Improving MAKER Gene Annotations in Grasses through the Use of GC Specific Hidden Markov Models

Size: px
Start display at page:

Download "Improving MAKER Gene Annotations in Grasses through the Use of GC Specific Hidden Markov Models"

Transcription

1 Improving MAKER Gene Annotations in Grasses through the Use of GC Specific Hidden Markov Models Megan Bowman Childs Lab Bioinformatics Seminar 22 April 2015

2 Outline GC content in plant genomes Codon usage Bioinformatics strategy MAKER Creation of GC specific HMM training datasets Results Ongoing work

3 GC content of plant genomes GC content varies among species and phylogeny impacts variation Recombination, expression level and replication may correlate with GC content Positive selection should result in high levels of codon bias and low rates of synonymous substitution Bimodal GC distribution in grasses, 5 3 GC gradient Plants are much more complicated, monocots have higher GC content than dicots and they show variation in codon usage Serres-Giardi et al., Plant Cell 2012

4 Why look at codon usage? Codon usage is linked to: Transcriptional selection Translation efficiency Gene expression GC content AA conservation Protein hydropathicity RNA stability Adaption to habitat Jane Pulman

5 CodonW Written by John Peden as part of his thesis Command line and GUI menu based Several issues Creates codon tables, determines optimal codons, COA analysis, CAI, N c, CBI, Fop, GRAVY, GC, GC3. Jane Pulman

6 Codon table Jane Pulman

7 GC3 Wobble position in codons is a marker for GC richness

8 How does GC impact genome annotation? Very likely that we miss gene models Prediction based on abinitio programs = HMMs Abinitio programs require training data sets for accurate gene prediction Nucleotide content of training set influences prediction Missing gene models with varying GC content that may have important functions in plants

9 Rapid divergence of codon usage patterns Wang and Hickley, BMC Evolutionary Biology 2007, 7(Suppl 1):S6 Jane Pulman

10 Hidden Markov Models (HMMs) HMMs are the Legos of computational sequence analysis Sean Eddy, Nature Biotechnology 2004

11 AUGUSTUS HMM

12 Bioinformatics strategy ü Reannotation of rice genome (Oryza sativa L. ssp japonica cv. Nipponbare) MSU v7 genome using MAKER ü Calculate distribution of GC content across all evidence supported predicted gene models ü Develop code to create new HMM training sets with extreme high and low GC content ü Retrain HMMs for abinito prediction programs with high and low GC sets ü MAKER annotations using high and low GC HMMs ü Identify newly predicted gene models and improve existing gene models ü Combine original, high and low GC annotations for new annotation

13 MAKER What are advantages to using MAKER for structural genome annotation? Masks repeats Aligns ESTs/RNA-seq assemblies and proteins to genome Guides abinitio gene predictors (Ex: SNAP and AUGUSTUS) Combines these into a final annotation Provides quality values for predicted gene models (AED Score)

14 Annotation Edit Distance (AED) Collapsed Evidence SN SP AED Perfect Accuracy Poor Specificity Poor Sensitivity Poor Specificity and Sensitivity Kevin Childs Eilbeck et al BMC Bioinformatics :67

15 Michael Campbell MAKER-Standard - Evidence - Pfam - Evidence + Pfam MAKER Max + Evidence + Pfam MAKER Default MAKER Standard + Evidence - Pfam

16 Training HMMs and GC content Does GC content impact the training of the SNAP and AUGUSTUS HMMs? Would we predict new gene models if the average GC content of the training set used for HMM training was either higher or lower than normal? Can we add additional evidence to gene models using these new HMMs, or identify new gene models not previously found?

