05_02_DNA.jpg. covalent bonds H bonds. polarity; antiparallel

Size: px
Start display at page:

Download "05_02_DNA.jpg. covalent bonds H bonds. polarity; antiparallel"

Transcription

1 Animal Cell

2 05_02_DNA.jpg covalent bonds H bonds polarity; antiparallel

3 05_06_compl_pairs.jpg H bonds between a purine and a pyrimidine fits the space; complementary bases; which more stable?

4 05_07_base pairing.jpg Same distance across molecule at each base pair (20Å)

5 05_08_major_minor_gr.jpg = is wider 10 nucleotides per helical turn = 34Å

6 05_24_Chromatin pack.jpg

7 05_21_Nucleosomes.jpg 30 nm fibers individual nucleosomes = beads on a string

8 05_22_8_histone.jpg

9 05_23_histone core.jpg

10 05_25_zigzag model.jpg

11 05_26_tightly packed.jpg

12 Gene-protein relations How do genes control enzyme (protein) activity? A protein is a polymer: A chain of amino acids. Connected through a peptide bond : a covalent bond between the C-N

13 General formula of an amino acid H 2 N-CHR 1 -COOH 20 common amino acids They differ only in R (side group), R can be hydrogen (glycine), ring (aromatic amino acids like tyrosine), etc. Most proteins in living organisms are large polypeptides mostly consisting of a.a The chemical properties of the amino acids are responsible for the structure and function of a protein (hydrophobic tend to be buried, hydrophilic tend to be outside, etc.)

14 Determinants of protein structure (and as a consequence,function) 1. Primary structure 2. Secondary structure 3. Tertiary structure 4. Quaternary structure

15 1. Primary structure: Linear sequence The order of amino acids determined (encoded) by the linear sequence of nucleotides (DNA) in a gene. Sequence of tryptophan synthase A

16 2. Secondary structure The interrelations of amino acids that are close together in the linear structure created by hydrogen bonds between CO and NH groups of different residues. Two basic periodic structures are α helix and β sheet β sheet α helix

17 3. Tertiary structure: Three dimentional architecture created by electrostatic, hydrogen and van der waals bonds between various R groups causing the protein chain to fold back. Sometimes amino acids that are very far in the primary structure become close in the 3rd structure. myoglobin

18 4. Quaternary structure - multimeric Two or more separate folded structures bind together to form a structure hemoglobin

19 RNA (Ribonucleic acid) Bases: Adenine (A) Guanine (G) Cytosine (C) Uracil (U); replaces T Oriented from 5 (phosphate) to 3 (sugar). Single-stranded => flexible backbone => secondary structure => catalytic role.

20 Overview of DNA to RNA to Protein A gene is expressed in two steps 1) Transcription: RNA synthesis 2) Translation: Protein synthesis

21 The Central Dogma

22 The birth of molecular Biology (early 70 s) Scientists find that some bacterial strains are immune to certain viruses (bacteriophages) Apparently, they have a system that RESTRICTS attacks: nucleases that chew up the viral DNA- RESTRICTION ENZYMES

23 Enzyme Site Recognition Each enzyme digests (cuts) DNA at a specific sequence = restriction site Enzymes recognize 4- or 6- base pair, palindromic sequences (eg GAATTC) Restriction site Palindrone Fragment 1 Fragment 2

24 5 vs 3 Enzyme cuts Prime Overhang Generates 5 prime overhang

25 Common Restriction Enzymes EcoRI Eschericha coli 5 prime overhang Pstl Providencia stuartii 3 prime overhang

26 R. E.s and DNA Ligase can be used to make recombinant DNA EcoRI GAATTC CTTAAG G CTTAA 1 Digestion EcoRI GAATTC CTTAAG AATTC 2 Annealing of sticky ends G G Ligase AATTC CTTAA G 3 Ligation 4 Recombinant DNA G AATTC CTTAA G

27 Gel Electrophoresis

28 Size of DNA fragments Restriction digestion & agarose gel electrophoresis using molecular weight marker 3.5 kb 0.8 kb 4.0 kb 3.0 kb 2.0 kb 1.6 kb 1.0 kb 0.5 kb

29 Hybridization The bases in DNA will only pair in very specific ways: G with C and A with T In short DNA sequences, imprecise base pairing will not be tolerated The source of any single strand of DNA is irrelevant, merely the sequence is important, thus complementary DNA from different sources can form a double helix This phenomenon of base pairing of single stranded DNA strands to form a double helix is called hybridization as it may be used to make hybrid DNA composed of strands from different sources 2000 Timothy G. Standish

30 Hybridization DNA from source X CTGATGGTCATGAGCTGTCCGATCGATCAT TACTCGACAGGCTAG Hybridization TACTCGACAGGCTAG DNA from source Y 2000 Timothy G. Standish

