Improving MAKER Gene Annotations in Grasses through the Use of GC Specific Hidden Markov Models
|
|
- Christian Patterson
- 7 years ago
- Views:
Transcription
1 Improving MAKER Gene Annotations in Grasses through the Use of GC Specific Hidden Markov Models Megan Bowman Childs Lab Bioinformatics Seminar 22 April 2015
2 Outline GC content in plant genomes Codon usage Bioinformatics strategy MAKER Creation of GC specific HMM training datasets Results Ongoing work
3 GC content of plant genomes GC content varies among species and phylogeny impacts variation Recombination, expression level and replication may correlate with GC content Positive selection should result in high levels of codon bias and low rates of synonymous substitution Bimodal GC distribution in grasses, 5 3 GC gradient Plants are much more complicated, monocots have higher GC content than dicots and they show variation in codon usage Serres-Giardi et al., Plant Cell 2012
4 Why look at codon usage? Codon usage is linked to: Transcriptional selection Translation efficiency Gene expression GC content AA conservation Protein hydropathicity RNA stability Adaption to habitat Jane Pulman
5 CodonW Written by John Peden as part of his thesis Command line and GUI menu based Several issues Creates codon tables, determines optimal codons, COA analysis, CAI, N c, CBI, Fop, GRAVY, GC, GC3. Jane Pulman
6 Codon table Jane Pulman
7 GC3 Wobble position in codons is a marker for GC richness
8 How does GC impact genome annotation? Very likely that we miss gene models Prediction based on abinitio programs = HMMs Abinitio programs require training data sets for accurate gene prediction Nucleotide content of training set influences prediction Missing gene models with varying GC content that may have important functions in plants
9 Rapid divergence of codon usage patterns Wang and Hickley, BMC Evolutionary Biology 2007, 7(Suppl 1):S6 Jane Pulman
10 Hidden Markov Models (HMMs) HMMs are the Legos of computational sequence analysis Sean Eddy, Nature Biotechnology 2004
11 AUGUSTUS HMM
12 Bioinformatics strategy ü Reannotation of rice genome (Oryza sativa L. ssp japonica cv. Nipponbare) MSU v7 genome using MAKER ü Calculate distribution of GC content across all evidence supported predicted gene models ü Develop code to create new HMM training sets with extreme high and low GC content ü Retrain HMMs for abinito prediction programs with high and low GC sets ü MAKER annotations using high and low GC HMMs ü Identify newly predicted gene models and improve existing gene models ü Combine original, high and low GC annotations for new annotation
13 MAKER What are advantages to using MAKER for structural genome annotation? Masks repeats Aligns ESTs/RNA-seq assemblies and proteins to genome Guides abinitio gene predictors (Ex: SNAP and AUGUSTUS) Combines these into a final annotation Provides quality values for predicted gene models (AED Score)
14 Annotation Edit Distance (AED) Collapsed Evidence SN SP AED Perfect Accuracy Poor Specificity Poor Sensitivity Poor Specificity and Sensitivity Kevin Childs Eilbeck et al BMC Bioinformatics :67
15 Michael Campbell MAKER-Standard - Evidence - Pfam - Evidence + Pfam MAKER Max + Evidence + Pfam MAKER Default MAKER Standard + Evidence - Pfam
16 Training HMMs and GC content Does GC content impact the training of the SNAP and AUGUSTUS HMMs? Would we predict new gene models if the average GC content of the training set used for HMM training was either higher or lower than normal? Can we add additional evidence to gene models using these new HMMs, or identify new gene models not previously found?