17 MAKER Annotation Reannotation of the MSU Rice v7 genome assembly Transcript Evidence Fifty SRA datasets Read cleaning and QC with FastQC and Cutadapt Transcript assembly with Trinity Trained SNAP and AUGUSTUS HMMs MAKER with default parameters Iprscan hmmscan Pfam for MAKER standard

18 Improving MAKER models based on GC distribution GC distribution of Maker Standard Models 4 3 Gene Frequency GC Content

19 Creation of GC Specific HMM Training Datasets Perl Scripts: MAKER Standard GFF3 and genome FASTA file Determines GC percentage and bins GC to integers over a user defined window on each side Creates FASTA files and GFF3s of high and low GC maker standard genes for HMM training GFF3 is input for SNAP abinitio gene prediction program (maker2zff)

20 Workflow Align Transcripts to Genome with MAKER Calculate Lower Threshold GC Content of Aligned Transcripts Use Transcripts with Regular GC Distribution Calculate Upper Threshold GC Content of Aligned Transcripts Train SNAP/Run MAKER with Lower GC Content Train SNAP/Run MAKER Train SNAP/Run MAKER with Upper GC Content Use SNAP Gene Predictions with Lower GC Content Use SNAP Gene Predictions with Regular GC Distribution Use SNAP Gene Predictions with Upper GC Content Train Augustus with Lower GC Gene Predictions Train Augustus with Regular GC Gene Predictions Train Augustus with Upper GC Gene Predictions MAKER Annotation with Lower GC HMMs MAKER Annotation with Regular GC HMMs MAKER Annotation with Upper GC HMMs Rerun MAKER Annotation with Regular GC HMMs and Predictions from Lower and Upper GC HMMs; MAKER Retains the Best Annotations

21 MAKER Annotation Comparative AED Curves Total Number of Transcripts AED combo high low original

22 Unique gene models AED Scores of New High GC Gene Models AED Scores of New Low GC Gene Models factor(high_names) factor(low_names) Count < AED <= < AED <= < AED < 1 AED <=.25 AED = 1 Count.25 < AED <= < AED <= < AED < 1 AED <=.25 AED = AED <= < AED <= < AED <= < AED < 1 AED = 1 AED Scores AED <= < AED <= < AED <= < AED < 1 AED = 1 AED Scores 1598 new gene models, 25,168 improved models (Decrease in AED score)

23 GC Distribution GC Distribution 7.5 Gene Frequency GC Content high high only low low only original

24 Codon usage original Jane Pulman

25 Codon usage low new models Jane Pulman

26 Codon usage high new models Jane Pulman

27 The effective number of codons!! = 2 + 9!! + 1!! + 5!! + 3!!! F i is the average homozygosity estimated for SF type i. 2 is the N c for M and Try as they are always 1. 9,1,5 and 3 are the number of AA of that type. So for example there are 9 AA that have 2 synonymous codons. Jane Pulman

28 Nc Plot Original Jane Pulman

29 Nc Plot Low New Models Jane Pulman

30 Nc Plot High New Models Jane Pulman

31 Position on first and second axis for High and Low GC new models Jane Pulman

32 Ongoing work Functional annotation of new genes Orthologs of new genes in other species Paralogs of new genes Comparison of MAKER annotations with full length cdnas Comparison of results to randomized training sets Expression analysis of high and low GC genes Tissue specific GC content and codon usage analyses

33 Conclusions High and low GC content gene models may be missed by using current HMM training methods Developed a pipeline for the creation of high and low GC content training data sets for existing gene prediction programs MAKER reannotation of MSU rice genome with high and low GC HMMs Identify over 1500 new gene models specific to high and low GC specific annotations Codon usage bias with high and low GC gene models

Bioinformatics Grid - Enabled Tools For Biologists.