31 Hybridization Because DNA sequences will seek out and hybridize with other sequences with which they base pair in a specific way much information can be gained about unknown DNA using single stranded DNA of known sequence Short sequences of single stranded DNA can be used as probes to detect the presence of their complementary sequence in any number of applications including: Southern blots Northern blots (in which RNA is probed) In situ hybridization Dot blots... In addition, the renaturation, or hybridization, of DNA in solution can tell much about the nature of organism s genomes 2000 Timothy G. Standish

32 Southern Blots Called Southern blots after their inventor (Edwin Southern, 1975) Involves five steps: 1 Digestion of DNA using restriction enzymes 2 Separation of the DNA fragments by size using gel electrophoresis 3 Transfer of fragments to a nitrocellulose or nylon membrane 4 Hybridization of a probe to the fragment or fragments of interest 5 Probe detection (autoradiography) 2000 Timothy G. Standish

33 Making A Southern Blot Digestion and Electrophoresis Marker Control Experimental Timothy G. Standish

34 Making A Southern Blot 3 DNA Transfer To Membrane DNA Paper Towels Gel Gel Membrane Membrane Buffer 2000 Timothy G. Standish

35 Making A Southern Blot 4 Probe Hybridization Addition of blocking reagent Probe addition After washing Membrane with bound DNA Parts of the membrane not already covered with DNA now bind blocking reagent Probe covers the membrane, but only binds to complementary DNA Probe only remains annealed to complementary DNA 2000 Timothy G. Standish

36 Making A Southern Blot 5 Autoradiograph Development Membrane with probe bound to complementary DNA X-ray film is placed over the membrane and left until radiation from the probe has exposed the film Fragments complementary to the probe appear as bands on the autorad 2000 Timothy G. Standish

37 Gel vs. Blot

38 So What is the Big Deal? Southern blots tell both the size and something about the sequence of a fragment mixed in with many other fragments, thus they can be used for many purposes Southern blots represent a technological change that led to a strategic change. A NEW approach to biology: Molecular Biology. Most techniques currently used were later developments of this basic idea 2000 Timothy G. Standish

39 Hybridization Screening Take the genome of an organism, cut it to pieces and CLONE it in plasmids : each plasmid has a random piece, each bacterium has only one type of plasmid. This collection is a genomic LIBRARY. Stick the DNA from many colonies of the library to a membrane Then hybridize a probe to the DNA on the membrane: Only those colonies that are complementary to the probe will give a positive result Timothy G. Standish

40 Membrane Hybridization Screening Transfer cells to membrane Lyse cells - DNA and protein stick to membrane Locate colony with target clone Develop X-ray film Block membrane - Prevents probe from sticking to membrane Add probe Cover with X-ray film Wash off excess probe 2000 Timothy G. Standish

41 Northern blots The most straight forward method for the measurement of a specific mrna species is called Northern blot hybridization analysis. Northern blots are similar to the Southern blots except that RNA, rather than DNA, is blotted onto the membrane.

42 Poly A+ RNA Once pure RNA is obtained, it is possible to further purify the mrna by oligo dt cellulose chromatography. Only about 1% of the total RNA from a tissue sample consists of mrna (poly A+ RNA). This step increases the sensitivity of any detection method. AAAAAAAAAAAA

43 Total or poly A+ RNA is resolved by agarose gel electrophoresis. This separates the various RNA molecules according to their size. The RNA in the gel is transferred to a nitrocellulose or nylon membrane. Radioactive DNA probes that are derived from the target gene are denatured and hybridized with the RNA blot.

44 These probes can anneal with complementary sequences in the RNA samples on the gel. The amount of probe bound to the RNA on the filter, as measured by radioactivity, is proportional to the amount of target RNA present on the filter.

45 Northern blot hybridization analysis of p53 and GAPDH mrna in total RNA samples from mouse tissues.

46 Measurement of proteins The amount of protein that is produced from a certain gene can be determined. Assays typically involve antibodies that specifically bind to the target protein. To produce such antibodies, the target protein is usually injected into an animal such as a rabbit or mouse.

47 The animal s immune system recognizes the injected protein as a foreign substance (antigen). Antibodies are made that bind to the protein and allow for its removal from the blood. Isolation of these antibodies from the animal s blood provides reagents that can be used to specifically recognize and bind to particular proteins.

48 Western blots Western blot analysis is the most common method for identifying and quantifying proteins. Protein samples from a tissue are resolved by electrophoresis and blotted from the gel onto a nitrocellulose or nylon membrane.

49 The membrane is then incubated first with the specific antibody, which binds to the target protein. Then a second antibody that recognizes and binds to the first antibody is added. The second antibody is labeled with a radioactive tag or with an enzyme that can easily be assayed. Peroxidase or acid phosphatase are commonly used.

