05_02_DNA.jpg. covalent bonds H bonds. polarity; antiparallel

Transcription

1 Animal Cell

2 05_02_DNA.jpg covalent bonds H bonds polarity; antiparallel

3 05_06_compl_pairs.jpg H bonds between a purine and a pyrimidine fits the space; complementary bases; which more stable?

4 05_07_base pairing.jpg Same distance across molecule at each base pair (20Å)

5 05_08_major_minor_gr.jpg = is wider 10 nucleotides per helical turn = 34Å

6 05_24_Chromatin pack.jpg

7 05_21_Nucleosomes.jpg 30 nm fibers individual nucleosomes = beads on a string

8 05_22_8_histone.jpg

9 05_23_histone core.jpg

10 05_25_zigzag model.jpg

11 05_26_tightly packed.jpg

12 Gene-protein relations How do genes control enzyme (protein) activity? A protein is a polymer: A chain of amino acids. Connected through a peptide bond : a covalent bond between the C-N

13 General formula of an amino acid H 2 N-CHR 1 -COOH 20 common amino acids They differ only in R (side group), R can be hydrogen (glycine), ring (aromatic amino acids like tyrosine), etc. Most proteins in living organisms are large polypeptides mostly consisting of a.a The chemical properties of the amino acids are responsible for the structure and function of a protein (hydrophobic tend to be buried, hydrophilic tend to be outside, etc.)

14 Determinants of protein structure (and as a consequence,function) 1. Primary structure 2. Secondary structure 3. Tertiary structure 4. Quaternary structure

15 1. Primary structure: Linear sequence The order of amino acids determined (encoded) by the linear sequence of nucleotides (DNA) in a gene. Sequence of tryptophan synthase A

16 2. Secondary structure The interrelations of amino acids that are close together in the linear structure created by hydrogen bonds between CO and NH groups of different residues. Two basic periodic structures are α helix and β sheet β sheet α helix

17 3. Tertiary structure: Three dimentional architecture created by electrostatic, hydrogen and van der waals bonds between various R groups causing the protein chain to fold back. Sometimes amino acids that are very far in the primary structure become close in the 3rd structure. myoglobin

18 4. Quaternary structure - multimeric Two or more separate folded structures bind together to form a structure hemoglobin

19 RNA (Ribonucleic acid) Bases: Adenine (A) Guanine (G) Cytosine (C) Uracil (U); replaces T Oriented from 5 (phosphate) to 3 (sugar). Single-stranded => flexible backbone => secondary structure => catalytic role.

20 Overview of DNA to RNA to Protein A gene is expressed in two steps 1) Transcription: RNA synthesis 2) Translation: Protein synthesis

21 The Central Dogma

22 The birth of molecular Biology (early 70 s) Scientists find that some bacterial strains are immune to certain viruses (bacteriophages) Apparently, they have a system that RESTRICTS attacks: nucleases that chew up the viral DNA- RESTRICTION ENZYMES

23 Enzyme Site Recognition Each enzyme digests (cuts) DNA at a specific sequence = restriction site Enzymes recognize 4- or 6- base pair, palindromic sequences (eg GAATTC) Restriction site Palindrone Fragment 1 Fragment 2

24 5 vs 3 Enzyme cuts Prime Overhang Generates 5 prime overhang

25 Common Restriction Enzymes EcoRI Eschericha coli 5 prime overhang Pstl Providencia stuartii 3 prime overhang

26 R. E.s and DNA Ligase can be used to make recombinant DNA EcoRI GAATTC CTTAAG G CTTAA 1 Digestion EcoRI GAATTC CTTAAG AATTC 2 Annealing of sticky ends G G Ligase AATTC CTTAA G 3 Ligation 4 Recombinant DNA G AATTC CTTAA G

27 Gel Electrophoresis

28 Size of DNA fragments Restriction digestion & agarose gel electrophoresis using molecular weight marker 3.5 kb 0.8 kb 4.0 kb 3.0 kb 2.0 kb 1.6 kb 1.0 kb 0.5 kb

29 Hybridization The bases in DNA will only pair in very specific ways: G with C and A with T In short DNA sequences, imprecise base pairing will not be tolerated The source of any single strand of DNA is irrelevant, merely the sequence is important, thus complementary DNA from different sources can form a double helix This phenomenon of base pairing of single stranded DNA strands to form a double helix is called hybridization as it may be used to make hybrid DNA composed of strands from different sources 2000 Timothy G. Standish

30 Hybridization DNA from source X CTGATGGTCATGAGCTGTCCGATCGATCAT TACTCGACAGGCTAG Hybridization TACTCGACAGGCTAG DNA from source Y 2000 Timothy G. Standish

31 Hybridization Because DNA sequences will seek out and hybridize with other sequences with which they base pair in a specific way much information can be gained about unknown DNA using single stranded DNA of known sequence Short sequences of single stranded DNA can be used as probes to detect the presence of their complementary sequence in any number of applications including: Southern blots Northern blots (in which RNA is probed) In situ hybridization Dot blots... In addition, the renaturation, or hybridization, of DNA in solution can tell much about the nature of organism s genomes 2000 Timothy G. Standish

32 Southern Blots Called Southern blots after their inventor (Edwin Southern, 1975) Involves five steps: 1 Digestion of DNA using restriction enzymes 2 Separation of the DNA fragments by size using gel electrophoresis 3 Transfer of fragments to a nitrocellulose or nylon membrane 4 Hybridization of a probe to the fragment or fragments of interest 5 Probe detection (autoradiography) 2000 Timothy G. Standish