Bioinformatics Grid - Enabled Tools For Biologists. Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis

More information

Introduction to NGS data analysis

Introduction to NGS data analysis Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

A Web Based Software for Synonymous Codon Usage Indices

A Web Based Software for Synonymous Codon Usage Indices International Journal of Information and Computation Technology. ISSN 0974-2239 Volume 3, Number 3 (2013), pp. 147-152 International Research Publications House http://www. irphouse.com /ijict.htm A Web

More information

Hidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006

Hidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006 Hidden Markov Models in Bioinformatics By Máthé Zoltán Kőrösi Zoltán 2006 Outline Markov Chain HMM (Hidden Markov Model) Hidden Markov Models in Bioinformatics Gene Finding Gene Finding Model Viterbi algorithm

More information

Module 1. Sequence Formats and Retrieval. Charles Steward

Module 1. Sequence Formats and Retrieval. Charles Steward The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.

More information

DnaSP, DNA polymorphism analyses by the coalescent and other methods.

DnaSP, DNA polymorphism analyses by the coalescent and other methods. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Author affiliation: Julio Rozas 1, *, Juan C. Sánchez-DelBarrio 2,3, Xavier Messeguer 2 and Ricardo Rozas 1 1 Departament de Genètica,

More information

17 July 2014 WEB-SERVER MANUAL. Contact: Michael Hackenberg ([email protected])

17 July 2014 WEB-SERVER MANUAL. Contact: Michael Hackenberg (hackenberg@ugr.es) WEB-SERVER MANUAL Contact: Michael Hackenberg ([email protected]) 1 1 Introduction srnabench is a free web-server tool and standalone application for processing small- RNA data obtained from next generation

More information

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

Core Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1

Core Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1 Core Bioinformatics 2014/2015 Code: 42397 ECTS Credits: 12 Degree Type Year Semester 4313473 Bioinformàtica/Bioinformatics OB 0 1 Contact Name: Sònia Casillas Viladerrams Email: [email protected]

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]

More information

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Focusing on results not data comprehensive data analysis for targeted next generation sequencing Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes

More information

BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis

BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis By the end of this lab students should be able to: Describe the uses for each line of the DNA subway program (Red/Yellow/Blue/Green) Describe

More information

Tutorial for proteome data analysis using the Perseus software platform

Tutorial for proteome data analysis using the Perseus software platform Tutorial for proteome data analysis using the Perseus software platform Laboratory of Mass Spectrometry, LNBio, CNPEM Tutorial version 1.0, January 2014. Note: This tutorial was written based on the information

More information

ADVANCES IN BOTANICAL RESEARCH

ADVANCES IN BOTANICAL RESEARCH o >VOLUME SIXTY NINE ADVANCES IN BOTANICAL RESEARCH Genomes of Herbaceous Land Plants Volume Editor ANDREW H. PATERSON Plant Genome Mapping Laboratory Department of Crop and Soil Sciences, Department of

More information

Evolutionary Bioinformatics. EvoPipes.net: Bioinformatic Tools for Ecological and Evolutionary Genomics

Evolutionary Bioinformatics. EvoPipes.net: Bioinformatic Tools for Ecological and Evolutionary Genomics Evolutionary Bioinformatics Short Report Open Access Full open access to this and thousands of other papers at http://www.la-press.com. EvoPipes.net: Bioinformatic Tools for Ecological and Evolutionary

More information

Current Motif Discovery Tools and their Limitations

Current Motif Discovery Tools and their Limitations Current Motif Discovery Tools and their Limitations Philipp Bucher SIB / CIG Workshop 3 October 2006 Trendy Concepts and Hypotheses Transcription regulatory elements act in a context-dependent manner.

More information

Biological Sequence Data Formats

Biological Sequence Data Formats Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: [email protected]

PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,

More information

Pairwise Sequence Alignment

Pairwise Sequence Alignment Pairwise Sequence Alignment [email protected] SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What

More information

A Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML

A Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML 9 June 2011 A Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML by Jun Inoue, Mario dos Reis, and Ziheng Yang In this tutorial we will analyze

More information

Visualization of Phylogenetic Trees and Metadata

Visualization of Phylogenetic Trees and Metadata Visualization of Phylogenetic Trees and Metadata November 27, 2015 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com [email protected]