50

51 RIA and ELISA Radio-immuno-assays (RIA) or enzyme linked immunosorbent assays (ELISA). Protein samples are applied to wells in plastic plates and the specific antibody and second antibody are applied. After washing, the radioactivity (in the case of RIA) or enzyme activity (in the case of ELISA) associated to the second antibody can be measured. ELISA assays have been adapted for use diagnostic tests.

52

53 In situ expression assays It is possible to detect gene expression directly in tissues or whole organisms. RNA in situ hybridization Labeled probes are applied to tissue sections to detect mrna. Protein Labeled antibodies are used to detect protein in tissue sections or whole organisms.

54 In situ detection of myogenin mrna in a mouse embryo

55 Reporter gene assays An interesting way to assay transcription in transgenic organisms is with reporter genes. The promoter and regulatory sequences of a gene of interest are attached to coding sequences of a gene that encodes a product that is easily detected. Transfer of this synthetic gene into a host organism allows for the expression of the reporter gene Reporter gene expression represents the pattern of expression of the native gene.

56 Reporter genes Commonly used reporter genes include: LacZ, encodes ß-galactosidase. Produces a blue stain when it reacts with X-gal. GUS, encodes ß-glucuronidase. Produces a blue stain when it reacts with X-gluc. LUC, Luciferase, fire-fly enzyme that produces light when it reacts with luciferin substrate. GFP, Green fluorescent proteins, fluoresce green when excited by blue light.

57 Staining of mouse embryo expressing PITX2-LacZ Tobacco plant expressing CaMV35S-Luciferase

58 In vivo expression analysis Expression of luciferase and GFP can be assayed in living organisms. No chemical fixation of the tissue or toxic stains are required. Therefore, it is possible to detect the expression of these reporter genes directly in living organisms and to follow changes in their expression over time.

59 Mouse pups expressing GFP Arabidopsis plant expressing GFP

Genetics Faculty of Agriculture and Veterinary Medicine

Genetics Faculty of Agriculture and Veterinary Medicine Genetics 10201232 Faculty of Agriculture and Veterinary Medicine Instructor: Dr. Jihad Abdallah Topic 15:Recombinant DNA Technology 1 Recombinant DNA Technology Recombinant DNA Technology is the use of

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Biotechnology and reporter genes Here, a lentivirus is used to carry foreign DNA into chickens. A reporter gene (GFP)indicates that foreign DNA has been successfully transferred. Recombinant DNA continued

More information

Recombinant DNA Technology

Recombinant DNA Technology PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology

More information

A disaccharide is formed when a dehydration reaction joins two monosaccharides. This covalent bond is called a glycosidic linkage.

A disaccharide is formed when a dehydration reaction joins two monosaccharides. This covalent bond is called a glycosidic linkage. CH 5 Structure & Function of Large Molecules: Macromolecules Molecules of Life All living things are made up of four classes of large biological molecules: carbohydrates, lipids, proteins, and nucleic

More information

Chapter 20: Biotechnology: DNA Technology & Genomics

Chapter 20: Biotechnology: DNA Technology & Genomics Biotechnology Chapter 20: Biotechnology: DNA Technology & Genomics The BIG Questions How can we use our knowledge of DNA to: o Diagnose disease or defect? o Cure disease or defect? o Change/improve organisms?

More information

MBLG1001 Lecture 8 page 1. University of Sydney Library Electronic Item COURSE: MBLG1001. Lecturer: Dale Hancock Lecture 8

MBLG1001 Lecture 8 page 1. University of Sydney Library Electronic Item COURSE: MBLG1001. Lecturer: Dale Hancock Lecture 8 MBLG1001 Lecture 8 page 1 University of Sydney Library Electronic Item CURSE: MBLG1001 Lecturer: Dale ancock Lecture 8 CMMNWEALT F AUSTRALIA Copyright Regulation WARNING This material has been reproduced

More information

Chapter 10 Manipulating Genes

Chapter 10 Manipulating Genes How DNA Molecules Are Analyzed Chapter 10 Manipulating Genes Until the development of recombinant DNA techniques, crucial clues for understanding how cell works remained lock in the genome. Important advances

More information

Proteins and Nucleic Acids

Proteins and Nucleic Acids Proteins and Nucleic Acids Chapter 5 Macromolecules: Proteins Proteins Most structurally & functionally diverse group of biomolecules. : o Involved in almost everything o Enzymes o Structure (keratin,

More information

BIOLOGICAL BACKGROUND THE CENTRAL DOGMA OF MOLECULAR BIOLOGY

BIOLOGICAL BACKGROUND THE CENTRAL DOGMA OF MOLECULAR BIOLOGY BIOLOGICAL BACKGROUND Central Dogma DNA and RNA Structure Replication, Transcription and Translation Techniques of Molecular Genetics Using restriction enzymes Using PCR THE CENTRAL DOGMA OF MOLECULAR

