in Men Mary B. Daly,M.D.,Ph.D. June 25, 2010 BRCA in Men Inheritance patterns of BRCA1/2 Cancer Risks for men with BRCA1/2 mutations Risk management recommendations for men with BRCA1/2 mutations

More information

Ovarian Cancer Genetic Testing: Why, When, How?

Ovarian Cancer Genetic Testing: Why, When, How? Ovarian Cancer Genetic Testing: Why, When, How? Jeffrey Dungan, MD Associate Professor Division of Clinical Genetics Department of Obstetrics & Gynecology Northwestern University Feinberg School of Medicine

More information

Gene mutation and molecular medicine Chapter 15

Gene mutation and molecular medicine Chapter 15 Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to

More information

About Sleep Apnea ABOUT SLEEP APNEA

About Sleep Apnea ABOUT SLEEP APNEA ABOUT SLEEP APNEA About Sleep Apnea What is Sleep Apnea? Sleep Apnea (from Greek, meaning "without breath") is one of the most common sleep disorders in which breathing stops and then restarts again recurrently

More information