Lab 5: DNA Fingerprinting

Save this PDF as:

Size: px
Start display at page:

Download "Lab 5: DNA Fingerprinting"


1 Lab 5: DNA Fingerprinting You are about to perform a procedure known as DNA fingerprinting. The data obtained may allow you to determine if the samples of DNA that you will be provided with are from the same individual or from different individuals. DNA fingerprinting (a.k.a. DNA typing, DNA profiling) uses DNA to show relatedness or identity of individual humans, other animals, or plants. In addition to forensic science, DNA fingerprinting has many other applications. For example: - Food identification: identifying impurities in food products - Freeing innocent convicted felons - Identifying human remains (historical sites, during times of war) - Determining relatedness of family members, paternity testing - Identifying organisms that cause disease In today s experiment, we will try to determine whether DNA from any of 5 crime suspects matches a DNA sample found at a crime scene. For this experiment, it is necessary to review the structure of DNA molecules. The DNA structures shown here represent very small sections of DNA from 3 different individuals. DNA consists of a series of nitrogenous base molecules bonded a sugar-phosphate backbone. Remember, the phosphate groups are negatively charged. The nitrogenous bases are adenine, thymine, guanine, and cytosine (A, T, G, and C). The bases from each strand pair with bases from the opposite strand according to base-pairing rules: A with T, and G with C. Figure 1 S = sugar (deoxyribose) P = phosphate The basic principle underlying DNA fingerprinting is that the sequence of bases (A, T, G, C) is unique in the DNA molecules of each organism (with the exception of identical twins). Therefore, your DNA is like your fingerprint it can identify you and distinguish you from other organisms. As with regular fingerprints, we need a way to visualize DNA fingerprints. For this, we rely on the use of restriction enzymes. to (continued on next page) 47

2 Activity 5a Restriction Enzyme Digestion of DNA Purpose In this activity, you will learn what restriction enzymes do and what their role is in DNA fingerprinting. You will use two restriction enzymes to digest DNA samples from the suspects as well as from the crime scene. The DNA products of the restriction enzyme digestion will be analyzed in Activities 5b and 5c. Background: Restriction enzymes: DNA cutting tools, or molecular scissors. Isolated from bacteria, who use them as a defensive tool to cut up foreign DNA There are many different restriction enzymes. Each restriction enzyme cuts DNA at a specific sequence of nucleotides (called restriction sites). All restriction sites are palindromic sequences, which means that the sequence on one DNA strand is the same as the sequence on the complementary DNA strand when it is read in the opposite direction. For example, we will be using 2 different restriction enzymes in today s lab: EcoRI cuts DNA at the sequence G A A T T C C T T A A G PstI cuts DNA at the sequence C T G C A G G A C G T C Let s look at a restriction digestion with EcoRI on a DNA molecule with the following sequence: A T G A A T T C T C A A T T A C C T T A C T T A A G A G T T A A T G G A A T G T A C T T A A A A T T C T C A A T T A C C T G A G T T A A T G G A Cutting this DNA sequence with EcoRI has now produced 2 DNA molecules of different sizes. DNA fragment size can be expressed as the number of base pairs in the fragment. Here, one of the DNA fragments is 3 base pairs (3 bp), and the other fragment is 11 base pairs (11 bp). In DNA fingerprinting, DNA from different individuals is cut with restriction enzymes in order to create a unique profile of DNA fragments this is the fingerprint that can determine whether two DNA samples came from the same individual or from different individuals. 48

3 Procedure 1. First, assemble the following materials for your group at your lab bench: EcoRI/PstI enzyme mix (80 µl) on ice. P-10 pipet, P-100 pipet, yellow micropipet tips colored microfuge tubes (green, blue, orange, violet, red, & yellow) sharpie marker to label tubes foam microfuge tube holder for waterbath incubation laboratory tape to label samples, gels 2. The Instructor bench will have the following materials when you are ready to use them: Crime scene DNA with buffer Suspect 1 DNA with buffer Suspect 2 DNA with buffer Suspect 3 DNA with buffer Suspect 4 DNA with buffer Suspect 5 DNA with buffer 37 C waterbath or incubator 3. Label your reaction tubes as follows: Green tube: CS (crime scene) Blue tube: S1 (suspect 1) Orange tube: S2 (suspect 2) Violet tube: S3 (suspect 3) Red tube: S4 (suspect 4) Yellow tube: S5 (suspect 5) * Also, make sure your group # or name is on the tubes so they don t get confused with other groups tubes. 4. Add DNA samples to tubes. Go to instructor bench and transfer 10 µl of each DNA sample from the colored stock tubes into each of the corresponding labeled colored tubes. Make sure to use a fresh pipet tip for each sample!!! 5. Add 10 µl of enzyme mix to each tube of DNA. Make sure to use a fresh pipet tip for each sample!!! 6. Mix the tube contents by gently flicking the tubes with your finger (ask instructor to demonstrate). {do not use vortex!} 7. Spin the tubes in a microcentrifuge for about two seconds to force the liquid to the bottom of the tubes. Make sure the tubes are balanced in the microcentrifuge! 8. Incubate the samples at 37 C for 45 minutes. Record start time and stop time for your incubation in your lab notebook. Also, make a table in your notebook listing the contents in each tube for quick reference. While your restriction digests are incubating, you will prepare your agarose gels for gel electrophoresis. Since we cut the DNA from the crime scene and the DNA from suspects #1-5 with the same restriction enzymes, we can compare the sizes of the DNA fragments to determine whether any of the suspects DNA matches DNA obtained from the crime scene. In order to compare the sizes of the DNA fragments, we need a way to separate them by size and visualize the DNA fragments. To do this, we will use a technique called gel electrophoresis. 49

