A new type of Hidden Markov Models to predict complex domain architecture in protein sequences
|
|
|
- Brooke Booth
- 10 years ago
- Views:
Transcription
1 A new type of Hidden Markov Models to predict complex domain architecture in protein sequences Raluca Uricaru, Laurent Bréhélin and Eric Rivals LIRMM, CNRS Université de Montpellier 2 14 Juin 2007 Raluca Uricaru (LIRMM/CNRS) Cyclic profile HMMs (CpHMMs) 14 Juin / 12
2 Summary 1 General Context 2 Proposed solution : CpHMM 3 Pentatrico-Peptide Repeat (PPR) protein family 4 Results Raluca Uricaru (LIRMM/CNRS) Cyclic profile HMMs (CpHMMs) 14 Juin / 12
3 General Context General Context Motifs, Domains, PFAM Motifs = sequence regions conserved in a protein family Domains = conserved sequence regions with structural properties many proteins are composed of several domains Pfam collection of protein domains & families uses phmms (via HMMER software) to model domains Raluca Uricaru (LIRMM/CNRS) Cyclic profile HMMs (CpHMMs) 14 Juin / 12
4 General Context phmms Profile Hidden Markov Models (phmms) HMM = probabilistic automaton ; phmm = HMM designed to represent domains/motifs ; test a protein s membership of a known family recognition tag the precise position of a domain in the sequence tagging Raluca Uricaru (LIRMM/CNRS) Cyclic profile HMMs (CpHMMs) 14 Juin / 12
5 General Context phmms (2) Difficulties proteins are usually composed of several different domains ; rearrangements & duplications different domain architectures in the same family. Raluca Uricaru (LIRMM/CNRS) Cyclic profile HMMs (CpHMMs) 14 Juin / 12
6 General Context phmms (2) Difficulties proteins are usually composed of several different domains ; rearrangements & duplications different domain architectures in the same family. phmms : have a linear structure, model a single domain unable to deal with complex domain architectures Raluca Uricaru (LIRMM/CNRS) Cyclic profile HMMs (CpHMMs) 14 Juin / 12
7 Proposed solution : CpHMM Proposed solution : generalized phmm Cyclic profile HMM (CpHMM) - made up of nested phmms Raluca Uricaru (LIRMM/CNRS) Cyclic profile HMMs (CpHMMs) 14 Juin / 12
8 Proposed solution : CpHMM CpHMM : advantages capitalizes on already developed phmms (PFAM) ; deals with both : variable number of repeated units & variable relative order of units ; takes in consideration both : sequence similarity & domain context ; Raluca Uricaru (LIRMM/CNRS) Cyclic profile HMMs (CpHMMs) 14 Juin / 12
9 Proposed solution : CpHMM CpHMM : advantages (2) built with or without prior knowledge can be adjusted & parameterised for a specific family ; automatically performs both tagging and recognition ; yields a globally optimal of several domains ; multiple tagging gives a global E-value (computed as in HMMER) ; efficient in execution terms ( 20 minutes for arabidopsis proteins) Raluca Uricaru (LIRMM/CNRS) Cyclic profile HMMs (CpHMMs) 14 Juin / 12
10 Pentatrico-Peptide Repeat (PPR) protein family PPR protein family Protein family with complex multi-domain architecture The PPR protein family is particularly large in plants Raluca Uricaru (LIRMM/CNRS) Cyclic profile HMMs (CpHMMs) 14 Juin / 12
11 Pentatrico-Peptide Repeat (PPR) protein family PPR protein family (2) Motif structure of PPR proteins for Arabidopsis Raluca Uricaru (LIRMM/CNRS) Cyclic profile HMMs (CpHMMs) 14 Juin / 12
12 Pentatrico-Peptide Repeat (PPR) protein family PPR protein family (3) PPR motif multiple alignment Raluca Uricaru (LIRMM/CNRS) Cyclic profile HMMs (CpHMMs) 14 Juin / 12
13 Results Validation comparison between automatic annotation (CpHMM) & expert manual annotation on PCMP subfamily in arabidopsis : 197 protein sequences regular expression for PCMP subfamily : (P L S ) (P L 2 S ) [E [E + [Dyw]]] distribution of the number of PPR motifs per protein : avg = 15, min = 7, max = 28 diversity of architectures ; identical improved prediction slightly different different #proteins automatic annotation valid in 88% of the motifs ; Raluca Uricaru (LIRMM/CNRS) Cyclic profile HMMs (CpHMMs) 14 Juin / 12
Bioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
Guide for Bioinformatics Project Module 3
Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first
Sequence Information. Sequence information. Good web sites. Sequence information. Sequence. Sequence
Sequence information Multiple Pair-wise SRS Entrez Comparisons Database searches Sequence Information Orthologue clusters Sequence Organell localisation Patterns Protein families Membrane attachment Bengt
Hidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006
Hidden Markov Models in Bioinformatics By Máthé Zoltán Kőrösi Zoltán 2006 Outline Markov Chain HMM (Hidden Markov Model) Hidden Markov Models in Bioinformatics Gene Finding Gene Finding Model Viterbi algorithm
T cell Epitope Prediction
Institute for Immunology and Informatics T cell Epitope Prediction EpiMatrix Eric Gustafson January 6, 2011 Overview Gathering raw data Popular sources Data Management Conservation Analysis Multiple Alignments
Introduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
Linear Sequence Analysis. 3-D Structure Analysis
Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical properties Molecular weight (MW), isoelectric point (pi), amino acid content, hydropathy (hydrophilic
A Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
Databases and mapping BWA. Samtools
Databases and mapping BWA Samtools FASTQ, SFF, bax.h5 ACE, FASTG FASTA BAM/SAM GFF, BED GenBank/Embl/DDJB many more File formats FASTQ Output format from Illumina and IonTorrent sequencers. Quality scores:
SGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD
White Paper SGI High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems Haruna Cofer*, PhD January, 2012 Abstract The SGI High Throughput Computing (HTC) Wrapper
Sequence homology search tools on the world wide web
44 Sequence Homology Search Tools Sequence homology search tools on the world wide web Ian Holmes Berkeley Drosophila Genome Project, Berkeley, CA email: [email protected] Introduction Sequence homology
Managing extended organizations and data governance : a foucauldian perspective
Managing extended organizations and data governance : a foucauldian perspective Eric Buffenoir, CNRS, Montpellier, France Isabelle Bourdon, MRM, Université Montpellier 2, France Digital Enterprise Design
Hidden Markov models in biological sequence analysis
Hidden Markov models in biological sequence analysis by E. Birney The vast increase of data in biology has meant that many aspects of computational science have been drawn into the field. Two areas of
NLP Programming Tutorial 5 - Part of Speech Tagging with Hidden Markov Models
NLP Programming Tutorial 5 - Part of Speech Tagging with Hidden Markov Models Graham Neubig Nara Institute of Science and Technology (NAIST) 1 Part of Speech (POS) Tagging Given a sentence X, predict its
statistical significance estimation
A probabilistic model of local sequence alignment that simplifies statistical significance estimation Sean R. Eddy Howard Hughes Medical Institute, Janelia Farm Research Campus 19700 Helix Drive Ashburn
Activity recognition in ADL settings. Ben Kröse [email protected]
Activity recognition in ADL settings Ben Kröse [email protected] Content Why sensor monitoring for health and wellbeing? Activity monitoring from simple sensors Cameras Co-design and privacy issues Necessity
Error Log Processing for Accurate Failure Prediction. Humboldt-Universität zu Berlin
Error Log Processing for Accurate Failure Prediction Felix Salfner ICSI Berkeley Steffen Tschirpke Humboldt-Universität zu Berlin Introduction Context of work: Error-based online failure prediction: error
Current Motif Discovery Tools and their Limitations
Current Motif Discovery Tools and their Limitations Philipp Bucher SIB / CIG Workshop 3 October 2006 Trendy Concepts and Hypotheses Transcription regulatory elements act in a context-dependent manner.
