Computational Genomics. Next generation sequencing (NGS)
|
|
|
- Isaac Mosley
- 9 years ago
- Views:
Transcription
1 Computational Genomics Next generation sequencing (NGS)
2 Sequencing technology defies Moore s law Nature Methods 2011
3
4 Log 10 (price) Sequencing the Human Genome 2001: Human Genome Project 2.7G$, 11 years : 454 1M$, 3 months : Celera 100M$, 3 years 2008: ABI SOLiD 60K$, 2 weeks 2009: Illumina, Helicos 40-50K$ 2010: 5K$, a few days 2014: 1000$, <24 hrs Year
5
6 6
7
8 Applications of next-generation sequencing Nature Biotechnology 26 (10): (2008)
9 Roche & illumina analyzers Genome Sequencer FLX Illumina Genome Analyzer
10 High Parallelism is Achieved in Polony Sequencing Sanger Polony 10
11 Generation of Polony array: DNA Beads (454, SOLiD) DNA Beads are generated using Emulsion PCR 11
12 Generation of Polony array: DNA Beads (454, SOLiD) DNA Beads are placed in wells 12
13 Generation of Polony array: Bridge-PCR (Solexa) DNA fragments are attached to array and used as PCR templates 13
14 Sequencing: Fluorescently labeled Nucleotides (Solexa) Complementary strand elongation: DNA Polymerase 14
15 Sequencing: Fluorescently Labeled Nucleotides (ABI SOLiD) Complementary strand elongation: DNA Ligase 15
16 Single Molecule Sequencing: HeliScope Direct sequencing of DNA molecules: no amplification stage DNA fragments are attached to array Potential benefits: higher throughput, less errors 16
17 Technology Summary Read length Sequencing Technology Throughput (per run) Sanger ~800bp Sanger 400kbp 500$ 454 ~400bp Polony 500Mbp 60$ Cost (1mbp)* Solexa 75bp Polony 20Gbp 2$ SOLiD 75bp Polony 60Gbp 2$ Helicos 30-35bp Single molecule 25Gbp 1$ *Source: Shendure & Ji, Nat Biotech,
18 Errors Erlich et al. Nature Methods 5: (2008)
19 Genome Sequencing Goal figuring the order of nucleotides across a genome Problem Current DNA sequencing methods can handle only short stretches of DNA at once (usually between bp s) Solution Sequence and then use computers to assemble the small pieces 19
20 Genome Sequencing TG..GT TC..CC AC..GC CG..CA TT..TC AC..GC GA..GC TG..AC CT..TG GT..GC AC..GC AC..GC AA..GC AT..AT TT..CC Genome Short fragments of DNA Short DNA sequences ACGTGGTAA CGTATACAC TAGGCCATA GTAATGGCG CACCCTTAG TGGCGTATA CATA ACGTGGTAATGGCGTATACACCCTTAGGCCATA ACGTGACCGGTACTGGTAACGTACA CCTACGTGACCGGTACTGGTAACGT ACGCCTACGTGACCGGTACTGGTAA CGTATACACGTGACCGGTACTGGTA ACGTACACCTACGTGACCGGTACTG GTAACGTACGCCTACGTGACCGGTA CTGGTAACGTATACCTCT... Sequenced genome 20 20
21 Assembly How do we use the short reads to recover the genome being sequenced?
22 1: Using a reference genome: Alignment of reads to a reference..actgggtcatcgtacgatcgatcgatcgatcgatcggctagctagcta....actgggtcatcgtacgatcgatagatcgatcgatcgctagctagcta.. Reference Sample
23 2. Assembly without a reference (de novo assembly) Paired-End sequencing (Mate pairs) Sequence two ends of a fragment of known size. Currently fragment length (insert size) can range from 200 bps 10,000 bps
24 Velvet Euler / De Bruijn approach. Introduced as a alternative to overlap-layoutconsensus approach in capillary sequencing. More suited for short read assembly. Based on De Bruijn graph. Implemented in Velvet 1, the mostly used short read assembly method at present. 1 Daniel Zerbino and Ewan Birney. Velvet: Algorithms for De Novo Short Read Assembly Using De Bruijn Graphs. Genome Res. 18:
25 De Bruijn graph method Break each read sequence in to overlapping fragments of size k. (k-mers) Form De Bruijn graph such that each (k-1)-mer represents a node in the graph. Edge exists between node a to b iff there exists a k-mer such that is prefix is a and suffix is b. Traverse the graph in unambiguous path to form contigs.