4 Activity 5b Gel Electrophoresis Purpose This activity will introduce you to the technique of gel electrophoresis, which is a method for the separation of biological molecules. You will use agarose gel electrophoresis to separate the products of your restriction enzyme digestion. Once separated on a gel, the DNA fragments will then be visualized by DNA staining in Activity 5c. Background: Gel electrophoresis: lab technique that uses electricity and a thin gel to separate nucleic acids or proteins by size. DNA fragments from each sample are loaded into wells in an agarose gel slab, which is placed into a chamber filled with a conductive buffer solution. A current is passed between wire electrodes at each end of the chamber. Since DNA molecules are negatively charged (due to the negatively charged phosphate groups in the sugar-phosphate backbone), they will move toward the positive electrode. The matrix of the agarose gel acts as a molecular sieve through which smaller DNA molecules can move more easily than larger ones. - an analogous situation: Imagine a classroom where all the desks and chairs have been pushed together. An individual student can wind his/her way through the maze more quickly and easily than a string of four students trying to wind through the maze. Figure 2 Mixture of DNA molecules of different sizes Power source Gel + + Completed gel Longer molecules Shorter molecules After the DNA fragments produced from restriction enzyme digestion are separated by gel electrophoresis, the shorter molecules will migrate farther than the larger ones (as shown in Figure 3). Fragments of the same size will migrate together in the gel and appear as single bands of DNA. These bands will be seen in the gel after the DNA is stained. Procedure Your instructor has already poured 1% agarose gels for each group. There will also be some extra agarose gels for you to practice loading before you load your DNA into the gel. If you would like to learn how to pour agarose gels, materials are available for that, and your instructor can help show you how to pour agarose gels while your gel is running. 50

5 1. Prepare your samples to be loaded into the gel. a) Obtain an aliquot of loading dye (LD) from your instructor. b) Using a new tip for each sample, add 5 µl of loading dye (LD) to each sample tube. Tightly cap each tube. Mix the components by gently flicking the tubes with your finger. c) Obtain an aliquot of DNA marker from your instructor. 2. Before loading your gel, practice loading a dye solution into one of the practice agarose gels that has been set up for you. Ask your instructor to demonstrate loading technique. You want to make sure that you don t go down to the second stop too forcefully when expelling the sample into the well of the gel so that the sample doesn t explode out of the well. Also, once you have delivered all of the sample into the well, make sure not to release the plunger until your pipet is all the way out of the gel; otherwise, you may withdraw some of the DNA sample back into the pipet tip. 3. Once everyone in your group has had a chance to practice, you are ready to load your gel. a) Place the gel tray into the electrophoresis chamber in the proper orientation (with the wells at the (-) electrode, which is colored black). b) Fill the electrophoresis chamber with 1X TAE buffer use enough buffer to just cover the wells of the gel by 1-2 mm. c) Just before loading your samples, spin them in a microcentrifuge for a few seconds to make sure that all the sample is at the bottom of the tube (make sure tubes are balanced if you have an odd number of tubes, you must use a blank tube). d) Using a separate pipet tip for each sample, use your P-100 to load your digested DNA samples into the gel. Gels are read from left to right. The first sample is loaded in the well at the lefthand corner of the gel. Make sure you record the order in which you loaded your samples in your lab notebook. Lane 1: DNA size marker (clear tube), 10 µl Lane 2: CS (green tube), 20 µl Lane 3: S1 (blue tube), 20 µl Lane 4: S2 (orange tube), 20 µl Lane 5: S3 (violet tube), 20 µl Lane 6: S4 (red tube), 20 µl Lane 7: S5 (yellow tube), 20 µl Figure 3 4. Run the gel. a) Secure the lid on the gel box. The lid will only attach to the base in one orientation (red to red & black to black). Connect the electrical leads to the power supply. b) Turn on the power supply. Set it for 125 V (check this with your instructor) and electrophorese the samples for about 30 minutes, or until the dye front is near the bottom of the gel. Write down the time you started the electrophoresis in your lab notebook. c) Once you turn on the power supply, you should see bubbles coming up from the electrodes if everything is working properly. After about 5 minutes, you should observe movement of the dye front away from the wells toward the anode. 51

6 Activity 5c DNA staining Purpose This activity will show you how DNA molecules can be visualized using a DNA stain. You will use Fast Blast DNA stain to see the DNA fragments produced from restriction enzyme digestion in your agarose gel. This will allow you to determine which of the suspect s DNA matches the DNA found at the crime scene. Background Since DNA is naturally colorless, it is not visible in the gel. The blue color that you see only indicates the positions of the loading dye and not the positions of the DNA fragments. DNA fragments will be visualized by staining the gel with a blue stain called Fast Blast DNA stain. The blue stain molecules are positively charged (+) and have a high binding affinity for DNA, which is negatively charged (-). The blue stain strongly binds to the DNA fragments and allows the DNA to become visible. These visible bands of DNA may then be traced, photographed, sketched, or retained as a permanently dried gel for analysis. Procedure 1. When the electrophoresis is complete, turn off the power supply and remove the lid from the gel box. Carefully remove the gel tray and gel from the electrophoresis chamber. Be very careful, as the gel is fragile use a spatula to avoid breaking the gel. Place the gel in a staining tray. Please share staining trays with at least one other group make sure to identify your gel in some way! One good way is to cut the corner or nick one group s gel. Also, use label tape on the staining tray to write the group s number or initials. 2. Before adding stain, make sure you have enough warm water for the destain rinses. You ll need about L of warm water (between C). To prepare this, heat water in the microwave in a plastic beaker until hot to the touch. Then mix with room temperature water to end up with warm water. You may need repeat this in between washes. 3. Pour approximately 120 ml of 100X stain into the staining tray enough stain to completely submerge the gels. Stain the gels for 2-3 minutes, but not for more than 3 minutes. Using a funnel, pour the 100X stain into a storage bottle (it can be re-used). 4. Pour ml of warm water into the tray. Rinse ~ 10 seconds. 5. Holding onto the gels with your hand, pour out the wash water, and add another ml of warm water for a second wash. Gently rock or shake the gel on a shaker for 5 min. 6. Perform another wash as in step 5. Figure 4 for 52