More information

GenBank, Entrez, & FASTA

GenBank, Entrez, & FASTA GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,

More information

(http://genomes.urv.es/caical) TUTORIAL. (July 2006)

(http://genomes.urv.es/caical) TUTORIAL. (July 2006) (http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS

More information

Recombinant DNA and Biotechnology

Recombinant DNA and Biotechnology Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study

More information

Bio-Informatics Lectures. A Short Introduction

Bio-Informatics Lectures. A Short Introduction Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

Human-Mouse Synteny in Functional Genomics Experiment

Human-Mouse Synteny in Functional Genomics Experiment Human-Mouse Synteny in Functional Genomics Experiment Ksenia Krasheninnikova University of the Russian Academy of Sciences, JetBrains [email protected] September 18, 2012 Ksenia Krasheninnikova

More information

Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes

Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes 2.1 Introduction Large-scale insertional mutagenesis screening in

More information

Overview of Eukaryotic Gene Prediction

Overview of Eukaryotic Gene Prediction Overview of Eukaryotic Gene Prediction CBB 231 / COMPSCI 261 W.H. Majoros What is DNA? Nucleus Chromosome Telomere Centromere Cell Telomere base pairs histones DNA (double helix) DNA is a Double Helix

More information

Genome Viewing. Module 2. Using Genome Browsers to View Annotation of the Human Genome

Genome Viewing. Module 2. Using Genome Browsers to View Annotation of the Human Genome Module 2 Genome Viewing Using Genome Browsers to View Annotation of the Human Genome Bert Overduin, Ph.D. PANDA Coordination & Outreach EMBL - European Bioinformatics Institute Wellcome Trust Genome Campus

More information

RNA- seq de novo ABiMS

RNA- seq de novo ABiMS RNA- seq de novo ABiMS Cleaning 1. import des données d'entrée depuis Data Libraries : Shared Data Data Libraries RNA- seq de- novo 2. lancement des programmes de nettoyage pas à pas BlueLight.sample.read1.fastq

More information

Introduction to Genome Annotation

Introduction to Genome Annotation Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

MORPHEUS. http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix.

MORPHEUS. http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix. MORPHEUS http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix. Reference: MORPHEUS, a Webtool for Transcripton Factor Binding Analysis Using

More information

A Tutorial in Genetic Sequence Classification Tools and Techniques

A Tutorial in Genetic Sequence Classification Tools and Techniques A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University [email protected] www.jakemdrew.com Sequence Characters IUPAC nucleotide

More information

AP Biology Essential Knowledge Student Diagnostic

AP Biology Essential Knowledge Student Diagnostic AP Biology Essential Knowledge Student Diagnostic Background The Essential Knowledge statements provided in the AP Biology Curriculum Framework are scientific claims describing phenomenon occurring in

More information

Step-by-Step Guide to Bi-Parental Linkage Mapping WHITE PAPER

Step-by-Step Guide to Bi-Parental Linkage Mapping WHITE PAPER Step-by-Step Guide to Bi-Parental Linkage Mapping WHITE PAPER JMP Genomics Step-by-Step Guide to Bi-Parental Linkage Mapping Introduction JMP Genomics offers several tools for the creation of linkage maps

More information

European Medicines Agency

European Medicines Agency European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein

More information

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

Guide for Bioinformatics Project Module 3

Guide for Bioinformatics Project Module 3 Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first

More information

SeattleSNPs Interactive Tutorial: Web Tools for Site Selection, Linkage Disequilibrium and Haplotype Analysis

SeattleSNPs Interactive Tutorial: Web Tools for Site Selection, Linkage Disequilibrium and Haplotype Analysis SeattleSNPs Interactive Tutorial: Web Tools for Site Selection, Linkage Disequilibrium and Haplotype Analysis Goal: This tutorial introduces several websites and tools useful for determining linkage disequilibrium

More information

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want 1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

CD-HIT User s Guide. Last updated: April 5, 2010. http://cd-hit.org http://bioinformatics.org/cd-hit/