More information

Chapter 12 - DNA Technology

Chapter 12 - DNA Technology Bio 100 DNA Technology 1 Chapter 12 - DNA Technology Among bacteria, there are 3 mechanisms for transferring genes from one cell to another cell: transformation, transduction, and conjugation 1. Transformation

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

Tools and Techniques. Chapter 10. Genetic Engineering. Restriction endonuclease. 1. Enzymes

Tools and Techniques. Chapter 10. Genetic Engineering. Restriction endonuclease. 1. Enzymes Chapter 10. Genetic Engineering Tools and Techniques 1. Enzymes 2. 3. Nucleic acid hybridization 4. Synthesizing DNA 5. Polymerase Chain Reaction 1 2 1. Enzymes Restriction endonuclease Ligase Reverse

More information

BIOTECHNOLOGY. What can we do with DNA?

BIOTECHNOLOGY. What can we do with DNA? BIOTECHNOLOGY What can we do with DNA? Biotechnology Manipulation of biological organisms or their components for research and industrial purpose Usually manipulate DNA itself How to study individual gene?

More information

The Molecules of Cells

The Molecules of Cells The Molecules of Cells I. Introduction A. Most of the world s population cannot digest milk-based foods. 1. These people are lactose intolerant because they lack the enzyme lactase. 2. This illustrates

More information

CHAPTER 8 RECOMBINANT DNA and GENETIC ENGINEERING

CHAPTER 8 RECOMBINANT DNA and GENETIC ENGINEERING CHAPTER 8 RECOMBINANT DNA and GENETIC ENGINEERING Questions to be addressed: How are recombinant DNA molecules generated in vitro? How is recombinant DNA amplified? What analytical techniques are used

More information

Nucleic Acids: DNA and RNA

Nucleic Acids: DNA and RNA Nucleic Acids: DNA and RNA Nucleic Acids Responsible for the transfer of genetic information. Two forms of nucleic acids: Ribonucleic Acid (RNA) Mainly found in cytoplasm Deoxyribonucleic Acid (DNA) Found

More information

The Structure and Function of Large Biological Molecules by Dr. Ty C.M. Hoffman

The Structure and Function of Large Biological Molecules by Dr. Ty C.M. Hoffman The Structure and Function of Large Biological Molecules by Dr. Ty C.M. Hoffman Slide 1 All of the biological macromolecules are built from smaller subunits. Each subunit features - H and - OH substituents

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

CHAPTER 3 THE CHEMISTRY OF ORGANIC MOLECULES

CHAPTER 3 THE CHEMISTRY OF ORGANIC MOLECULES CHAPTER 3 THE CHEMISTRY OF ORGANIC MOLECULES 3.1 Organic Molecules The chemistry of carbon accounts for the diversity of organic molecules found in living things. Carbon has six electrons, four of which

More information

PRACTICE TEST QUESTIONS

PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

DNA Scissors: Introduction to Restriction Enzymes

DNA Scissors: Introduction to Restriction Enzymes DNA Scissors: Introduction to Restriction Enzymes Objectives At the end of this activity, students should be able to 1. Describe a typical restriction site as a 4- or 6-base- pair palindrome; 2. Describe

More information

Today-applications: Medicine-better health Pharmaceutical-production of antibiotics Foods-wine, cheese, beer Agriculture-selective breeding

Today-applications: Medicine-better health Pharmaceutical-production of antibiotics Foods-wine, cheese, beer Agriculture-selective breeding I. Genetic Engineering modification of DNA of organisms to produce new genes with new characteristics -genes are small compared to chromosomes -need methods to get gene-sized pieces of DNA -direct manipulation

More information

Web Quest: DNA & Protein Synthesis Biology 1

Web Quest: DNA & Protein Synthesis Biology 1 Web Quest: DNA & Protein Synthesis Biology 1 Name: TO ACCESS THE WEBSITES IN THIS WEB QUEST WITHOUT HAVING TO TYPE IN ALL OF THE URLs: 1. Go to alkire.weebly.com 2. Mouse over Biology 1 3. Click on Online

More information

the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids

the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids and their sub-units; the role of lipids in the plasma

More information

MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS

MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS Richard L. Hodinka, Ph.D. University of South Carolina School of Medicine Greenville Greenville Health System, Greenville, SC hodinka@greenvillemed.sc.edu

More information

Chapter 11: Molecular Structure of DNA and RNA

Chapter 11: Molecular Structure of DNA and RNA Chapter 11: Molecular Structure of DNA and RNA Student Learning Objectives Upon completion of this chapter you should be able to: 1. Understand the major experiments that led to the discovery of DNA as

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

3. comparison with proteins of known function

3. comparison with proteins of known function Lectures 26 and 27 recombinant DNA technology I. oal of genetics A. historically - easy to isolate total DNA - difficult to isolate individual gene B. recombinant DNA technology C. why get the gene? 1.