17 MAKER Annotation Reannotation of the MSU Rice v7 genome assembly Transcript Evidence Fifty SRA datasets Read cleaning and QC with FastQC and Cutadapt Transcript assembly with Trinity Trained SNAP and AUGUSTUS HMMs MAKER with default parameters Iprscan hmmscan Pfam for MAKER standard
18 Improving MAKER models based on GC distribution GC distribution of Maker Standard Models 4 3 Gene Frequency GC Content
19 Creation of GC Specific HMM Training Datasets Perl Scripts: MAKER Standard GFF3 and genome FASTA file Determines GC percentage and bins GC to integers over a user defined window on each side Creates FASTA files and GFF3s of high and low GC maker standard genes for HMM training GFF3 is input for SNAP abinitio gene prediction program (maker2zff)
20 Workflow Align Transcripts to Genome with MAKER Calculate Lower Threshold GC Content of Aligned Transcripts Use Transcripts with Regular GC Distribution Calculate Upper Threshold GC Content of Aligned Transcripts Train SNAP/Run MAKER with Lower GC Content Train SNAP/Run MAKER Train SNAP/Run MAKER with Upper GC Content Use SNAP Gene Predictions with Lower GC Content Use SNAP Gene Predictions with Regular GC Distribution Use SNAP Gene Predictions with Upper GC Content Train Augustus with Lower GC Gene Predictions Train Augustus with Regular GC Gene Predictions Train Augustus with Upper GC Gene Predictions MAKER Annotation with Lower GC HMMs MAKER Annotation with Regular GC HMMs MAKER Annotation with Upper GC HMMs Rerun MAKER Annotation with Regular GC HMMs and Predictions from Lower and Upper GC HMMs; MAKER Retains the Best Annotations
21 MAKER Annotation Comparative AED Curves Total Number of Transcripts AED combo high low original
22 Unique gene models AED Scores of New High GC Gene Models AED Scores of New Low GC Gene Models factor(high_names) factor(low_names) Count < AED <= < AED <= < AED < 1 AED <=.25 AED = 1 Count.25 < AED <= < AED <= < AED < 1 AED <=.25 AED = AED <= < AED <= < AED <= < AED < 1 AED = 1 AED Scores AED <= < AED <= < AED <= < AED < 1 AED = 1 AED Scores 1598 new gene models, 25,168 improved models (Decrease in AED score)
23 GC Distribution GC Distribution 7.5 Gene Frequency GC Content high high only low low only original
24 Codon usage original Jane Pulman
25 Codon usage low new models Jane Pulman
26 Codon usage high new models Jane Pulman
27 The effective number of codons!! = 2 + 9!! + 1!! + 5!! + 3!!! F i is the average homozygosity estimated for SF type i. 2 is the N c for M and Try as they are always 1. 9,1,5 and 3 are the number of AA of that type. So for example there are 9 AA that have 2 synonymous codons. Jane Pulman
28 Nc Plot Original Jane Pulman
29 Nc Plot Low New Models Jane Pulman
30 Nc Plot High New Models Jane Pulman
31 Position on first and second axis for High and Low GC new models Jane Pulman
32 Ongoing work Functional annotation of new genes Orthologs of new genes in other species Paralogs of new genes Comparison of MAKER annotations with full length cdnas Comparison of results to randomized training sets Expression analysis of high and low GC genes Tissue specific GC content and codon usage analyses
33 Conclusions High and low GC content gene models may be missed by using current HMM training methods Developed a pipeline for the creation of high and low GC content training data sets for existing gene prediction programs MAKER reannotation of MSU rice genome with high and low GC HMMs Identify over 1500 new gene models specific to high and low GC specific annotations Codon usage bias with high and low GC gene models
Bioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
More informationIntroduction to NGS data analysis
Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High
More informationHENIPAVIRUS ANTIBODY ESCAPE SEQUENCING REPORT
HENIPAVIRUS ANTIBODY ESCAPE SEQUENCING REPORT Kimberly Bishop Lilly 1,2, Truong Luu 1,2, Regina Cer 1,2, and LT Vishwesh Mokashi 1 1 Naval Medical Research Center, NMRC Frederick, 8400 Research Plaza,
More informationRETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
More informationA Web Based Software for Synonymous Codon Usage Indices
International Journal of Information and Computation Technology. ISSN 0974-2239 Volume 3, Number 3 (2013), pp. 147-152 International Research Publications House http://www. irphouse.com /ijict.htm A Web
More informationHidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006
Hidden Markov Models in Bioinformatics By Máthé Zoltán Kőrösi Zoltán 2006 Outline Markov Chain HMM (Hidden Markov Model) Hidden Markov Models in Bioinformatics Gene Finding Gene Finding Model Viterbi algorithm
More informationModule 1. Sequence Formats and Retrieval. Charles Steward
The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.
More informationComputational localization of promoters and transcription start sites in mammalian genomes
Computational localization of promoters and transcription start sites in mammalian genomes Thomas Down This dissertation is submitted for the degree of Doctor of Philosophy Wellcome Trust Sanger Institute
More informationDnaSP, DNA polymorphism analyses by the coalescent and other methods.