Hardware Implementation of Probabilistic State Machine for Word Recognition
IJECT Vo l. 4, Is s u e Sp l - 5, Ju l y - Se p t 2013 ISSN : 2230-7109 (Online) ISSN : 2230-9543 (Print) Hardware Implementation of Probabilistic State Machine for Word Recognition 1 Soorya Asokan, 2
Course: Model, Learning, and Inference: Lecture 5
Course: Model, Learning, and Inference: Lecture 5 Alan Yuille Department of Statistics, UCLA Los Angeles, CA 90095 [email protected] Abstract Probability distributions on structured representation.
Finding soon-to-fail disks in a haystack
Finding soon-to-fail disks in a haystack Moises Goldszmidt Microsoft Research Abstract This paper presents a detector of soon-to-fail disks based on a combination of statistical models. During operation
Classification/Decision Trees (II)
Classification/Decision Trees (II) Department of Statistics The Pennsylvania State University Email: [email protected] Right Sized Trees Let the expected misclassification rate of a tree T be R (T ).
Stock Trading by Modelling Price Trend with Dynamic Bayesian Networks
Stock Trading by Modelling Price Trend with Dynamic Bayesian Networks Jangmin O 1,JaeWonLee 2, Sung-Bae Park 1, and Byoung-Tak Zhang 1 1 School of Computer Science and Engineering, Seoul National University
Core Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1
Core Bioinformatics 2014/2015 Code: 42397 ECTS Credits: 12 Degree Type Year Semester 4313473 Bioinformàtica/Bioinformatics OB 0 1 Contact Name: Sònia Casillas Viladerrams Email: [email protected]
Yale Pseudogene Analysis as part of GENCODE Project
Sanger Center 2009.01.20, 11:20-11:40 Mark B Gerstein Yale Illustra(on from Gerstein & Zheng (2006). Sci Am. (c) Mark Gerstein, 2002, (c) Yale, 1 1Lectures.GersteinLab.org 2007bioinfo.mbb.yale.edu Yale
AUTOMATIC PHONEME SEGMENTATION WITH RELAXED TEXTUAL CONSTRAINTS
AUTOMATIC PHONEME SEGMENTATION WITH RELAXED TEXTUAL CONSTRAINTS PIERRE LANCHANTIN, ANDREW C. MORRIS, XAVIER RODET, CHRISTOPHE VEAUX Very high quality text-to-speech synthesis can be achieved by unit selection
Second International Workshop on Preservation of Evolving Big Data - Panel on Big Data Quality
Second International Workshop on Preservation of Evolving Big Data - Panel on Big Data Quality Angela Bonifati University of Lyon 1 Liris CNRS, France March 15, 2016 Angela Bonifati 2nd Diachron Workshop
Consensus alignment server for reliable comparative modeling with distant templates
W50 W54 Nucleic Acids Research, 2004, Vol. 32, Web Server issue DOI: 10.1093/nar/gkh456 Consensus alignment server for reliable comparative modeling with distant templates Jahnavi C. Prasad 1, Sandor Vajda
MK Gibson et al. Training and Benchmarking of Resfams profile HMMs
Training and Benchmarking of Resfams profile HMMs A curated list of antibiotic resistance (AR) proteins used to generate Resfams profile HMMs, along with associated reference gene sequences, is available
Machine Learning and Statistics: What s the Connection?