7 7. Pour off the water and examine the stained gels. The bands may appear fuzzy immediately after the second wash, but will begin to develop into sharper bands within 5-15 minutes after the second wash as the stain molecules bind more tightly to the DNA. To obtain maximum contrast, additional washes in warm water may be necessary. 8. Place your gel on a light background (white paper, or light box, if available) and record your results by making a diagram as follows. Place a clear sheet of plastic wrap over your gel. Using a sharpie marker, trace the wells where you loaded your samples and trace the band patterns. Then remove the plastic wrap and ask your instructor to make a copy for your notebook or trace the wells and band patterns into your notebook. 53

8 Lab 5 Homework Name: 1) Look at the DNA structure cartoon shown in Figure 1 (pg. 1). a) Are there any differences in the sugar-phosphate arrangements in the 3 DNA molecules? b) What are the similarities and differences regarding the bases in the 3 DNA samples? c) Are the bases paired in an identical manner in all 3 DNA samples? 2) Could the following DNA sequences possibly be a restriction sites (sites in DNA where a restriction enzyme might cut)? Why or why not? a) TCGCGA b) ATCTGA 3) Given this DNA fragment sequence: TGTCATGAATTCTCAATTCTGCAGACCT ACAGTACTTAAGAGTTAAGACGTCTGGA a) How many DNA fragments would result from cutting with EcoRI (recognizes GAATTC, cuts between the G & A)? b) What are the sizes of these fragments? b) How many DNA fragments would result from cutting with both EcoRI (recognizes GAATTC, cuts between G & A) and PstI (recognizes CTGCAG, cuts between A & G)? 4) Our gels were made from a 1% agarose solution prepared in TAE buffer. If you were to prepare this from agarose powder and TAE buffer, how much agarose would you need to prepare 50 ml of agarose gel? Show your calculations, and describe how you would make the 1% agarose solution. 54

9 5) The electrophoresis apparatus creates an electrical field with a positive electrode at one end of the gel and a negative electrodes at the other end of the gel. a) Which direction will DNA molecules migrate in the gel (+ ) or ( +)? b) Explain why DNA molecules migrate in the direction you chose in part a. c) Which DNA size fragment (large vs. small) would you expect to move toward the opposite end of the gel most quickly? Explain your answer. 6) Looking at the cartoon of a stained agarose gel shown here, answer the following questions: a) What can you assume is contained within each band? b) Which of the DNA samples have the same number of restriction sites for the restriction enzyme used? Write the lane numbers. c) Which sample contains the smallest DNA fragment? d) How many restriction sites were there in the DNA sample in lane five? e) Which DNA samples appear to have been cut into the same number and size of fragments (in other words, which suspect s DNA matches the DNA found at the crime scene)? 55

Computer 6B. Forensic DNA Fingerprinting

Computer 6B. Forensic DNA Fingerprinting Forensic DNA Fingerprinting Computer 6B Scientists working in forensic labs are often asked to perform DNA profiling or fingerprinting to analyze evidence in law enforcement, mass disasters, and paternity

More information

LAB 14 DNA Restriction Analysis

LAB 14 DNA Restriction Analysis Name: AP Biology Lab 14 LAB 14 DNA Restriction Analysis Introduction: DNA restriction analysis is at the heart of recombinant DNA technology and of the laboratories in this course. The ability to cut DNA

More information

Crime Scenes and Genes

Crime Scenes and Genes Glossary Agarose Biotechnology Cell Chromosome DNA (deoxyribonucleic acid) Electrophoresis Gene Micro-pipette Mutation Nucleotide Nucleus PCR (Polymerase chain reaction) Primer STR (short tandem repeats)

More information

Forensic DNA Fingerprinting Kit. Instruction Manual

Forensic DNA Fingerprinting Kit. Instruction Manual Biotechnology Explorer Forensic DNA Fingerprinting Kit Instruction Manual Catalog #166-0007EDU The kit is shipped at room temperature. Open immediately upon arrival and store reagent

More information

Fast Blast DNA Stain (500x) 100 ml Instruction Manual

Fast Blast DNA Stain (500x) 100 ml Instruction Manual Fast Blast DNA Stain (500x) 100 ml Instruction Manual Catalog #166-0420EDU Store at room temperature. Stable for 1 year from purchase. Table of Contents Section 1 Introduction...1 Section 2 Features of

More information

DNA Electrophoresis Lesson Plan

DNA Electrophoresis Lesson Plan DNA Electrophoresis Lesson Plan Primary Learning Outcomes: Students will learn how to properly load a well in an agarose gel. Students will learn how to analyze the results of DNA electrophoresis. Students

More information

DNA Restriction Analysis

DNA Restriction Analysis DNA Restriction Analysis Introduction: DNA restriction analysis is at the heart of recombinant DNA technology and of the laboratories in this course. The ability to cut DNA predictably and precisely enables