More information

Life. In nature, we find living things and non living things. Living things can move, reproduce, as opposed to non living things.

Life. In nature, we find living things and non living things. Living things can move, reproduce, as opposed to non living things. Computat onal Biology Lecture 1 Life In nature, we find living things and non living things. Living things can move, reproduce, as opposed to non living things. Both are composed of the same atoms and

More information

Lecture Overview. Hydrogen Bonds. Special Properties of Water Molecules. Universal Solvent. ph Scale Illustrated. special properties of water

Lecture Overview. Hydrogen Bonds. Special Properties of Water Molecules. Universal Solvent. ph Scale Illustrated. special properties of water Lecture Overview special properties of water > water as a solvent > ph molecules of the cell > properties of carbon > carbohydrates > lipids > proteins > nucleic acids Hydrogen Bonds polarity of water

More information

4. Which carbohydrate would you find as part of a molecule of RNA? a. Galactose b. Deoxyribose c. Ribose d. Glucose

4. Which carbohydrate would you find as part of a molecule of RNA? a. Galactose b. Deoxyribose c. Ribose d. Glucose 1. How is a polymer formed from multiple monomers? a. From the growth of the chain of carbon atoms b. By the removal of an OH group and a hydrogen atom c. By the addition of an OH group and a hydrogen

More information

Biotechnology and Recombinant DNA

Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Recombinant DNA procedures - an overview Biotechnology: The use of microorganisms, cells, or cell components to make a product. Foods, antibiotics, vitamins, enzymes Recombinant

More information

Genetics Notes C. Molecular Genetics

Genetics Notes C. Molecular Genetics Genetics Notes C Molecular Genetics Vocabulary central dogma of molecular biology Chargaff's rules messenger RNA (mrna) ribosomal RNA (rrna) transfer RNA (trna) Your DNA, or deoxyribonucleic acid, contains

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

Chapter 10: Protein Synthesis. Biology

Chapter 10: Protein Synthesis. Biology Chapter 10: Protein Synthesis Biology Let s Review What are proteins? Chains of amino acids Some are enzymes Some are structural components of cells and tissues More Review What are ribosomes? Cell structures

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

DNA AND IT S ROLE IN HEREDITY

DNA AND IT S ROLE IN HEREDITY DNA AND IT S ROLE IN HEREDITY Lesson overview and objectives - DNA/RNA structural properties What are DNA and RNA made of What are the structural differences between DNA and RNA What is the structure of

More information

Chapter 3 Molecules of Cells

Chapter 3 Molecules of Cells Bio 100 Molecules of cells 1 Chapter 3 Molecules of Cells Compounds containing carbon are called organic compounds Molecules such as methane that are only composed of carbon and hydrogen are called hydrocarbons

More information

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes.

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology has had-and will havemany important

More information

B5 B8 ANWERS DNA & ) DNA

B5 B8 ANWERS DNA & ) DNA Review sheet for test B5 B8 ANWERS DNA review 1. What bonds hold complementary bases between 2 strands of DNA together? Hydrogen bonds 2. What bonds exist between sugars and phosphates? Covalent bonds

More information

2. Why did biologists used to think that proteins are the genetic material?

2. Why did biologists used to think that proteins are the genetic material? Chapter 16: DNA: The Genetic Material 1. What must genetic material do? 2. Why did biologists used to think that proteins are the genetic material? 3. Describe Griffith s experiments with genetic transformation

More information

Molecules of Life. Chapter 3 Part 2

Molecules of Life. Chapter 3 Part 2 Molecules of Life Chapter 3 Part 2 3.5 Proteins Diversity in Structure and Function Proteins are the most diverse biological molecule (structural, nutritious, enzyme, transport, communication, and defense

More information

Concept 5.4: Proteins include a diversity of structures, resulting in a wide range of functions

Concept 5.4: Proteins include a diversity of structures, resulting in a wide range of functions Concept 5.4: Proteins include a diversity of structures, resulting in a wide range of functions Proteins account for more than 50% of the dry mass of most cells Some proteins speed up chemical reactions

More information

DNA TECHNOLOGY- methods for studying and manipulating genetic material.

DNA TECHNOLOGY- methods for studying and manipulating genetic material. 1 DNA TECHNOLOGY- methods for studying and manipulating genetic material. BIOTECHNOLOGY, the manipulation of organisms or their components to make useful products. Biotechnology today usually refers to

More information

Recipient Cell. DNA Foreign DNA. Recombinant DNA

Recipient Cell. DNA Foreign DNA. Recombinant DNA Module 4B Biotechnology In this module, we will examine some of the techniques scientists have developed to study and manipulate the DNA of living organisms. Objective # 7 Explain what genetic recombination

More information

Disaccharides consist of two monosaccharide monomers covalently linked by a glycosidic bond. They function in sugar transport.