DnaSP, DNA polymorphism analyses by the coalescent and other methods. Author affiliation: Julio Rozas 1, *, Juan C. Sánchez-DelBarrio 2,3, Xavier Messeguer 2 and Ricardo Rozas 1 1 Departament de Genètica,
More information17 July 2014 WEB-SERVER MANUAL. Contact: Michael Hackenberg (hackenberg@ugr.es)
WEB-SERVER MANUAL Contact: Michael Hackenberg (hackenberg@ugr.es) 1 1 Introduction srnabench is a free web-server tool and standalone application for processing small- RNA data obtained from next generation
More informationBioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
More informationData search and visualization tools at the Comparative Evolutionary Genomics of Cotton Web resource
Data search and visualization tools at the Comparative Evolutionary Genomics of Cotton Web resource Alan R. Gingle Andrew H. Paterson Joshua A. Udall Jonathan F. Wendel 1 CEGC project goals set the context
More informationCore Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1
Core Bioinformatics 2014/2015 Code: 42397 ECTS Credits: 12 Degree Type Year Semester 4313473 Bioinformàtica/Bioinformatics OB 0 1 Contact Name: Sònia Casillas Viladerrams Email: Sonia.Casillas@uab.cat
More informationIntroduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
More informationFocusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
More informationBIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis
BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis By the end of this lab students should be able to: Describe the uses for each line of the DNA subway program (Red/Yellow/Blue/Green) Describe
More informationTutorial for proteome data analysis using the Perseus software platform
Tutorial for proteome data analysis using the Perseus software platform Laboratory of Mass Spectrometry, LNBio, CNPEM Tutorial version 1.0, January 2014. Note: This tutorial was written based on the information
More informationADVANCES IN BOTANICAL RESEARCH
o >VOLUME SIXTY NINE ADVANCES IN BOTANICAL RESEARCH Genomes of Herbaceous Land Plants Volume Editor ANDREW H. PATERSON Plant Genome Mapping Laboratory Department of Crop and Soil Sciences, Department of
More informationEvolutionary Bioinformatics. EvoPipes.net: Bioinformatic Tools for Ecological and Evolutionary Genomics
Evolutionary Bioinformatics Short Report Open Access Full open access to this and thousands of other papers at http://www.la-press.com. EvoPipes.net: Bioinformatic Tools for Ecological and Evolutionary
More informationCurrent Motif Discovery Tools and their Limitations
Current Motif Discovery Tools and their Limitations Philipp Bucher SIB / CIG Workshop 3 October 2006 Trendy Concepts and Hypotheses Transcription regulatory elements act in a context-dependent manner.
More informationThe Galaxy workflow. George Magklaras PhD RHCE
The Galaxy workflow George Magklaras PhD RHCE Biotechnology Center of Oslo & The Norwegian Center of Molecular Medicine University of Oslo, Norway http://www.biotek.uio.no http://www.ncmm.uio.no http://www.no.embnet.org
More informationBiological Sequence Data Formats
Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA
More informationA Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
More informationPROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org
BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,
More informationPairwise Sequence Alignment
Pairwise Sequence Alignment carolin.kosiol@vetmeduni.ac.at SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What
More informationA Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML
9 June 2011 A Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML by Jun Inoue, Mario dos Reis, and Ziheng Yang In this tutorial we will analyze
More informationVisualization of Phylogenetic Trees and Metadata
Visualization of Phylogenetic Trees and Metadata November 27, 2015 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com
More informationGenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
More information(http://genomes.urv.es/caical) TUTORIAL. (July 2006)
(http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA
More informationINTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
More informationRecombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
More informationBio-Informatics Lectures. A Short Introduction
Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
More informationHuman-Mouse Synteny in Functional Genomics Experiment
Human-Mouse Synteny in Functional Genomics Experiment Ksenia Krasheninnikova University of the Russian Academy of Sciences, JetBrains krasheninnikova@gmail.com September 18, 2012 Ksenia Krasheninnikova
More informationChapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes
Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes 2.1 Introduction Large-scale insertional mutagenesis screening in
More informationOverview of Eukaryotic Gene Prediction
Overview of Eukaryotic Gene Prediction CBB 231 / COMPSCI 261 W.H. Majoros What is DNA? Nucleus Chromosome Telomere Centromere Cell Telomere base pairs histones DNA (double helix) DNA is a Double Helix
More informationGenome Viewing. Module 2. Using Genome Browsers to View Annotation of the Human Genome
Module 2 Genome Viewing Using Genome Browsers to View Annotation of the Human Genome Bert Overduin, Ph.D. PANDA Coordination & Outreach EMBL - European Bioinformatics Institute Wellcome Trust Genome Campus
More informationRNA- seq de novo ABiMS
RNA- seq de novo ABiMS Cleaning 1. import des données d'entrée depuis Data Libraries : Shared Data Data Libraries RNA- seq de- novo 2. lancement des programmes de nettoyage pas à pas BlueLight.sample.read1.fastq
More informationIntroduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
More informationAlgorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
More informationMORPHEUS. http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix.