Machine Learning and Statistics: What s the Connection? Institute for Adaptive and Neural Computation School of Informatics, University of Edinburgh, UK August 2006 Outline The roots of machine learning
Tagging with Hidden Markov Models
Tagging with Hidden Markov Models Michael Collins 1 Tagging Problems In many NLP problems, we would like to model pairs of sequences. Part-of-speech (POS) tagging is perhaps the earliest, and most famous,
HMM : Viterbi algorithm - a toy example
MM : Viterbi algorithm - a toy example.5.3.4.2 et's consider the following simple MM. This model is composed of 2 states, (high C content) and (low C content). We can for example consider that state characterizes
Budapest University of Technology and Economics Department of Measurement and Information Systems. Business Process Modeling
Budapest University of Technology and Economics Department of Measurement and Information Systems Business Process Modeling Process, business process Workflow: sequence of given steps executed in order
Learning is a very general term denoting the way in which agents:
What is learning? Learning is a very general term denoting the way in which agents: Acquire and organize knowledge (by building, modifying and organizing internal representations of some external reality);
Advanced Signal Processing and Digital Noise Reduction
Advanced Signal Processing and Digital Noise Reduction Saeed V. Vaseghi Queen's University of Belfast UK WILEY HTEUBNER A Partnership between John Wiley & Sons and B. G. Teubner Publishers Chichester New
Introduction to MDM Part 4 - Enterprise Data Architecture Master Data Management
Introduction to MDM Part 4 - Enterprise Data Architecture Master Data Management Education Pierre Bonnet, IS Consultant, March 2012 Last update: March 21, 2012 [email protected] skype:
Cell Phone based Activity Detection using Markov Logic Network
Cell Phone based Activity Detection using Markov Logic Network Somdeb Sarkhel [email protected] 1 Introduction Mobile devices are becoming increasingly sophisticated and the latest generation of smart
Intrusion Detection via Machine Learning for SCADA System Protection
Intrusion Detection via Machine Learning for SCADA System Protection S.L.P. Yasakethu Department of Computing, University of Surrey, Guildford, GU2 7XH, UK. [email protected] J. Jiang Department
Lecture/Recitation Topic SMA 5303 L1 Sampling and statistical distributions
SMA 50: Statistical Learning and Data Mining in Bioinformatics (also listed as 5.077: Statistical Learning and Data Mining ()) Spring Term (Feb May 200) Faculty: Professor Roy Welsch Wed 0 Feb 7:00-8:0
博 士 論 文 ( 要 約 ) A study on enzymatic synthesis of. stable cyclized peptides which. inhibit protein-protein interactions
博 士 論 文 ( 要 約 ) 論 文 題 目 A study on enzymatic synthesis of stable cyclized peptides which inhibit protein-protein interactions ( 蛋 白 質 間 相 互 作 用 を 阻 害 する 安 定 な 環 状 化 ペプチドの 酵 素 合 成 に 関 する 研 究 ) 氏 名 張 静 1
PHYML Online: A Web Server for Fast Maximum Likelihood-Based Phylogenetic Inference
PHYML Online: A Web Server for Fast Maximum Likelihood-Based Phylogenetic Inference Stephane Guindon, F. Le Thiec, Patrice Duroux, Olivier Gascuel To cite this version: Stephane Guindon, F. Le Thiec, Patrice
Conditional Random Fields: An Introduction
Conditional Random Fields: An Introduction Hanna M. Wallach February 24, 2004 1 Labeling Sequential Data The task of assigning label sequences to a set of observation sequences arises in many fields, including
Automatic segmentation of text into structured records
Automatic segmentation of text into structured records Vinayak Borkar Kaustubh Deshmukh Sunita Sarawagi Indian Institute of Technology, Bombay ABSTRACT In this paper we present a method for automatically
Location: Events Center - Mandalay Bay Events Center Agenda Status: Default
Conference Home IBM Information On Demand 2011 SmartSite Mon, October 24 8:15 AM 3790A Opening General Session: Turn Insight Into Action Location: Events Center - Mandalay Bay Events Center Agenda Status:
Word Completion and Prediction in Hebrew
Experiments with Language Models for בס"ד Word Completion and Prediction in Hebrew 1 Yaakov HaCohen-Kerner, Asaf Applebaum, Jacob Bitterman Department of Computer Science Jerusalem College of Technology
Pricing Indicators. National Pricing Indicators. For the week beginning 6/6/11. (Additional indexes and products inside)
Pricing Indicators National Pricing Indicators For the week beginning 6/6/11 Highlights Checking account make-up is changing (p.2) No change in the national average APY for deposit product (p.2) No change
http://hmmer.wustl.edu/ Version 2.3.1; June 2003
HMMER User s Guide Biological sequence analysis using profile hidden Markov models http://hmmer.wustl.edu/ Version 2.3.1; June 2003 Sean Eddy Howard Hughes Medical Institute and Dept. of Genetics Washington
Bio-Informatics Lectures. A Short Introduction
Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively
Terminology Extraction from Log Files
Terminology Extraction from Log Files Hassan Saneifar 1,2, Stéphane Bonniol 2, Anne Laurent 1, Pascal Poncelet 1, and Mathieu Roche 1 1 LIRMM - Université Montpellier 2 - CNRS 161 rue Ada, 34392 Montpellier
UGENE Quick Start Guide
Quick Start Guide This document contains a quick introduction to UGENE. For more detailed information, you can find the UGENE User Manual and other special manuals in project website: http://ugene.unipro.ru.