CD-HIT User s Guide. Last updated: April 5, 2010. http://cd-hit.org http://bioinformatics.org/cd-hit/ CD-HIT User s Guide Last updated: April 5, 2010 http://cd-hit.org http://bioinformatics.org/cd-hit/ Program developed by Weizhong Li s lab at UCSD http://weizhong-lab.ucsd.edu [email protected] 1. Introduction

More information

A new type of Hidden Markov Models to predict complex domain architecture in protein sequences

A new type of Hidden Markov Models to predict complex domain architecture in protein sequences A new type of Hidden Markov Models to predict complex domain architecture in protein sequences Raluca Uricaru, Laurent Bréhélin and Eric Rivals LIRMM, CNRS Université de Montpellier 2 14 Juin 2007 Raluca

More information

Analyzing A DNA Sequence Chromatogram

Analyzing A DNA Sequence Chromatogram LESSON 9 HANDOUT Analyzing A DNA Sequence Chromatogram Student Researcher Background: DNA Analysis and FinchTV DNA sequence data can be used to answer many types of questions. Because DNA sequences differ

More information

An introduction to bioinformatic tools for population genomic and metagenetic data analysis, 2.5 higher education credits Third Cycle

An introduction to bioinformatic tools for population genomic and metagenetic data analysis, 2.5 higher education credits Third Cycle An introduction to bioinformatic tools for population genomic and metagenetic data analysis, 2.5 higher education credits Third Cycle Faculty of Science; Department of Marine Sciences The Swedish Royal

More information

Gene Finding CMSC 423

Gene Finding CMSC 423 Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher

More information

Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003

Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Similarity Searches on Sequence Databases: BLAST, FASTA Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Outline Importance of Similarity Heuristic Sequence Alignment:

More information

UGENE Quick Start Guide

UGENE Quick Start Guide Quick Start Guide This document contains a quick introduction to UGENE. For more detailed information, you can find the UGENE User Manual and other special manuals in project website: http://ugene.unipro.ru.

More information

SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE

SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,

More information

2.3 Identify rrna sequences in DNA

2.3 Identify rrna sequences in DNA 2.3 Identify rrna sequences in DNA For identifying rrna sequences in DNA we will use rnammer, a program that implements an algorithm designed to find rrna sequences in DNA [5]. The program was made by

More information

SGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD

SGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD White Paper SGI High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems Haruna Cofer*, PhD January, 2012 Abstract The SGI High Throughput Computing (HTC) Wrapper

More information

Gene Models & Bed format: What they represent.

Gene Models & Bed format: What they represent. GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,

More information

Comparing Methods for Identifying Transcription Factor Target Genes

Comparing Methods for Identifying Transcription Factor Target Genes Comparing Methods for Identifying Transcription Factor Target Genes Alena van Bömmel (R 3.3.73) Matthew Huska (R 3.3.18) Max Planck Institute for Molecular Genetics Folie 1 Transcriptional Regulation TF

More information

Introduction to Phylogenetic Analysis

Introduction to Phylogenetic Analysis Subjects of this lecture Introduction to Phylogenetic nalysis Irit Orr 1 Introducing some of the terminology of phylogenetics. 2 Introducing some of the most commonly used methods for phylogenetic analysis.

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

G E N OM I C S S E RV I C ES

G E N OM I C S S E RV I C ES GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E

More information

Castillo et al. Rice Archaeogenetics electronic supplementary information

Castillo et al. Rice Archaeogenetics electronic supplementary information Castillo et al. Rice Archaeogenetics electronic supplementary information Figure S1: PCR amplification for the nuclear genome region Sh4; and the sequence analysis. (a) Electrophoresis of 10 PCR products

More information

Frequently Asked Questions Next Generation Sequencing

Frequently Asked Questions Next Generation Sequencing Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided

More information

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,

More information

T cell Epitope Prediction

T cell Epitope Prediction Institute for Immunology and Informatics T cell Epitope Prediction EpiMatrix Eric Gustafson January 6, 2011 Overview Gathering raw data Popular sources Data Management Conservation Analysis Multiple Alignments

More information

GeneProf and the new GeneProf Web Services

GeneProf and the new GeneProf Web Services GeneProf and the new GeneProf Web Services Florian Halbritter [email protected] Stem Cell Bioinformatics Group (Simon R. Tomlinson) [email protected] December 10, 2012 Florian Halbritter

More information

UCHIME in practice Single-region sequencing Reference database mode

UCHIME in practice Single-region sequencing Reference database mode UCHIME in practice Single-region sequencing UCHIME is designed for experiments that perform community sequencing of a single region such as the 16S rrna gene or fungal ITS region. While UCHIME may prove

More information

Genome Explorer For Comparative Genome Analysis

Genome Explorer For Comparative Genome Analysis Genome Explorer For Comparative Genome Analysis Jenn Conn 1, Jo L. Dicks 1 and Ian N. Roberts 2 Abstract Genome Explorer brings together the tools required to build and compare phylogenies from both sequence

More information

Objectives. Raster Data Discrete Classes. Spatial Information in Natural Resources FANR 3800. Review the raster data model

Objectives. Raster Data Discrete Classes. Spatial Information in Natural Resources FANR 3800. Review the raster data model Spatial Information in Natural Resources FANR 3800 Raster Analysis Objectives Review the raster data model Understand how raster analysis fundamentally differs from vector analysis Become familiar with

More information

BAPS: Bayesian Analysis of Population Structure

BAPS: Bayesian Analysis of Population Structure BAPS: Bayesian Analysis of Population Structure Manual v. 6.0 NOTE: ANY INQUIRIES CONCERNING THE PROGRAM SHOULD BE SENT TO JUKKA CORANDER (first.last at helsinki.fi). http://www.helsinki.fi/bsg/software/baps/

More information

Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium

Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium I. Introduction: Sequence based assays of transcriptomes (RNA-seq) are in wide use because of their favorable

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

BIOINFORMATICS TUTORIAL

BIOINFORMATICS TUTORIAL Bio 242 BIOINFORMATICS TUTORIAL Bio 242 α Amylase Lab Sequence Sequence Searches: BLAST Sequence Alignment: Clustal Omega 3d Structure & 3d Alignments DO NOT REMOVE FROM LAB. DO NOT WRITE IN THIS DOCUMENT.

More information

Phylogenetic Trees Made Easy

Phylogenetic Trees Made Easy Phylogenetic Trees Made Easy A How-To Manual Fourth Edition Barry G. Hall University of Rochester, Emeritus and Bellingham Research Institute Sinauer Associates, Inc. Publishers Sunderland, Massachusetts

More information

BSCI222 Principles of Genetics Winter 2014 TENTATIVE

BSCI222 Principles of Genetics Winter 2014 TENTATIVE BSCI222 Principles of Genetics Winter 2014 Instructor: Dr. O Brien Office Hours: Office: 3118 Plant Sciences Building Email: [email protected] Phone: 301.405.1305 Please do not hesitate to come see me to

More information

SMRT Analysis v2.2.0 Overview. 1. SMRT Analysis v2.2.0. 1.1 SMRT Analysis v2.2.0 Overview. Notes:

SMRT Analysis v2.2.0 Overview. 1. SMRT Analysis v2.2.0. 1.1 SMRT Analysis v2.2.0 Overview. Notes: SMRT Analysis v2.2.0 Overview 100 338 400 01 1. SMRT Analysis v2.2.0 1.1 SMRT Analysis v2.2.0 Overview Welcome to Pacific Biosciences' SMRT Analysis v2.2.0 Overview 1.2 Contents This module will introduce