More information

DNA: A Person s Ultimate Fingerprint

DNA: A Person s Ultimate Fingerprint A partnership between the UAB Center for Community Outreach Development and McWane Center DNA: A Person s Ultimate Fingerprint This project is supported by a Science Education Partnership Award (SEPA)

More information

The Techniques of Molecular Biology: Forensic DNA Fingerprinting

The Techniques of Molecular Biology: Forensic DNA Fingerprinting Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins

More information

EXPERIMENT 10: Restriction Digestion and Analysis of Lambda DNA

EXPERIMENT 10: Restriction Digestion and Analysis of Lambda DNA Biochemistry Lab CHE 431 Page 1 of 7 OBJECTIVE: EXPERIMENT 10: Restriction Digestion and Analysis of Lambda DNA DNA splicing, the cutting and linking of DNA molecules, is one of the basic tools of modern

More information

RAINBOW ELECTROPHORESIS 1 An Introduction to Gel Electrophoresis

RAINBOW ELECTROPHORESIS 1 An Introduction to Gel Electrophoresis RAINBOW ELECTROPHORESIS 1 An Introduction to Gel Electrophoresis INTRODUCTION This laboratory will demonstrate the basics of electrophoresis and the theory behind the separation of molecules on an agarose

More information


RESTRICTION ENZYME ANALYSIS OF DNA University of Massachusetts Medical School Regional Science Resource Center SUPPORTING MATHEMATICS, SCIENCE AND TECHNOLOGY EDUCATION 222 Maple Avenue, Stoddard Building Shrewsbury, MA 01545-2732 508.856.5097

More information

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns

More information

Transformation Protocol

Transformation Protocol To make Glycerol Stocks of Plasmids ** To be done in the hood and use RNase/DNase free tips** 1. In a 10 ml sterile tube add 3 ml autoclaved LB broth and 1.5 ul antibiotic (@ 100 ug/ul) or 3 ul antibiotic

More information

Biotechnology Explorer

Biotechnology Explorer Biotechnology Explorer Restriction Digestion and Analysis of Lambda DNA Kit Instruction Manual Catalog #166-0002EDU The kit is packaged and shipped as two modules. Open the modules

More information

Agarose Gel Electrophoresis with Food Color- Teacher Guide

Agarose Gel Electrophoresis with Food Color- Teacher Guide Page 1 of 7 Project Home Gateway to the Project Laboratory Activities What the Project can do in the classroom Biotechnology Resources Favorite resources online and in print Agarose Gel Electrophoresis

More information

DNA Fingerprinting. Biotechnology - Electrophoresis & DNA Fingerprinting Biology 100 - Concepts of Biology 8.1. Name Instructor Lab Section.

DNA Fingerprinting. Biotechnology - Electrophoresis & DNA Fingerprinting Biology 100 - Concepts of Biology 8.1. Name Instructor Lab Section. Biotechnology - Electrophoresis & DNA Fingerprinting Biology 100 - Concepts of Biology 8.1 Name Instructor Lab Section Objectives: To gain a better understanding of: Fundamental Biotechnology Techniques

More information

Objectives: Vocabulary:

Objectives: Vocabulary: Introduction to Agarose Gel Electrophoresis: A Precursor to Cornell Institute for Biology Teacher s lab Author: Jennifer Weiser and Laura Austen Date Created: 2010 Subject: Molecular Biology and Genetics

More information

Biotechnology Explorer

Biotechnology Explorer Biotechnology Explorer Analysis of Precut Lambda DNA Kit Instruction Manual Catalog #166-0001EDU Ships at room temperature. Store DNA in the refrigerator (4 C) or freezer ( 20 C) within

More information

The MiniOne TM Reagent Kit: Electrophoresis 101

The MiniOne TM Reagent Kit: Electrophoresis 101 The MiniOne TM Reagent Kit: Cat#: M3001 2 3 Reagent Kit Components Other Required Materials Laboratory Safety Experiment Procedures Teacher s Guide Student Worksheet Ordering Consumables Table of Contents

More information

The Chemical Nature of DNA

The Chemical Nature of DNA Experiment 3 The Chemical Nature of DNA Chemically, DNA is a polymer composed of four simple repeating subunits, the nucleotides. Each nucleotide is comprised of a molecule of deoxyribose, a phosphate

More information

HiPer Restriction Fragment Length Polymorphism (RFLP) Teaching Kit

HiPer Restriction Fragment Length Polymorphism (RFLP) Teaching Kit HiPer Restriction Fragment Length Polymorphism (RFLP) Teaching Kit Product Code: HTBM026 Number of experiments that can be performed: 5/25 Duration of Experiment Protocol:3.5 hours Agarose Gel Electrophoresis:1

More information


LAB 7 DNA RESTRICTION for CLONING BIOTECHNOLOGY I DNA RESTRICTION FOR CLONING LAB 7 DNA RESTRICTION for CLONING STUDENT GUIDE GOALS The goals of this lab are to provide the biotech student with experience in DNA digestion with restriction

More information

Electrophoresis and Electroblotting of Proteins

Electrophoresis and Electroblotting of Proteins Electrophoresis and Electroblotting of Proteins The purpose of the next lab exercises will be to study the relative amounts of β-actin in cells of the B-16 melanoma, liver and muscle of mice. Electrophoresis

More information

Today you will extract DNA from some of your cells and learn more about DNA. Extracting DNA from Your Cells

Today you will extract DNA from some of your cells and learn more about DNA. Extracting DNA from Your Cells DNA Based on and adapted from the Genetic Science Learning Center s How to Extract DNA from Any Living Thing ( and BioRad s Genes in a bottle

More information

What Affects Enzyme Activity? Lab

What Affects Enzyme Activity? Lab Name Date Period Bio I, Ms. D _ What Affects Enzyme Activity? Lab Introduction Enzymes are biological catalysts that help to carry out the thousands of chemical reactions that occur in living cells. They

More information

Biotechnology Explorer Forensic DNA Fingerprinting Kit

Biotechnology Explorer Forensic DNA Fingerprinting Kit Biotechnology Explorer Forensic DNA Fingerprinting Kit Instruction Manual Catalog #166-0077EDU The kit is shipped at room temperature. Open immediately upon arrival and store reagent bag at 20 C within

More information



More information

DNA Technology Mapping a plasmid digesting How do restriction enzymes work?