26 K = 4 De Bruijn graph
27 De Bruijn graph method / Velvet Elegant way of representing the problem. Very fast execution. Error correction can be handled in the graph. De Bruijn graph size can be huge. ~200GB for human genomes. Does not use pair information in initial phase, resulting in overly complicated graphs
28 Applications (beyond DNA)
29 RNASeq Sample Total RNA PolyA RNA Small RNA Library Construction Reference Mapping to Genome PUN Assembly to Contigs Analysis Digital Counts Reads per kilobase per million (RPKM) Transcript structure Secondary structure Targets or Products Sequencing Base calling & QC CSIRO. INI Meeting July Tutorial - Applications
30 Depth of Sequence RNASeq Compositional Sequence count Transcript Abundance properties Majority of the data can be dominated by a small number of highly abundant transcripts Ability to observe transcripts of smaller abundance is dependent upon sequence depth
31 Normalization Normalization is the process in which components of experiments are made comparable before statistical analysis. It is important in sequencing as well as for microarrays. A couple issues in normalization are different sequencing depth (library size) and distributions of reads (long right tails).
32 Summarized Counts
33 Simple RPKM Normalization Proportion of reads: number of reads (n) mapping to an exon (gene) divided by the total number of reads (N), n/n. RPKM: Reads Per Kilobase of exon (gene) per Million mapped sequence reads, 10 9 n/(nl), where L is the length of the transcriptional unit in bp (Mortazavi et al., Nat. Meth., 2008).
34 RNASeq - Correspondence Good correspondence with : Expression Arrays Tiling Arrays qrt-pcr Range of up to 5 orders of magnitude Better detection of low abundance transcripts Greater power to detect Transcript sequence polymorphism Novel trans-splicing Paralogous genes Individual cell type expression
35
36 ChIPSeq MNase Linker Digest Remove Nucleosomes Sequence & Align
37 ChIP-Seq Hongkai Ji et al. Nature Biotechnology 26:
38 ChIP-Seq Analysis Alignment Peak Detection Annotation Visualization Sequence Analysis Motif Analysis
39 Alignment ELAND Bowtie SOAP SeqMap
40 FindPeaks CHiPSeq BS-Seq SISSRs QuEST MACS CisGenome Peak detection
41 One sample analysis A simple way is the sliding window method Poisson background model is commonly used to estimate error rate k i ~ Poisson(λ 0 ) k i Or people use Monte Carlo simulations Both are based on the assumption that read sampling rate is a constant across the genome. Hongkai Ji et al. Nature Biotechnology 26:
42 FDR estimation based on Poisson and negative binomial model Hongkai Ji et al. Nature Biotechnology 26:
43 Two sample analysis Reason: read sample rates at the same genomic locus are correlated across different samples. Hongkai Ji et al. Nature Biotechnology 26:
44 CisGenome two sample analysis Alignment k 1i Exploration n i =k 1i + k 2i k 1i n i ~ Binom(n i, p 0 ) k 2i FDR computation Peak Detection Post Processing Hongkai Ji et al. Nature Biotechnology 26:
45 Epigenome Protein-DNA interactions [ChIPSeq] Nucleosome positioning Histone modification Transcription factor interactions Methylation [MethylSeq] Impact of NextGen Whole genome profiling Resolution Image : ClearScience
46 Third generation sequencing 3 rd generation PacBio RS Single Molecule Sequencing Technology (tsms) No amplification 10Gb os sequence data per 8 day run Single Molecule Real Time (SMRT) sequencing technology (PacBio RS)
47 Nanopore sequencing
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
Next Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center
Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing
July 7th 2009 DNA sequencing
July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer
Next Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University [email protected] http://tandem.bu.edu/ The Human Genome Project took
Introduction to next-generation sequencing data
Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS
NGS data analysis. Bernardo J. Clavijo
NGS data analysis Bernardo J. Clavijo 1 A brief history of DNA sequencing 1953 double helix structure, Watson & Crick! 1977 rapid DNA sequencing, Sanger! 1977 first full (5k) genome bacteriophage Phi X!