Disaccharides consist of two monosaccharide monomers covalently linked by a glycosidic bond. They function in sugar transport. 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions that occur in specialized areas of the organism s cells. As a basis for understanding this concept: 1.

More information

Study Guide Chapter 12

Study Guide Chapter 12 Study Guide Chapter 12 1. Know ALL of your vocabulary words! 2. Name the following scientists with their contributions to Discovering DNA: a. Strains can be transformed (or changed) into other forms while

More information

RNA and Protein Synthesis Biology Mr. Hines

RNA and Protein Synthesis Biology Mr. Hines RNA and Protein Synthesis 12.3 Biology Mr. Hines Now we know how DNA (genes) are copied. But how is it used to make a living organism? Most of the structures inside of a cell are made of protein - so we

More information

OUTCOMES. PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation OVERVIEW ANIMATION CONTEXT RIBONUCLEIC ACID (RNA)

OUTCOMES. PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation OVERVIEW ANIMATION CONTEXT RIBONUCLEIC ACID (RNA) OUTCOMES PROTEIN SYNTHESIS IB Biology Core Topic 3.5 Transcription and Translation 3.5.1 Compare the structure of RNA and DNA. 3.5.2 Outline DNA transcription in terms of the formation of an RNA strand

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

BINF6201/8201. Basics of Molecular Biology

BINF6201/8201. Basics of Molecular Biology BINF6201/8201 Basics of Molecular Biology 08-26-2016 Linear structure of nucleic acids Ø Nucleic acids are polymers of nucleotides Ø Nucleic acids Deoxyribonucleic acids (DNA) Ribonucleic acids (RNA) Phosphate

More information

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise: HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone

More information

MOLECULAR GENETICS GENETIC ENGINEERING RECOMBINANT DNA. Molecular Genetics Activity #6 page 1

MOLECULAR GENETICS GENETIC ENGINEERING RECOMBINANT DNA. Molecular Genetics Activity #6 page 1 AP BIOLOGY MOLECULAR GENETICS ACTIVITY #6 NAME DATE HOUR RECOMBINANT DNA GENETIC ENGINEERING Molecular Genetics Activity #6 page 1 GENETIC ENGINEERING Molecular Genetics Activity #6 page 2 PART I: PRODUCING

More information

WEEK ONE VOCABULARY. Adhesion- the attraction between water molecules and other molecules

WEEK ONE VOCABULARY. Adhesion- the attraction between water molecules and other molecules WEEK ONE VOCABULARY Acid- hydrogen donors; acids increase the hydrogen ion concentration in solution Adhesion- the attraction between water molecules and other molecules Alpha (α) helix- secondary protein

More information

Lecture 36: Basics of DNA Cloning-II

Lecture 36: Basics of DNA Cloning-II Lecture 36: Basics of DNA Cloning-II Note: Before starting this lecture students should have completed Lecture 35 Sequential steps involved in DNA cloning using plasmid DNA as vector: Molecular cloning

More information

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites.

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites. 1. A recombinant DNA molecules is one that is a. produced through the process of crossing over that occurs in meiosis b. constructed from DNA from different sources c. constructed from novel combinations

More information

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication

Ch. 12: DNA and RNA 12.1 DNA Chromosomes and DNA Replication Ch. 12: DNA and RNA 12.1 DNA A. To understand genetics, biologists had to learn the chemical makeup of the gene Genes are made of DNA DNA stores and transmits the genetic information from one generation

More information

DNA, RNA AND PROTEIN SYNTHESIS

DNA, RNA AND PROTEIN SYNTHESIS DNA, RNA AND PROTEIN SYNTHESIS Evolution of Eukaryotic Cells Eukaryotes are larger, more complex cells that contain a nucleus and membrane bound organelles. Oldest eukarytotic fossil is 1800 million years

More information

Carbohydrates, proteins and lipids

Carbohydrates, proteins and lipids Carbohydrates, proteins and lipids Chapter 3 MACROMOLECULES Macromolecules: polymers with molecular weights >1,000 Functional groups THE FOUR MACROMOLECULES IN LIFE Molecules in living organisms: proteins,

More information

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot Recombinant technology Gene analysis Sequencing PCR RNA Northern-blot RT PCR Protein Western-blot Sequencing Southern-blot in situ hybridization in situ hybridization Function analysis Histochemical analysis

More information

Nucleotides and Nucleic Acids

Nucleotides and Nucleic Acids Nucleotides and Nucleic Acids Brief History 1 1869 - Miescher Isolated nuclein from soiled bandages 1902 - Garrod Studied rare genetic disorder: Alkaptonuria; concluded that specific gene is associated