DNA Technology Mapping a plasmid digesting How do restriction enzymes work? DNA Technology Mapping a plasmid A first step in working with DNA is mapping the DNA molecule. One way to do this is to use restriction enzymes (restriction endonucleases) that are naturally found in bacteria

More information

Southern Blot Analysis (from Baker lab, university of Florida)

Southern Blot Analysis (from Baker lab, university of Florida) Southern Blot Analysis (from Baker lab, university of Florida) DNA Prep Prepare DNA via your favorite method. You may find a protocol under Mini Yeast Genomic Prep. Restriction Digest 1.Digest DNA with

More information

Dot Blot Analysis. Teacher s Guidebook. (Cat. # BE 502) think proteins! think G-Biosciences

Dot Blot Analysis. Teacher s Guidebook. (Cat. # BE 502) think proteins! think G-Biosciences PR110 G-Biosciences 1-800-628-7730 1-314-991-6034 A Geno Technology, Inc. (USA) brand name Dot Blot Analysis Teacher s Guidebook (Cat. # BE 502) think proteins! think G-Biosciences

More information

Troubleshooting Guide for DNA Electrophoresis

Troubleshooting Guide for DNA Electrophoresis Troubleshooting Guide for Electrophoresis. ELECTROPHORESIS Protocols and Recommendations for Electrophoresis electrophoresis problem 1 Low intensity of all or some bands 2 Smeared bands 3 Atypical banding

More information


LAB 11 PLASMID DNA MINIPREP LAB 11 PLASMID DNA MINIPREP STUDENT GUIDE GOAL The objective of this lab is to perform extraction of plasmid DNA and analyze the results. OBJECTIVES After completion, the student should be able to: 1.

More information

BIOTECHNOLOGY. What can we do with DNA?

BIOTECHNOLOGY. What can we do with DNA? BIOTECHNOLOGY What can we do with DNA? Biotechnology Manipulation of biological organisms or their components for research and industrial purpose Usually manipulate DNA itself How to study individual gene?

More information

EZ Load Molecular Rulers. Catalog Numbers 170-8351 20 bp 170-8352 100 bp 170-8353 100 bp PCR 170-8354 500 bp 170-8355 1 kb 170-8356 Precision Mass

EZ Load Molecular Rulers. Catalog Numbers 170-8351 20 bp 170-8352 100 bp 170-8353 100 bp PCR 170-8354 500 bp 170-8355 1 kb 170-8356 Precision Mass EZ Load Molecular Rulers Catalog Numbers 170-8351 20 bp 170-8352 100 bp 170-8353 100 bp PCR 170-8354 500 bp 170-8355 1 kb 170-8356 Precision Mass EZ Load Molecular Rulers Quantity DNA sufficient for 100

More information

DNA Separation Methods. Chapter 12

DNA Separation Methods. Chapter 12 DNA Separation Methods Chapter 12 DNA molecules After PCR reaction produces many copies of DNA molecules Need a way to separate the DNA molecules from similar sized molecules Only way to genotype samples

More information

Gel Electrophoresis Teacher Instructions Suggested Grade Level: Grades 7-14 Class Time Required: 1 period (50 minutes)

Gel Electrophoresis Teacher Instructions Suggested Grade Level: Grades 7-14 Class Time Required: 1 period (50 minutes) Biological Sciences Initiative HHMI Gel Electrophoresis Teacher Instructions Suggested Grade Level: Grades 7-14 Class Time Required: 1 period (50 minutes) EQUIPMENT AND MATERIALS NEEDED (per group) Electrophoresis

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information


CLONING IN ESCHERICHIA COLI CLONING IN ESCHERICHIA COLI Introduction: In this laboratory, you will carry out a simple cloning experiment in E. coli. Specifically, you will first create a recombinant DNA molecule by carrying out a

More information

Cloning of genes from genomic DNA: Part 3-Restriction Enzyme Digestion and Agarose Gel Electrophoresis

Cloning of genes from genomic DNA: Part 3-Restriction Enzyme Digestion and Agarose Gel Electrophoresis Cloning of genes from genomic DNA: Part 3-Restriction Enzyme Digestion and Agarose Gel Electrophoresis Continuing from our isolation of genomic DNA and PCR amplification of either the evenskipped gene

More information


STANDARD OPERATING PROCEDURE STANDARD OPERATING PROCEDURE Title: Evaluation using Western Blot SOP#: M-103 Version #: 1 Author: R. Saul Date Approved: Feb. 5, 2009 Date Modified: 1. PURPOSE The purpose of this document is to describe

More information

DNA Worksheet BIOL 1107L DNA

DNA Worksheet BIOL 1107L DNA Worksheet BIOL 1107L Name Day/Time Refer to Chapter 5 and Chapter 16 (Figs. 16.5, 16.7, 16.8 and figure embedded in text on p. 310) in your textbook, Biology, 9th Ed, for information on and its structure