More information

Cloud-Based Big Data Analytics in Bioinformatics

Cloud-Based Big Data Analytics in Bioinformatics Cloud-Based Big Data Analytics in Bioinformatics Presented By Cephas Mawere Harare Institute of Technology, Zimbabwe 1 Introduction 2 Big Data Analytics Big Data are a collection of data sets so large

More information

A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques

A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques Proceedings of the 2007 WSEAS International Conference on Computer Engineering and Applications, Gold Coast, Australia, January 17-19, 2007 402 A Multiple DNA Sequence Translation Tool Incorporating Web

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

Yale Pseudogene Analysis as part of GENCODE Project

Yale Pseudogene Analysis as part of GENCODE Project Sanger Center 2009.01.20, 11:20-11:40 Mark B Gerstein Yale Illustra(on from Gerstein & Zheng (2006). Sci Am. (c) Mark Gerstein, 2002, (c) Yale, 1 1Lectures.GersteinLab.org 2007bioinfo.mbb.yale.edu Yale

More information

Final Project Report

Final Project Report CPSC545 by Introduction to Data Mining Prof. Martin Schultz & Prof. Mark Gerstein Student Name: Yu Kor Hugo Lam Student ID : 904907866 Due Date : May 7, 2007 Introduction Final Project Report Pseudogenes

More information

Vaxign Reverse Vaccinology Software Demo Introduction Zhuoshuang Allen Xiang, Yongqun Oliver He

Vaxign Reverse Vaccinology Software Demo Introduction Zhuoshuang Allen Xiang, Yongqun Oliver He Vaxign Reverse Vaccinology Software Demo Introduction Zhuoshuang Allen Xiang, Yongqun Oliver He Unit for Laboratory Animal Medicine Department of Microbiology and Immunology Center for Computational Medicine

More information

Linear Sequence Analysis. 3-D Structure Analysis

Linear Sequence Analysis. 3-D Structure Analysis Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical properties Molecular weight (MW), isoelectric point (pi), amino acid content, hydropathy (hydrophilic

More information

AS Biology Unit 2 Key Terms and Definitions. Make sure you use these terms when answering exam questions!

AS Biology Unit 2 Key Terms and Definitions. Make sure you use these terms when answering exam questions! AS Biology Unit 2 Key Terms and Definitions Make sure you use these terms when answering exam questions! Chapter 7 Variation 7.1 Random Sampling Sampling a population to eliminate bias e.g. grid square

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

Activity 7.21 Transcription factors

Activity 7.21 Transcription factors Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation

More information

Novel Mining of Cancer via Mutation in Tumor Protein P53 using Quick Propagation Network

Novel Mining of Cancer via Mutation in Tumor Protein P53 using Quick Propagation Network Novel Mining of Cancer via Mutation in Tumor Protein P53 using Quick Propagation Network Ayad. Ghany Ismaeel, and Raghad. Zuhair Yousif Abstract There is multiple databases contain datasets of TP53 gene

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

GC3 Use cases for the Cloud

GC3 Use cases for the Cloud GC3: Grid Computing Competence Center GC3 Use cases for the Cloud Some real world examples suited for cloud systems Antonio Messina Trieste, 24.10.2013 Who am I System Architect

More information

Gramene: Exploring Function through Comparative Genomics and Network Analysis Doreen H. Ware, Ph.D. United States Department of Agriculture ARS Cold

Gramene: Exploring Function through Comparative Genomics and Network Analysis Doreen H. Ware, Ph.D. United States Department of Agriculture ARS Cold Gramene: Exploring Function through Comparative Genomics and Network Analysis Doreen H. Ware, Ph.D. United States Department of Agriculture ARS Cold Spring Harbor Laboratory Gramene II Pankaj Jaiswal,

More information

Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS

Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS Lab 2/Phylogenetics/September 16, 2002 1 Read: Tudge Chapter 2 PHYLOGENETICS Objective of the Lab: To understand how DNA and protein sequence information can be used to make comparisons and assess evolutionary

More information