More information

Lab #5: DNA, RNA & Protein Synthesis. Heredity & Human Affairs (Biology 1605) Spring 2012

Lab #5: DNA, RNA & Protein Synthesis. Heredity & Human Affairs (Biology 1605) Spring 2012 Lab #5: DNA, RNA & Protein Synthesis Heredity & Human Affairs (Biology 1605) Spring 2012 DNA Stands for : Deoxyribonucleic Acid Double-stranded helix Made up of nucleotides Each nucleotide= 1. 5-carbon

More information

Chapter 5. The Structure and Function of Macromolecule s

Chapter 5. The Structure and Function of Macromolecule s Chapter 5 The Structure and Function of Macromolecule s Most Macromolecules are polymers: Polymer: (poly: many; mer: part) Large molecules consisting of many identical or similar subunits connected together.

More information

Bioinformatics: Network Analysis

Bioinformatics: Network Analysis Bioinformatics: Network Analysis Molecular Cell Biology: A Brief Review COMP 572 (BIOS 572 / BIOE 564) - Fall 2013 Luay Nakhleh, Rice University 1 The Tree of Life 2 Prokaryotic vs. Eukaryotic Cell Structure

More information

DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH)

DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH) DNA, RNA, replication, translation, and transcription Overview Recall the central dogma of biology: DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) DNA structure

More information

Transcription Activity Guide

Transcription Activity Guide Transcription Activity Guide Teacher Key Ribonucleic Acid (RNA) Introduction Central Dogma: DNA to RNA to Protein Almost all dynamic functions in a living organism depend on proteins. Proteins are molecular

More information

Pharmaceutical Biotechnology. Recombinant DNA technology Western blotting and SDS-PAGE

Pharmaceutical Biotechnology. Recombinant DNA technology Western blotting and SDS-PAGE Pharmaceutical Biotechnology Recombinant DNA technology Western blotting and SDS-PAGE Recombinant DNA Technology Protein Synthesis Western Blot Western blots allow investigators to determine the molecular

More information

Overview of the Recombinant DNA technology- the process of subcloning a foreign gene into the plasmid vector puc19

Overview of the Recombinant DNA technology- the process of subcloning a foreign gene into the plasmid vector puc19 Health and Life Sciences Faculty Course Title: Biological and Forensic Science Module code: 216 BMS Module Title: Molecular Genetics Overview of the Recombinant DNA technology- the process of subcloning

More information

Basic Concepts of DNA, Proteins, Genes and Genomes

Basic Concepts of DNA, Proteins, Genes and Genomes Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate

More information

Worked solutions to student book questions Chapter 13 DNA

Worked solutions to student book questions Chapter 13 DNA Q1. Copy the structural formula of deoxyribose sugar. Now indicate where covalent bonds form to link this group to: a a phosphate group b a base group A1. Q2. Give the sequence of bases that will pair

More information

Methods for Protein Analysis

Methods for Protein Analysis Methods for Protein Analysis 1. Protein Separation Methods The following is a quick review of some common methods used for protein separation: SDS-PAGE (SDS-polyacrylamide gel electrophoresis) separates

More information

NUCLEIC ACIDS. An INTRODUCTION. Two classes of Nucleic Acids

NUCLEIC ACIDS. An INTRODUCTION. Two classes of Nucleic Acids NUCLEIC ACIDS An INTRODUCTION Two classes of Nucleic Acids Deoxynucleic Acids (DNA) Hereditary molecule of all cellular life Stores genetic information (encodes) Transmits genetic information Information

More information

Molecular Biology Basic Concepts

Molecular Biology Basic Concepts Molecular Biology Basic Concepts Prof. Dr. Antônio Augusto Fröhlich Charles Ivan Wust LISHA - UFSC {guto charles}@lisha.ufsc.br http://www.lisha.ufsc.br/~{guto charles} September 2003 September 2003 http://www.lisha.ufsc.br/~guto

More information

Helices From Readily in Biological Structures

Helices From Readily in Biological Structures The α Helix and the β Sheet Are Common Folding Patterns Although the overall conformation each protein is unique, there are only two different folding patterns are present in all proteins, which are α

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

STRUCTURES OF NUCLEIC ACIDS

STRUCTURES OF NUCLEIC ACIDS CHAPTER 2 STRUCTURES OF NUCLEIC ACIDS What is the chemical structure of a deoxyribonucleic acid (DNA) molecule? DNA is a polymer of deoxyribonucleotides. All nucleic acids consist of nucleotides as building

More information

DNA replication. DNA RNA Protein

DNA replication. DNA RNA Protein DNA replication The central dogma of molecular biology transcription translation DNA RNA Protein replication Revers transcriptase The information stored by DNA: - protein structure - the regulation of

More information

SAM Teacher s Guide DNA to Proteins

SAM Teacher s Guide DNA to Proteins SAM Teacher s Guide DNA to Proteins Note: Answers to activity and homework questions are only included in the Teacher Guides available after registering for the SAM activities, and not in this sample version.