More information

Affinity Chromatography

Affinity Chromatography PR100-02 G-Biosciences 1-800-628-7730 1-314-991-6034 A Geno Technology, Inc. (USA) brand name Affinity Chromatography Teacher s Guidebook (Cat. # BE-417) think proteins! think

More information

Enzymes: Amylase Activity in Starch-degrading Soil Isolates

Enzymes: Amylase Activity in Starch-degrading Soil Isolates Enzymes: Amylase Activity in Starch-degrading Soil Isolates Introduction This week you will continue our theme of industrial microbiologist by characterizing the enzyme activity we selected for (starch

More information


Microbiology Laboratory: MOLECULAR IDENTIFICATION OF UNKNOWN BACTERIA Microbiology Laboratory: MOLECULAR IDENTIFICATION OF UNKNOWN BACTERIA Classical Microbiology courses are typically structured to introduce the identification of bacterial species using a series of biochemical

More information

Bacterial Transformation with Green Fluorescent Protein. Table of Contents Fall 2012

Bacterial Transformation with Green Fluorescent Protein. Table of Contents Fall 2012 Bacterial Transformation with Green Fluorescent Protein pglo Version Table of Contents Bacterial Transformation Introduction..1 Laboratory Exercise...3 Important Laboratory Practices 3 Protocol...... 4

More information

Western Blotting. Prepare samples:

Western Blotting. Prepare samples: Western Blotting Sive Lab Protocol March 2007 Prepare samples: For zebrafish embryos: Option 1: Take live embryos and put into 1.5 ml tube with E3. Centrifuge gently for 1-2 minutes -yolk lipids will rise

More information

Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides

Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides Polyacrylamide gel electrophoresis (PAGE) and subsequent analyses are common tools in biochemistry and molecular biology. This Application

More information

Cloning GFP into Mammalian cells

Cloning GFP into Mammalian cells Protocol for Cloning GFP into Mammalian cells Studiepraktik 2013 Molecular Biology and Molecular Medicine Aarhus University Produced by the instructors: Tobias Holm Bønnelykke, Rikke Mouridsen, Steffan

More information

DNA Replication Activity Guide

DNA Replication Activity Guide DNA Replication Activity Guide Teacher Key Deoxyribonucleic Acid (DNA) Exploring DNA 1. List at least three reasons why a cell must undergo division. Answers may vary but may include: growth, repair, reproduction,

More information

Use of Micropipettes

Use of Micropipettes Use of Micropipettes Prior to lab you should understand: The function of micropipettes in the laboratory Basic parts of micropipette What volumes are measured with P, P and P1 micopipettors How to read

More information

12.1 Identifying the Substance of Genes

12.1 Identifying the Substance of Genes 12.1 Identifying the Substance of Genes Lesson Objectives Summarize the process of bacterial transformation. Describe the role of bacteriophages in identifying genetic material. Identify the role of DNA

More information



More information

PTC DNA Fingerprint Gel

PTC DNA Fingerprint Gel BIO 141 PTC DNA Fingerprint Analysis (Modified 3/14) PTC DNA Fingerprint Gel taster non- non- non- non- 100 bp taster taster taster taster taster taster taster ladder Tt tt Tt TT tt tt Tt tt 500 bp 300

More information

Denaturing Gradient Gel Electrophoresis (DGGE)

Denaturing Gradient Gel Electrophoresis (DGGE) Laboratory for Microbial Ecology Department of Earth, Ecological and Environmental Sciences University of Toledo Denaturing Gradient Gel Electrophoresis (DGGE) Background information Denaturing gradient

More information

SDS-PAGE Protocol Mutated from the SDS-PAGE protocol written by the Lord of the Flies

SDS-PAGE Protocol Mutated from the SDS-PAGE protocol written by the Lord of the Flies SDS-PAGE Protocol Mutated from the SDS-PAGE protocol written by the Lord of the Flies Pouring the resolving gel 1. Clean glass plates with soap and water, then with ethanol. Assemble the glass plates and

More information

Bacterial Transformation with Green Fluorescent Protein. pgfp Version. Table of Contents Fall 2012

Bacterial Transformation with Green Fluorescent Protein. pgfp Version. Table of Contents Fall 2012 Bacterial Transformation with Green Fluorescent Protein pgfp Version Table of Contents Bacterial Transformation Introduction..1 Laboratory Exercise...3 Important Laboratory Practices 3 Protocol...... 4

More information

DNA Paper Model Activity Level: Grade 6-8

DNA Paper Model Activity Level: Grade 6-8 Karen Mayes DNA Paper Model Activity Level: Grade 6-8 Students will be able to: 1. Identify the component molecules of DNA. 2. Construct a model of the DNA double-helix. 3. Identify which bases are found

More information

Green Fluorescent Protein (GFP): Genetic Transformation, Synthesis and Purification of the Recombinant Protein

Green Fluorescent Protein (GFP): Genetic Transformation, Synthesis and Purification of the Recombinant Protein Green Fluorescent Protein (GFP): Genetic Transformation, Synthesis and Purification of the Recombinant Protein INTRODUCTION Green Fluorescent Protein (GFP) is a novel protein produced by the bioluminescent

More information

Bio 6 Restriction Enzyme Digestion Lab

Bio 6 Restriction Enzyme Digestion Lab Bio 6 Restriction Enzyme Digestion Lab Objectives Upon completion of this laboratory you will understand how to: 1) set up and carry out a restriction enzyme digest of DNA, 2) carry out agarose gel electrophoresis

More information

DNA is found in all organisms from the smallest bacteria to humans. DNA has the same composition and structure in all organisms!