REGULATIONS FOR THE DEGREE OF MASTER OF SCIENCE IN COMPUTER SCIENCE (MSc[CompSc])
![REGULATIONS FOR THE DEGREE OF MASTER OF SCIENCE IN COMPUTER SCIENCE (MSc[CompSc])](/thumbs/24/2595933.jpg "REGULATIONS FOR THE DEGREE OF MASTER OF SCIENCE IN COMPUTER SCIENCE (MSc[CompSc])")
244 REGULATIONS FOR THE DEGREE OF MASTER OF SCIENCE IN COMPUTER SCIENCE (MSc[CompSc]) (See also General Regulations) Any publication based on work approved for a higher degree should contain a reference
Automated Content Analysis of Discussion Transcripts
Automated Content Analysis of Discussion Transcripts Vitomir Kovanović [email protected] Dragan Gašević [email protected] School of Informatics, University of Edinburgh Edinburgh, United Kingdom [email protected]
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Bayesian Networks. Read R&N Ch. 14.1-14.2. Next lecture: Read R&N 18.1-18.4
Bayesian Networks Read R&N Ch. 14.1-14.2 Next lecture: Read R&N 18.1-18.4 You will be expected to know Basic concepts and vocabulary of Bayesian networks. Nodes represent random variables. Directed arcs
Evaluation of Optimizations for Object Tracking Feedback-Based Head-Tracking
Evaluation of Optimizations for Object Tracking Feedback-Based Head-Tracking Anjo Vahldiek, Ansgar Schneider, Stefan Schubert Baden-Wuerttemberg State University Stuttgart Computer Science Department Rotebuehlplatz
How To Calculate Energy From Water
A bi-projection method for Bingham type flows Laurent Chupin, Thierry Dubois Laboratoire de Mathématiques Université Blaise Pascal, Clermont-Ferrand Ecoulements Gravitaires et RIsques Naturels Juin 2015
Case Study: How Generic Domain Names Impact a SEM Campaign
Case Study: How Generic Domain Names Impact a SEM Campaign Karan Budhiraja 1 Executive Summary A challenge for online marketers is getting more clicks out of their pay-per-click search engine campaigns,
Introduction. Key Benefits. Data Storage. Data Retrieval. TechTip: Wonderware Historian a Look at Different Data Retrieval Methods.
NOTE: This article and all content are provided on an "as is" basis without any warranties of any kind, whether express or implied, including, but not limited to the implied warranties of merchantability,
THREE DIMENSIONAL REPRESENTATION OF AMINO ACID CHARAC- TERISTICS
THREE DIMENSIONAL REPRESENTATION OF AMINO ACID CHARAC- TERISTICS O.U. Sezerman 1, R. Islamaj 2, E. Alpaydin 2 1 Laborotory of Computational Biology, Sabancı University, Istanbul, Turkey. 2 Computer Engineering
200630 - FBIO - Fundations of Bioinformatics
Coordinating unit: Teaching unit: Academic year: Degree: ECTS credits: 2015 200 - FME - School of Mathematics and Statistics 1004 - UB - (ENG)Universitat de Barcelona MASTER'S DEGREE IN STATISTICS AND
DYNAMIC CHORD ANALYSIS FOR SYMBOLIC MUSIC
DYNAMIC CHORD ANALYSIS FOR SYMBOLIC MUSIC Thomas Rocher, Matthias Robine, Pierre Hanna, Robert Strandh LaBRI University of Bordeaux 1 351 avenue de la Libration F 33405 Talence, France [email protected]
THE TURING DEGREES AND THEIR LACK OF LINEAR ORDER
THE TURING DEGREES AND THEIR LACK OF LINEAR ORDER JASPER DEANTONIO Abstract. This paper is a study of the Turing Degrees, which are levels of incomputability naturally arising from sets of natural numbers.