More information

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory.

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory. BIOTECHNOLOGY Levels: 11-12 Units of Credit: 1.0 CIP Code: 51.1201 Prerequisite: Biology or Chemistry Skill Certificates: #708 COURSE DESCRIPTION is an exploratory course designed to create an awareness

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

Molecular Biology of The Cell - An Introduction

Molecular Biology of The Cell - An Introduction Molecular Biology of The Cell - An Introduction Nguyen Phuong Thao School of Biotechnology International University Contents Three Domain of Life The Cell Eukaryotic Cell Prokaryotic Cell The Genome The

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium

More information

Biological molecules:

Biological molecules: Biological molecules: All are organic (based on carbon). Monomers vs. polymers: Monomers refer to the subunits that, when polymerized, make up a larger polymer. Monomers may function on their own in some

More information

Activity 4/5.1 How Can You Identify Organic Macromolecules?

Activity 4/5.1 How Can You Identify Organic Macromolecules? Answers? Activity 4/5.1 ow an You Identify rganic Macromolecules? efer to the figure (Some Simple hemistry) on the next page when doing this activity. Part A. Answer the questions. Then use your answers

More information

DNA replication (Lecture 28,29)

DNA replication (Lecture 28,29) DNA replication (Lecture 28,29) 1. DNA replication and the cell cycle 2. DNA is Reproduced by Semiconservative Replication 2.1 Conservation of the Original Helix 2.2 The Meselson-Stahl Experiment 2.3 Semiconservative

More information

Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure

Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure Nucleic acids play an important role in the storage and expression of genetic information. They are divided into

More information

INTRODUCTION TO DNA Replication

INTRODUCTION TO DNA Replication INTRODUCTION TO DNA Replication - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - Chapter 13 covers a descriptive explanation of Deoxyribose nucleic Acid

More information

Proteins. Proteins. Amino Acids. Most diverse and most important molecule in. Functions: Functions (cont d)

Proteins. Proteins. Amino Acids. Most diverse and most important molecule in. Functions: Functions (cont d) Proteins Proteins Most diverse and most important molecule in living i organisms Functions: 1. Structural (keratin in hair, collagen in ligaments) 2. Storage (casein in mother s milk) 3. Transport (HAEMOGLOBIN!)

More information

Recombinant DNA Unit Exam

Recombinant DNA Unit Exam Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the

More information

Chapter 5: The Structure and Function of Large Biological Molecules

Chapter 5: The Structure and Function of Large Biological Molecules Name Period Concept 5.1 Macromolecules are polymers, built from monomers 1. The large molecules of all living things fall into just four main classes. Name them. 2. Circle the three classes that are called

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS

STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS THESIS SUBMITTED FOR THE DEGREB OF DOCTOR OF PHILOSOPHY (SCIENCE) OF THE UNIVERSITY OF CALCUTTA 1996 NRISINHA DE, M.Sc DEPARTMENT OF BIOCHEMISTRY

More information

Biochem 717 Gene Cloning. Prof Amer Jamil Dept of Biochemistry University of Agriculture Faisalabad

Biochem 717 Gene Cloning. Prof Amer Jamil Dept of Biochemistry University of Agriculture Faisalabad Biochem 717 Gene Cloning Prof Amer Jamil Dept of Biochemistry University of Agriculture Faisalabad How to construct a recombinant DNA molecule? DNA isolation Cutting of DNA molecule with the help of restriction

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

DNA Glycosylase Exercise - Levels 1 & 2: Answer Key

DNA Glycosylase Exercise - Levels 1 & 2: Answer Key Name StarBiochem DNA Glycosylase Exercise - Levels 1 & 2: Answer Key Background In this exercise, you will explore the structure of a DNA repair protein found in most species, including bacteria. DNA repair

More information

Transcription Study Guide

Transcription Study Guide Transcription Study Guide This study guide is a written version of the material you have seen presented in the transcription unit. The cell s DNA contains the instructions for carrying out the work of

More information

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the

More information

DNA CLONING: amplification of unique DNA molecules. In vivo-in different host cells

DNA CLONING: amplification of unique DNA molecules. In vivo-in different host cells DNA CLONING DNA CLONING: amplification of unique DNA molecules In vitro-pcr In vivo-in different host cells POLYMERASE CHAIN REACTION (PCR) PCR THE POLYMERASE CHAIN REACTION (PCR) PROVIDES AN EXTREMELY

More information