DNA is found in all organisms from the smallest bacteria to humans. DNA has the same composition and structure in all organisms! Biological Sciences Initiative HHMI DNA omponents and Structure Introduction Nucleic acids are molecules that are essential to, and characteristic of, life on Earth. There are two basic types of nucleic

More information

Lab # 12: DNA and RNA

Lab # 12: DNA and RNA 115 116 Concepts to be explored: Structure of DNA Nucleotides Amino Acids Proteins Genetic Code Mutation RNA Transcription to RNA Translation to a Protein Figure 12. 1: DNA double helix Introduction Long

More information

An In-Gel Digestion Protocol

An In-Gel Digestion Protocol An In-Gel Digestion Protocol This protocol describes the digestion of a protein present in an SDS-PAGE gel band with trypsin. The band can be taken from either a 1D or 2D electrophoresis gel. Reagents

More information

Protein expression in the life cycle of bean beetles (Callosobruchus maculatus)

Protein expression in the life cycle of bean beetles (Callosobruchus maculatus) Protein expression in the life cycle of bean beetles (Callosobruchus maculatus) Pre laboratory Preparation Instructor s Notes You will need a number of cultures of bean beetles at various life stages.

More information


PAPER CHROMATOGRAPHY PAPER CHROMATOGRAPHY INTRODUCTION Chromatography is a technique that is used to separate and to identify components of a mixture. This analytical technique has a wide range of applications in the real

More information

DNA 1 2. I. Extracting DNA from Your Cells

DNA 1 2. I. Extracting DNA from Your Cells DNA 1 2 I. Extracting DNA from Your Cells Each cell in your body has a nucleus with multiple chromosomes. Each chromosome contains a DNA molecule. Each cell is surrounded by a cell membrane that regulates

More information

Modeling DNA Replication and Protein Synthesis

Modeling DNA Replication and Protein Synthesis Skills Practice Lab Modeling DNA Replication and Protein Synthesis OBJECTIVES Construct and analyze a model of DNA. Use a model to simulate the process of replication. Use a model to simulate the process

More information

How Does a Genetic Counselor Detect Mutant Genes? SECTION E. How Genes and the Environment Influence Our Health CHAPTER 3

How Does a Genetic Counselor Detect Mutant Genes? SECTION E. How Genes and the Environment Influence Our Health CHAPTER 3 CHAPTER 3 How Genes and the Environment Influence Our Health SECTION E How Does a Genetic Counselor Detect Mutant Genes? Chapter 3 Modern Genetics for All Students T 211 Chapter 3: Section E Background

More information

Module 3: Strawberry DNA Extraction

Module 3: Strawberry DNA Extraction Module 3: Strawberry DNA Extraction Teacher/Leader Target Audience: 7-12 Life Science, Biology, Ag Science Overview: In this lab, students will extract DNA from a strawberry using everyday materials and

More information



More information

Biotechnology Explorer

Biotechnology Explorer Biotechnology Explorer Chromosome 16: PV92 PCR Informatics Kit Catalog #166-2100EDU Note: Kit contains temperature-sensitive reagents. Open immediately upon arrival and store components

More information

Plant Genomic DNA Extraction using CTAB

Plant Genomic DNA Extraction using CTAB Plant Genomic DNA Extraction using CTAB Introduction The search for a more efficient means of extracting DNA of both higher quality and yield has lead to the development of a variety of protocols, however

More information

6 H2O + 6 CO 2 (g) + energy

6 H2O + 6 CO 2 (g) + energy AEROBIC RESPIRATION LAB DO 2.CALC From Biology with Calculators, Vernier Software & Technology, 2000. INTRODUCTION Aerobic cellular respiration is the process of converting the chemical energy of organic

More information

EZ-PAGE Electrophoresis System USER MANUAL

EZ-PAGE Electrophoresis System USER MANUAL EZ-PAGE Electrophoresis System USER MANUAL Table of Contents Safety Information.. 2 Product Description... 2 Product Contents..... 3 Specifications & Storage Conditions.. 3 Product Use..... 3 Getting Started

More information

Activity IT S ALL RELATIVES The Role of DNA Evidence in Forensic Investigations

Activity IT S ALL RELATIVES The Role of DNA Evidence in Forensic Investigations Activity IT S ALL RELATIVES The Role of DNA Evidence in Forensic Investigations SCENARIO You have responded, as a result of a call from the police to the Coroner s Office, to the scene of the death of

More information

The Chinese University of Hong Kong School of Life Sciences Biochemistry Program CUGEN Ltd.

The Chinese University of Hong Kong School of Life Sciences Biochemistry Program CUGEN Ltd. The Chinese University of Hong Kong School of Life Sciences Biochemistry Program CUGEN Ltd. DNA Forensic and Agarose Gel Electrophoresis 1 OBJECTIVES Prof. Stephen K.W. Tsui, Dr. Patrick Law and Miss Fion

More information

7 Electrophoresis. µ proportional to Q

7 Electrophoresis. µ proportional to Q 7 Electrophoresis Objectives: A) To perform agarose gel electrophoresis of the proteins isolated in last week's experiment and B) to interpret the banding patterns produced by these proteins. Introduction:

More information

UltraClean PCR Clean-Up Kit

UltraClean PCR Clean-Up Kit UltraClean PCR Clean-Up Kit Catalog No. Quantity 12500-50 50 Preps 12500-100 100 Preps 12500-250 250 Preps Instruction Manual Please recycle Version: 02212013 1 Table of Contents Introduction... 3 Protocol

More information

Animal & Plant Cell Slides

Animal & Plant Cell Slides Animal & Plant Cell Slides Category: Biology Type: Class Experiment, 60 min class Materials: 2 Glass Slides 2 Cover Slips 1 Bottle of methylene blue (optional) 1 Plastic tray 1 Bottle of iodine 1 Plastic

More information

IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR)

IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) Background Infectious diseases caused by pathogenic organisms such as bacteria, viruses, protozoa,

More information

Amino Acids, Peptides, and Proteins

Amino Acids, Peptides, and Proteins 1 Amino Acids, Peptides, and Proteins Introduction Amino Acids Amino acids are the building blocks of proteins. In class you learned the structures of the 20 common amino acids that make up proteins. All

More information

UltraClean Forensic DNA Isolation Kit (Single Prep Format)

UltraClean Forensic DNA Isolation Kit (Single Prep Format) UltraClean Forensic DNA Isolation Kit (Single Prep Format) Catalog No. Quantity 14000-10 10 preps 14000-S 1 prep Instruction Manual Please recycle Version: 10302012 1 Table of Contents Introduction...