Next generation sequencing (NGS)
Next generation sequencing (NGS) Vijayachitra Modhukur BIIT [email protected] 1 Bioinformatics course 11/13/12 Sequencing 2 Bioinformatics course 11/13/12 Microarrays vs NGS Sequences do not need to be known
RNAseq / ChipSeq / Methylseq and personalized genomics
RNAseq / ChipSeq / Methylseq and personalized genomics 7711 Lecture Subhajyo) De, PhD Division of Biomedical Informa)cs and Personalized Biomedicine, Department of Medicine University of Colorado School
Expression Quantification (I)
Expression Quantification (I) Mario Fasold, LIFE, IZBI Sequencing Technology One Illumina HiSeq 2000 run produces 2 times (paired-end) ca. 1,2 Billion reads ca. 120 GB FASTQ file RNA-seq protocol Task
Introduction to NGS data analysis
Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High
Genome-wide measurements of protein-dna interaction by chromatin immunoprecipitation
Genome-wide measurements of protein-dna interaction by chromatin immunoprecipitation D. Puthier. laboratoire INSERM, Aix-Marseille Université, TAGC/INSERM U928, Parc Scientifique de Luminy case 928 Outline
Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe
Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. To published results faster With proven scalability To the forefront of discovery To limitless applications
Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment
Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249
Reading DNA Sequences:
Reading DNA Sequences: 18-th Century Mathematics for 21-st Century Technology Michael Waterman University of Southern California Tsinghua University DNA Genetic information of an organism Double helix,
Automated DNA sequencing 20/12/2009. Next Generation Sequencing
DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing
Frequently Asked Questions Next Generation Sequencing
Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided
Next generation DNA sequencing technologies. theory & prac-ce
Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing
Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling
Lectures 1 and 8 15 February 7, 2013 This is a review of the material from lectures 1 and 8 14. Note that the material from lecture 15 is not relevant for the final exam. Today we will go over the material
How is genome sequencing done?
How is genome sequencing done? Using 454 Sequencing on the Genome Sequencer FLX System, DNA from a genome is converted into sequence data through four primary steps: Step One DNA sample preparation; Step
New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova
New generation sequencing: current limits and future perspectives Giorgio Valle CRIBI Università di Padova Around 2004 the Race for the 1000$ Genome started A few questions... When? How? Why? Standard
Nebula A web-server for advanced ChIP-seq data analysis. Tutorial. by Valentina BOEVA
Nebula A web-server for advanced ChIP-seq data analysis Tutorial by Valentina BOEVA Content Upload data to the history pp. 5-6 Check read number and sequencing quality pp. 7-9 Visualize.BAM files in UCSC
Core Facility Genomics
Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray
De Novo Assembly Using Illumina Reads
De Novo Assembly Using Illumina Reads High quality de novo sequence assembly using Illumina Genome Analyzer reads is possible today using publicly available short-read assemblers. Here we summarize the
New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.
New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System
Next Generation Sequencing for DUMMIES
Next Generation Sequencing for DUMMIES Looking at a presentation without the explanation from the author is sometimes difficult to understand. This document contains extra information for some slides that
PreciseTM Whitepaper
Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis
Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium
Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium I. Introduction: Sequence based assays of transcriptomes (RNA-seq) are in wide use because of their favorable
Analysis of ChIP-seq data in Galaxy
Analysis of ChIP-seq data in Galaxy November, 2012 Local copy: https://galaxy.wi.mit.edu/ Joint project between BaRC and IT Main site: http://main.g2.bx.psu.edu/ 1 Font Conventions Bold and blue refers
The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics
The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long
Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms
Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).
Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office
2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data The Illumina TopHat Alignment and Cufflinks Assembly and Differential Expression apps make RNA data analysis accessible to any user, regardless
Basic processing of next-generation sequencing (NGS) data
Basic processing of next-generation sequencing (NGS) data Getting from raw sequence data to expression analysis! 1 Reminder: we are measuring expression of protein coding genes by transcript abundance
Challenges associated with analysis and storage of NGS data
Challenges associated with analysis and storage of NGS data Gabriella Rustici Research and training coordinator Functional Genomics Group [email protected] Next-generation sequencing Next-generation sequencing
Next Generation Sequencing data Analysis at Genoscope. Jean-Marc Aury
Next Generation Sequencing data Analysis at Genoscope Jean-Marc Aury Introduction Presentation of Genoscope and NGS activities Overview of sequencing technologies Sequencing and assembly of prokaryotic
DNA Sequencing & The Human Genome Project
DNA Sequencing & The Human Genome Project An Endeavor Revolutionizing Modern Biology Jutta Marzillier, Ph.D Lehigh University Biological Sciences November 13 th, 2013 Guess, who turned 60 earlier this
Concepts and methods in sequencing and genome assembly
BCM-2004 Concepts and methods in sequencing and genome assembly B. Franz LANG, Département de Biochimie Bureau: H307-15 Courrier électronique: [email protected] Outline 1. Concepts in DNA and RNA
Overview of Next Generation Sequencing platform technologies
Overview of Next Generation Sequencing platform technologies Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Outline 1. Technologies
Data Analysis & Management of High-throughput Sequencing Data. Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute
Data Analysis & Management of High-throughput Sequencing Data Quoclinh Nguyen Research Informatics Genomics Core / Medical Research Institute Current Issues Current Issues The QSEQ file Number files per
Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics
Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics Christopher Benner, PhD Director, Integrative Genomics and Bioinformatics Core (IGC) idash Webinar,
History of DNA Sequencing & Current Applications
History of DNA Sequencing & Current Applications Christopher McLeod President & CEO, 454 Life Sciences, A Roche Company IMPORTANT NOTICE Intended Use Unless explicitly stated otherwise, all Roche Applied
FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem
FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert September 24, 2013 Abstract FlipFlop implements a fast method for de novo transcript
G E N OM I C S S E RV I C ES
GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E
Algorithms for Next Generation Sequencing Data Analysis
UNIVERSITÀ DEGLI STUDI DI MILANO - BICOCCA FACOLTÀ DI SCIENZE MATEMATICHE, FISICHE E NATURALI DIPARTIMENTO DI INFORMATICA, SISTEMISTICA E COMUNICAZIONE DOTTORATO DI RICERCA IN INFORMATICA - CICLO XXV Ph.D.