33 Making A Southern Blot Digestion and Electrophoresis Marker Control Experimental Timothy G. Standish

34 Making A Southern Blot 3 DNA Transfer To Membrane DNA Paper Towels Gel Gel Membrane Membrane Buffer 2000 Timothy G. Standish

35 Making A Southern Blot 4 Probe Hybridization Addition of blocking reagent Probe addition After washing Membrane with bound DNA Parts of the membrane not already covered with DNA now bind blocking reagent Probe covers the membrane, but only binds to complementary DNA Probe only remains annealed to complementary DNA 2000 Timothy G. Standish

36 Making A Southern Blot 5 Autoradiograph Development Membrane with probe bound to complementary DNA X-ray film is placed over the membrane and left until radiation from the probe has exposed the film Fragments complementary to the probe appear as bands on the autorad 2000 Timothy G. Standish

37 Gel vs. Blot

38 So What is the Big Deal? Southern blots tell both the size and something about the sequence of a fragment mixed in with many other fragments, thus they can be used for many purposes Southern blots represent a technological change that led to a strategic change. A NEW approach to biology: Molecular Biology. Most techniques currently used were later developments of this basic idea 2000 Timothy G. Standish

39 Hybridization Screening Take the genome of an organism, cut it to pieces and CLONE it in plasmids : each plasmid has a random piece, each bacterium has only one type of plasmid. This collection is a genomic LIBRARY. Stick the DNA from many colonies of the library to a membrane Then hybridize a probe to the DNA on the membrane: Only those colonies that are complementary to the probe will give a positive result Timothy G. Standish

40 Membrane Hybridization Screening Transfer cells to membrane Lyse cells - DNA and protein stick to membrane Locate colony with target clone Develop X-ray film Block membrane - Prevents probe from sticking to membrane Add probe Cover with X-ray film Wash off excess probe 2000 Timothy G. Standish

41 Northern blots The most straight forward method for the measurement of a specific mrna species is called Northern blot hybridization analysis. Northern blots are similar to the Southern blots except that RNA, rather than DNA, is blotted onto the membrane.

42 Poly A+ RNA Once pure RNA is obtained, it is possible to further purify the mrna by oligo dt cellulose chromatography. Only about 1% of the total RNA from a tissue sample consists of mrna (poly A+ RNA). This step increases the sensitivity of any detection method. AAAAAAAAAAAA

43 Total or poly A+ RNA is resolved by agarose gel electrophoresis. This separates the various RNA molecules according to their size. The RNA in the gel is transferred to a nitrocellulose or nylon membrane. Radioactive DNA probes that are derived from the target gene are denatured and hybridized with the RNA blot.

44 These probes can anneal with complementary sequences in the RNA samples on the gel. The amount of probe bound to the RNA on the filter, as measured by radioactivity, is proportional to the amount of target RNA present on the filter.

45 Northern blot hybridization analysis of p53 and GAPDH mrna in total RNA samples from mouse tissues.

46 Measurement of proteins The amount of protein that is produced from a certain gene can be determined. Assays typically involve antibodies that specifically bind to the target protein. To produce such antibodies, the target protein is usually injected into an animal such as a rabbit or mouse.

47 The animal s immune system recognizes the injected protein as a foreign substance (antigen). Antibodies are made that bind to the protein and allow for its removal from the blood. Isolation of these antibodies from the animal s blood provides reagents that can be used to specifically recognize and bind to particular proteins.

48 Western blots Western blot analysis is the most common method for identifying and quantifying proteins. Protein samples from a tissue are resolved by electrophoresis and blotted from the gel onto a nitrocellulose or nylon membrane.

49 The membrane is then incubated first with the specific antibody, which binds to the target protein. Then a second antibody that recognizes and binds to the first antibody is added. The second antibody is labeled with a radioactive tag or with an enzyme that can easily be assayed. Peroxidase or acid phosphatase are commonly used.

50

51 RIA and ELISA Radio-immuno-assays (RIA) or enzyme linked immunosorbent assays (ELISA). Protein samples are applied to wells in plastic plates and the specific antibody and second antibody are applied. After washing, the radioactivity (in the case of RIA) or enzyme activity (in the case of ELISA) associated to the second antibody can be measured. ELISA assays have been adapted for use diagnostic tests.

52

53 In situ expression assays It is possible to detect gene expression directly in tissues or whole organisms. RNA in situ hybridization Labeled probes are applied to tissue sections to detect mrna. Protein Labeled antibodies are used to detect protein in tissue sections or whole organisms.

54 In situ detection of myogenin mrna in a mouse embryo

55 Reporter gene assays An interesting way to assay transcription in transgenic organisms is with reporter genes. The promoter and regulatory sequences of a gene of interest are attached to coding sequences of a gene that encodes a product that is easily detected. Transfer of this synthetic gene into a host organism allows for the expression of the reporter gene Reporter gene expression represents the pattern of expression of the native gene.

56 Reporter genes Commonly used reporter genes include: LacZ, encodes ß-galactosidase. Produces a blue stain when it reacts with X-gal. GUS, encodes ß-glucuronidase. Produces a blue stain when it reacts with X-gluc. LUC, Luciferase, fire-fly enzyme that produces light when it reacts with luciferin substrate. GFP, Green fluorescent proteins, fluoresce green when excited by blue light.

57 Staining of mouse embryo expressing PITX2-LacZ Tobacco plant expressing CaMV35S-Luciferase

58 In vivo expression analysis Expression of luciferase and GFP can be assayed in living organisms. No chemical fixation of the tissue or toxic stains are required. Therefore, it is possible to detect the expression of these reporter genes directly in living organisms and to follow changes in their expression over time.

59 Mouse pups expressing GFP Arabidopsis plant expressing GFP