More information


Luminol Test PROCESS SKILLS SCIENCE TOPICS VOCABULARY EXPERIMENT: LUMINOL TEST Luminol Test Visitors mix a solution of luminol with fake blood (hydrogen peroxide) to produce a reaction that gives off blue light. OBJECTIVES: Visitors learn that some chemical

More information

Make a model DNA strand

Make a model DNA strand Make a model DNA strand Summary A strand of DNA looks like a ladder that has been twisted into a corkscrew. Just like a ladder, a DNA strand has two rails running parallel to each other and rungs that

More information

Mitochondrial DNA Analysis

Mitochondrial DNA Analysis Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)

More information

DNA and Forensic Science

DNA and Forensic Science DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

Innocent or Guilty: A Lab on DNA Gel Electrophoresis JoAnn Smith, California Studio Teacher, North Hills, CA

Innocent or Guilty: A Lab on DNA Gel Electrophoresis JoAnn Smith, California Studio Teacher, North Hills, CA Innocent or Guilty: A Lab on DNA Gel Electrophoresis JoAnn Smith, California Studio Teacher, North Hills, CA INTRODUCTION Description This lesson, based on EDVOTEK Kit #109, DNA Fingerprinting I: Identification

More information

BotanoTech: A Comparative Plant Genomics Module

BotanoTech: A Comparative Plant Genomics Module BotanoTech: A Comparative Plant Genomics Module Students imagine themselves as employees of a (fictitious) San Diego Biotech Company Botanotech. The company develops anti-cancer medications and has identified

More information

PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200

PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System)

More information

PCR Optimization. Table of Contents Fall 2012

PCR Optimization. Table of Contents Fall 2012 Table of Contents Optimizing the Polymerase Chain Reaction Introduction.....1 Review of Mathematics........ 3 Solving Problems of Dilution and Concentration: Two Approaches.. 4 Experiment Overview 7 Calculations

More information

Olympic B3 Summer Science Camp 2015 Weller, Smith, Putnam L3

Olympic B3 Summer Science Camp 2015 Weller, Smith, Putnam L3 Chestnut Leaf DNA Extraction Protocol Introduction: we will extract the nucleic acid from leaf tissue by grinding it in a reducing medium (the beta-mercaptoethanol chemical is a reducing agent, it smells

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

PLB161A Laboratory XI a Genome Mapping

PLB161A Laboratory XI a Genome Mapping PLB161A Laboratory XI a Genome Mapping Restriction Digests and Agarose Gel Electrophoresis of Genomic DNA. A. Restriction Digests. Introduction Restriction enzymes are a class of DNA endonucleases, which

More information

DNA. Discovery of the DNA double helix

DNA. Discovery of the DNA double helix DNA Replication DNA Discovery of the DNA double helix A. 1950 s B. Rosalind Franklin - X-ray photo of DNA. C. Watson and Crick - described the DNA molecule from Franklin s X-ray. What is DNA? Question:

More information

Western Blotting. USA: UK & Europe: China:

Western Blotting. USA: UK & Europe: China: Western Blotting All steps are carried out at room temperature unless otherwise indicated. Recipes for all solutions highlighted bold are included at the end of the protocol. SDS-PAGE 1. Construct an SDS-PAGE

More information

Teacher Guide: Have Your DNA and Eat It Too ACTIVITY OVERVIEW.

Teacher Guide: Have Your DNA and Eat It Too ACTIVITY OVERVIEW. ACTIVITY OVERVIEW Abstract: Students build an edible model of DNA while learning basic DNA structure and the rules of base pairing. Module: The Basics and Beyond Prior Knowledge Needed: DNA contains heritable

More information

Forensic Science TEKS/LINKS Student Objectives One Credit

Forensic Science TEKS/LINKS Student Objectives One Credit First Six Weeks Intro/Observation FS 4(A) The student will distinguish between forensic science and criminalistics in law, public safety, corrections, and security. FS 5(D) The student will apply knowledge

More information

Western Blotting: Mini-gels

Western Blotting: Mini-gels Western Blotting: Mini-gels Materials a Protein Extraction Buffer (for callus or kernel), Solution Stock Final Volume Tris-HCl ph 80 1 M 200 mm 20 ml NaCl 4 M 100 mm 25 ml Sucrose 2 M 400 mm 20 ml EDTA

More information

Evaluation copy. Enzyme Action: Testing Catalase Activity (Method 1 O 2 Gas Sensor) Computer 2

Evaluation copy. Enzyme Action: Testing Catalase Activity (Method 1 O 2 Gas Sensor) Computer 2 Enzyme Action: Testing Catalase Activity (Method 1 O 2 Gas Sensor) Computer 2 Many organisms can decompose hydrogen peroxide (H 2 O 2 ) enzymatically. Enzymes are globular proteins, responsible for most

More information