MiSeq: Imaging and Base Calling
MiSeq: Imaging and Page Welcome Navigation Presenter Introduction MiSeq Sequencing Workflow Narration Welcome to MiSeq: Imaging and. This course takes 35 minutes to complete. Click Next to continue. Please
How long is long enough?
How long is long enough? - Modeling to predict genome assembly performance - Hayan Lee@Schatz Lab Feb 26, 2014 Quantitative Biology Seminar 1 Outline Background Assembly history Recent sequencing technology
Introduction Bioo Scientific
Next Generation Sequencing Catalog 2014-2015 Introduction Bioo Scientific Bioo Scientific is a global life science company headquartered in Austin, TX, committed to providing innovative products and superior
NGS Technologies for Genomics and Transcriptomics
NGS Technologies for Genomics and Transcriptomics Massimo Delledonne Department of Biotechnologies - University of Verona http://profs.sci.univr.it/delledonne 13 years and $3 billion required for the Human
DNA Sequence Analysis
DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
CHALLENGES IN NEXT-GENERATION SEQUENCING
CHALLENGES IN NEXT-GENERATION SEQUENCING BASIC TENETS OF DATA AND HPC Gray s Laws of data engineering 1 : Scientific computing is very dataintensive, with no real limits. The solution is scale-out architecture
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
PAGANTEC: OPENMP PARALLEL ERROR CORRECTION FOR NEXT-GENERATION SEQUENCING DATA
PAGANTEC: OPENMP PARALLEL ERROR CORRECTION FOR NEXT-GENERATION SEQUENCING DATA Markus Joppich, Tony Bolger, Dirk Schmidl Björn Usadel and Torsten Kuhlen Markus Joppich Lehr- und Forschungseinheit Bioinformatik
8/7/2012. Experimental Design & Intro to NGS Data Analysis. Examples. Agenda. Shoe Example. Breast Cancer Example. Rat Example (Experimental Design)
Experimental Design & Intro to NGS Data Analysis Ryan Peters Field Application Specialist Partek, Incorporated Agenda Experimental Design Examples ANOVA What assays are possible? NGS Analytical Process
Athanasia Pavlopoulou University of Thessaly, Lamia June 2015
Athanasia Pavlopoulou University of Thessaly, Lamia June 2015 Early DNA Sequencing Technologies Early efforts at DNA sequencing were: o tedious o time consuming o labor intensive Frederick Sanger (Sanger
Version 5.0 Release Notes
Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com
An Overview of DNA Sequencing
An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure
Keeping up with DNA technologies
Keeping up with DNA technologies Mihai Pop Department of Computer Science Center for Bioinformatics and Computational Biology University of Maryland, College Park The evolution of DNA sequencing Since
Analysis of DNA methylation: bisulfite libraries and SOLiD sequencing
Analysis of DNA methylation: bisulfite libraries and SOLiD sequencing An easy view of the bisulfite approach CH3 genome TAGTACGTTGAT TAGTACGTTGAT read TAGTACGTTGAT TAGTATGTTGAT Three main problems 1.