MORPHEUS http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix. Reference: MORPHEUS, a Webtool for Transcripton Factor Binding Analysis Using
More informationA Tutorial in Genetic Sequence Classification Tools and Techniques
A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University jakemdrew@gmail.com www.jakemdrew.com Sequence Characters IUPAC nucleotide
More informationAP Biology Essential Knowledge Student Diagnostic
AP Biology Essential Knowledge Student Diagnostic Background The Essential Knowledge statements provided in the AP Biology Curriculum Framework are scientific claims describing phenomenon occurring in
More informationStep-by-Step Guide to Bi-Parental Linkage Mapping WHITE PAPER
Step-by-Step Guide to Bi-Parental Linkage Mapping WHITE PAPER JMP Genomics Step-by-Step Guide to Bi-Parental Linkage Mapping Introduction JMP Genomics offers several tools for the creation of linkage maps
More informationEuropean Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
More informationBIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:
More informationName Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
More informationGuide for Bioinformatics Project Module 3
Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first
More informationSeattleSNPs Interactive Tutorial: Web Tools for Site Selection, Linkage Disequilibrium and Haplotype Analysis
SeattleSNPs Interactive Tutorial: Web Tools for Site Selection, Linkage Disequilibrium and Haplotype Analysis Goal: This tutorial introduces several websites and tools useful for determining linkage disequilibrium
More informationWhen you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want
1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very
More informationDNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
More informationCD-HIT User s Guide. Last updated: April 5, 2010. http://cd-hit.org http://bioinformatics.org/cd-hit/
CD-HIT User s Guide Last updated: April 5, 2010 http://cd-hit.org http://bioinformatics.org/cd-hit/ Program developed by Weizhong Li s lab at UCSD http://weizhong-lab.ucsd.edu liwz@sdsc.edu 1. Introduction
More informationA new type of Hidden Markov Models to predict complex domain architecture in protein sequences
A new type of Hidden Markov Models to predict complex domain architecture in protein sequences Raluca Uricaru, Laurent Bréhélin and Eric Rivals LIRMM, CNRS Université de Montpellier 2 14 Juin 2007 Raluca
More informationAnalyzing A DNA Sequence Chromatogram
LESSON 9 HANDOUT Analyzing A DNA Sequence Chromatogram Student Researcher Background: DNA Analysis and FinchTV DNA sequence data can be used to answer many types of questions. Because DNA sequences differ
More informationMultiple Sequence Alignment. Hot Topic 5/24/06 Kim Walker
Multiple Sequence Alignment Hot Topic 5/24/06 Kim Walker Outline Why are Multiple Sequence Alignments useful? What Tools are Available? Brief Introduction to ClustalX Tools to Edit and Add Features to
More informationAn introduction to bioinformatic tools for population genomic and metagenetic data analysis, 2.5 higher education credits Third Cycle
An introduction to bioinformatic tools for population genomic and metagenetic data analysis, 2.5 higher education credits Third Cycle Faculty of Science; Department of Marine Sciences The Swedish Royal
More informationGene Finding CMSC 423
Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher
More informationSimilarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003
Similarity Searches on Sequence Databases: BLAST, FASTA Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Outline Importance of Similarity Heuristic Sequence Alignment:
More informationUGENE Quick Start Guide
Quick Start Guide This document contains a quick introduction to UGENE. For more detailed information, you can find the UGENE User Manual and other special manuals in project website: http://ugene.unipro.ru.
More informationSICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE
AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,
More information2.3 Identify rrna sequences in DNA
2.3 Identify rrna sequences in DNA For identifying rrna sequences in DNA we will use rnammer, a program that implements an algorithm designed to find rrna sequences in DNA [5]. The program was made by
More informationSGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD
White Paper SGI High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems Haruna Cofer*, PhD January, 2012 Abstract The SGI High Throughput Computing (HTC) Wrapper
More informationDepartment of Microbiology, University of Washington
The Bioverse: An object-oriented genomic database and webserver written in Python Jason McDermott and Ram Samudrala Department of Microbiology, University of Washington mcdermottj@compbio.washington.edu
More informationGene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
More informationComparing Methods for Identifying Transcription Factor Target Genes
Comparing Methods for Identifying Transcription Factor Target Genes Alena van Bömmel (R 3.3.73) Matthew Huska (R 3.3.18) Max Planck Institute for Molecular Genetics Folie 1 Transcriptional Regulation TF
More informationIntroduction to Phylogenetic Analysis
Subjects of this lecture Introduction to Phylogenetic nalysis Irit Orr 1 Introducing some of the terminology of phylogenetics. 2 Introducing some of the most commonly used methods for phylogenetic analysis.
More informationGenetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
More informationG E N OM I C S S E RV I C ES
GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E
More informationCastillo et al. Rice Archaeogenetics electronic supplementary information
Castillo et al. Rice Archaeogenetics electronic supplementary information Figure S1: PCR amplification for the nuclear genome region Sh4; and the sequence analysis. (a) Electrophoresis of 10 PCR products
More informationFrequently Asked Questions Next Generation Sequencing
Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided
More informationIntroduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
More informationT cell Epitope Prediction
Institute for Immunology and Informatics T cell Epitope Prediction EpiMatrix Eric Gustafson January 6, 2011 Overview Gathering raw data Popular sources Data Management Conservation Analysis Multiple Alignments
More informationGeneProf and the new GeneProf Web Services
GeneProf and the new GeneProf Web Services Florian Halbritter florian.halbritter@ed.ac.uk Stem Cell Bioinformatics Group (Simon R. Tomlinson) simon.tomlinson@ed.ac.uk December 10, 2012 Florian Halbritter
More informationUCHIME in practice Single-region sequencing Reference database mode
UCHIME in practice Single-region sequencing UCHIME is designed for experiments that perform community sequencing of a single region such as the 16S rrna gene or fungal ITS region. While UCHIME may prove
More informationGenome Explorer For Comparative Genome Analysis
Genome Explorer For Comparative Genome Analysis Jenn Conn 1, Jo L. Dicks 1 and Ian N. Roberts 2 Abstract Genome Explorer brings together the tools required to build and compare phylogenies from both sequence
More informationObjectives. Raster Data Discrete Classes. Spatial Information in Natural Resources FANR 3800. Review the raster data model
Spatial Information in Natural Resources FANR 3800 Raster Analysis Objectives Review the raster data model Understand how raster analysis fundamentally differs from vector analysis Become familiar with
More informationBAPS: Bayesian Analysis of Population Structure
BAPS: Bayesian Analysis of Population Structure Manual v. 6.0 NOTE: ANY INQUIRIES CONCERNING THE PROGRAM SHOULD BE SENT TO JUKKA CORANDER (first.last at helsinki.fi). http://www.helsinki.fi/bsg/software/baps/
More informationStandards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium
Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium I. Introduction: Sequence based assays of transcriptomes (RNA-seq) are in wide use because of their favorable
More informationTranslation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
More informationBIOINFORMATICS TUTORIAL
Bio 242 BIOINFORMATICS TUTORIAL Bio 242 α Amylase Lab Sequence Sequence Searches: BLAST Sequence Alignment: Clustal Omega 3d Structure & 3d Alignments DO NOT REMOVE FROM LAB. DO NOT WRITE IN THIS DOCUMENT.