Annex 6: Nucleotide Sequence Information System BEETLE. Biological and Ecological Evaluation towards Long-Term Effects
Annex 6: Nucleotide Sequence Information System BEETLE Biological and Ecological Evaluation towards Long-Term Effects Long-term effects of genetically modified (GM) crops on health, biodiversity and the
Quick DDNS Quick Start Guide
Quick DDNS Quick Start Guide Contents Before Use... 1 Enable Domain Name Access... 2 Default Domain Name Access... 2 Custom Domain Name... 3 DDNS Web Registration and Management... 5 Smart Phone Client...
Hidden Markov Models
8.47 Introduction to omputational Molecular Biology Lecture 7: November 4, 2004 Scribe: Han-Pang hiu Lecturer: Ross Lippert Editor: Russ ox Hidden Markov Models The G island phenomenon The nucleotide frequencies
Data Mining. Dr. Saed Sayad. University of Toronto 2010 [email protected]. http://chem-eng.utoronto.ca/~datamining/
Data Mining Dr. Saed Sayad University of Toronto 2010 [email protected] http://chem-eng.utoronto.ca/~datamining/ 1 Data Mining Data mining is about explaining the past and predicting the future by
Predicting Student Retention in Massive Open Online Courses using Hidden Markov Models
Predicting Student Retention in Massive Open Online Courses using Hidden Markov Models Girish Balakrishnan Electrical Engineering and Computer Sciences University of California at Berkeley Technical Report
Part A: Data Definition Language (DDL) Schema and Catalog CREAT TABLE. Referential Triggered Actions. CSC 742 Database Management Systems
CSC 74 Database Management Systems Topic #0: SQL Part A: Data Definition Language (DDL) Spring 00 CSC 74: DBMS by Dr. Peng Ning Spring 00 CSC 74: DBMS by Dr. Peng Ning Schema and Catalog Schema A collection
Chapter 5 More SQL: Complex Queries, Triggers, Views, and Schema Modification
Chapter 5 More SQL: Complex Queries, Triggers, Views, and Schema Modification Copyright 2011 Pearson Education, Inc. Publishing as Pearson Addison-Wesley Chapter 5 Outline More Complex SQL Retrieval Queries
Spot me if you can: Uncovering spoken phrases in encrypted VoIP conversations
Spot me if you can: Uncovering spoken phrases in encrypted VoIP conversations C. Wright, L. Ballard, S. Coull, F. Monrose, G. Masson Talk held by Goran Doychev Selected Topics in Information Security and
Cursive Handwriting Recognition for Document Archiving
International Digital Archives Project Cursive Handwriting Recognition for Document Archiving Trish Keaton Rod Goodman California Institute of Technology Motivation Numerous documents have been conserved
Quick DDNS Quick Start Guide
Quick DDNS Quick Start Guide DDNS 快 速 指 导 手 册 1 / 11 Before Use The device must be connected to the Internet, please check if the connection works properly. Please confirm Internet access port is open
Hidden Markov Models Chapter 15
Hidden Markov Models Chapter 15 Mausam (Slides based on Dan Klein, Luke Zettlemoyer, Alex Simma, Erik Sudderth, David Fernandez-Baca, Drena Dobbs, Serafim Batzoglou, William Cohen, Andrew McCallum, Dan
LabGenius. Technical design notes. The world s most advanced synthetic DNA libraries. [email protected] V1.5 NOV 15
LabGenius The world s most advanced synthetic DNA libraries Technical design notes [email protected] V1.5 NOV 15 Introduction OUR APPROACH LabGenius is a gene synthesis company focussed on the design and manufacture
AUTOMATIC VIDEO STRUCTURING BASED ON HMMS AND AUDIO VISUAL INTEGRATION
AUTOMATIC VIDEO STRUCTURING BASED ON HMMS AND AUDIO VISUAL INTEGRATION P. Gros (1), E. Kijak (2) and G. Gravier (1) (1) IRISA CNRS (2) IRISA Université de Rennes 1 Campus Universitaire de Beaulieu 35042