The NGS IT notes. George Magklaras PhD RHCE
The NGS IT notes George Magklaras PhD RHCE Biotechnology Center of Oslo & The Norwegian Center of Molecular Medicine University of Oslo, Norway http://www.biotek.uio.no http://www.ncmm.uio.no http://www.no.embnet.org
Gene Expression Assays
APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency
GeneSifter: Next Generation Data Management and Analysis for Next Generation Sequencing
for Next Generation Sequencing Dale Baskin, N. Eric Olson, Laura Lucas, Todd Smith 1 Abstract Next generation sequencing technology is rapidly changing the way laboratories and researchers approach the
Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University
Genotyping by sequencing and data analysis Ross Whetten North Carolina State University Stein (2010) Genome Biology 11:207 More New Technology on the Horizon Genotyping By Sequencing Timeline 2007 Complexity
GeneProf and the new GeneProf Web Services
GeneProf and the new GeneProf Web Services Florian Halbritter [email protected] Stem Cell Bioinformatics Group (Simon R. Tomlinson) [email protected] December 10, 2012 Florian Halbritter
Software Getting Started Guide
Software Getting Started Guide For Research Use Only. Not for use in diagnostic procedures. P/N 001-097-569-03 Copyright 2010-2013, Pacific Biosciences of California, Inc. All rights reserved. Information
How Sequencing Experiments Fail
How Sequencing Experiments Fail v1.0 Simon Andrews [email protected] Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine
Introduction. Overview of Bioconductor packages for short read analysis
Overview of Bioconductor packages for short read analysis Introduction General introduction SRAdb Pseudo code (Shortread) Short overview of some packages Quality assessment Example sequencing data in Bioconductor
Partek Methylation User Guide
Partek Methylation User Guide Introduction This user guide will explain the different types of workflow that can be used to analyze methylation datasets. Under the Partek Methylation workflow there are
Genomics Services @ GENterprise
Genomics Services @ GENterprise since 1998 Mainz University spin-off privately financed 6-10 employees since 2006 Genomics Services @ GENterprise Sequencing Service (Sanger/3730, 454) Genome Projects (Bacteria,
SMRT Analysis v2.2.0 Overview. 1. SMRT Analysis v2.2.0. 1.1 SMRT Analysis v2.2.0 Overview. Notes:
SMRT Analysis v2.2.0 Overview 100 338 400 01 1. SMRT Analysis v2.2.0 1.1 SMRT Analysis v2.2.0 Overview Welcome to Pacific Biosciences' SMRT Analysis v2.2.0 Overview 1.2 Contents This module will introduce
Searching Nucleotide Databases
Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames
Next Generation Sequencing; Technologies, applications and data analysis
; Technologies, applications and data analysis Course 2542 Dr. Martie C.M. Verschuren Research group Analysis techniques in Life Science, Breda Prof. dr. Johan T. den Dunnen Leiden Genome Technology Center,
NEXT GENERATION SEQUENCING
NEXT GENERATION SEQUENCING Dr. R. Piazza SANGER SEQUENCING + DNA NEXT GENERATION SEQUENCING Flowcell NEXT GENERATION SEQUENCING Library di DNA Genomic DNA NEXT GENERATION SEQUENCING NEXT GENERATION SEQUENCING
FOR REFERENCE PURPOSES
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
Universidade Estadual de Maringá
Universidade Estadual de Maringá Disciplina: Biologia Molecular Sequenciamento de ácidos nucléicos Profa. Dra. Maria Aparecida Fernandez Maxan e Gilbert - quebra química Berg, Gilbert and Sanger dideoxinucleotideos
EPIGENETICS DNA and Histone Model
EPIGENETICS ABSTRACT A 3-D cut-and-paste model depicting how histone, acetyl and methyl molecules control access to DNA and affect gene expression. LOGISTICS TIME REQUIRED LEARNING OBJECTIVES DNA is coiled
Bioinformatics Unit Department of Biological Services. Get to know us
Bioinformatics Unit Department of Biological Services Get to know us Domains of Activity IT & programming Microarray analysis Sequence analysis Bioinformatics Team Biostatistical support NGS data analysis
SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications
Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each
Biotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
Deep Sequencing Data Analysis
Deep Sequencing Data Analysis Ross Whetten Professor Forestry & Environmental Resources Background Who am I, and why am I teaching this topic? I am not an expert in bioinformatics I started as a biologist
NGS Data Analysis: An Intro to RNA-Seq
NGS Data Analysis: An Intro to RNA-Seq March 25th, 2014 GST Colloquim: March 25th, 2014 1 / 1 Workshop Design Basics of NGS Sample Prep RNA-Seq Analysis GST Colloquim: March 25th, 2014 2 / 1 Experimental
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
Transcription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