More informationPhylogenetic Trees Made Easy
Phylogenetic Trees Made Easy A How-To Manual Fourth Edition Barry G. Hall University of Rochester, Emeritus and Bellingham Research Institute Sinauer Associates, Inc. Publishers Sunderland, Massachusetts
More informationBSCI222 Principles of Genetics Winter 2014 TENTATIVE
BSCI222 Principles of Genetics Winter 2014 Instructor: Dr. O Brien Office Hours: Office: 3118 Plant Sciences Building Email: tammatha@umd.edu Phone: 301.405.1305 Please do not hesitate to come see me to
More informationSMRT Analysis v2.2.0 Overview. 1. SMRT Analysis v2.2.0. 1.1 SMRT Analysis v2.2.0 Overview. Notes:
SMRT Analysis v2.2.0 Overview 100 338 400 01 1. SMRT Analysis v2.2.0 1.1 SMRT Analysis v2.2.0 Overview Welcome to Pacific Biosciences' SMRT Analysis v2.2.0 Overview 1.2 Contents This module will introduce
More informationCloud-Based Big Data Analytics in Bioinformatics
Cloud-Based Big Data Analytics in Bioinformatics Presented By Cephas Mawere Harare Institute of Technology, Zimbabwe 1 Introduction 2 Big Data Analytics Big Data are a collection of data sets so large
More informationA Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques
Proceedings of the 2007 WSEAS International Conference on Computer Engineering and Applications, Gold Coast, Australia, January 17-19, 2007 402 A Multiple DNA Sequence Translation Tool Incorporating Web
More informationBiotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
More informationYale Pseudogene Analysis as part of GENCODE Project
Sanger Center 2009.01.20, 11:20-11:40 Mark B Gerstein Yale Illustra(on from Gerstein & Zheng (2006). Sci Am. (c) Mark Gerstein, 2002, (c) Yale, 1 1Lectures.GersteinLab.org 2007bioinfo.mbb.yale.edu Yale
More informationFinal Project Report
CPSC545 by Introduction to Data Mining Prof. Martin Schultz & Prof. Mark Gerstein Student Name: Yu Kor Hugo Lam Student ID : 904907866 Due Date : May 7, 2007 Introduction Final Project Report Pseudogenes
More informationVaxign Reverse Vaccinology Software Demo Introduction Zhuoshuang Allen Xiang, Yongqun Oliver He
Vaxign Reverse Vaccinology Software Demo Introduction Zhuoshuang Allen Xiang, Yongqun Oliver He Unit for Laboratory Animal Medicine Department of Microbiology and Immunology Center for Computational Medicine
More informationLinear Sequence Analysis. 3-D Structure Analysis
Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical properties Molecular weight (MW), isoelectric point (pi), amino acid content, hydropathy (hydrophilic
More informationAS Biology Unit 2 Key Terms and Definitions. Make sure you use these terms when answering exam questions!
AS Biology Unit 2 Key Terms and Definitions Make sure you use these terms when answering exam questions! Chapter 7 Variation 7.1 Random Sampling Sampling a population to eliminate bias e.g. grid square
More informationThe Steps. 1. Transcription. 2. Transferal. 3. Translation
Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order
More informationActivity 7.21 Transcription factors
Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation
More informationID of alternative translational initiation events. Description of gene function Reference of NCBI database access and relative literatures
Data resource: In this database, 650 alternatively translated variants assigned to a total of 300 genes are contained. These database records of alternative translational initiation have been collected
More informationNovel Mining of Cancer via Mutation in Tumor Protein P53 using Quick Propagation Network
Novel Mining of Cancer via Mutation in Tumor Protein P53 using Quick Propagation Network Ayad. Ghany Ismaeel, and Raghad. Zuhair Yousif Abstract There is multiple databases contain datasets of TP53 gene
More informationGenetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
More informationGC3 Use cases for the Cloud
GC3: Grid Computing Competence Center GC3 Use cases for the Cloud Some real world examples suited for cloud systems Antonio Messina Trieste, 24.10.2013 Who am I System Architect
More informationGramene: Exploring Function through Comparative Genomics and Network Analysis Doreen H. Ware, Ph.D. United States Department of Agriculture ARS Cold
Gramene: Exploring Function through Comparative Genomics and Network Analysis Doreen H. Ware, Ph.D. United States Department of Agriculture ARS Cold Spring Harbor Laboratory Gramene II Pankaj Jaiswal,
More informationAn introduction to bioinformatic tools for metagenetic and population genomic data analysis, 2.0 higher education credits
An introduction to bioinformatic tools for metagenetic and population genomic data analysis, 2.0 higher education credits Course period: 3-7 November 2014 Course leaders / Addresses for applications: Pierre
More informationLab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS
Lab 2/Phylogenetics/September 16, 2002 1 Read: Tudge Chapter 2 PHYLOGENETICS Objective of the Lab: To understand how DNA and protein sequence information can be used to make comparisons and assess evolutionary
More information