Data Analysis for Ion Torrent Sequencing
|
|
- Rose Barber
- 8 years ago
- Views:
Transcription
1 IFU022 v Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan Niel Belgium Revision date: August 21, 2014 Page 1 of 9
2 TABLE OF CONTENTS 1. KITS AND INTENDED USE PRINCIPLE OF THE METHOD MATERIALS AND EQUIPMENT REQUIRED BUT NOT PROVIDED FILES PROVIDED GENERAL CONSIDERATIONS DATA FILES STRUCTURE OF THE SEQUENCING READS DEMULTIPLEXING OF THE SEQUENCING READS TRIMMING OF THE SEQUENCING READS ALIGNMENT TO THE REFERENCE SEQUENCE VARIANT CALLING MINIMAL COVERAGE QUALITY SCORES CNV ANALYSIS SPECIFIC INSTRUCTIONS TORRENT SUITE TM SOFTWARE DROPGEN INSTRUCTIONS LIST OF ABBREVIATIONS... 9 Revision date: August 21, 2014 Page 2 of 9
3 1. KITS AND INTENDED USE The combined use of Multiplicom s MASTR (Multiplex Amplification of Specific Targets for Resequencing) kits with one or more of Multiplicom s molecular identifier (MID) kit(s) or Short Read Amplification kit enables the preparation of libraries for sequencing the gene(s) of interest using massively parallel sequencing (MPS) instruments. A list of available MASTR assays and Complementary MASTR products can be found on Multiplicom s website ( under Products section. These MASTR assays are for Research Use Only, unless otherwise stated, enabling the identification or confirmation of the presence or absence of mutations and/or copy number variations (CNV) in target regions. 2. PRINCIPLE OF THE METHOD Multiplicom s MASTR assays enable multiplex PCR amplification of all required target regions of the gene(s) of interest in a limited number of PCR reactions. The recommended amount of DNA for each multiplex PCR reaction is between 20 and 50 ng of purified genomic DNA for the germline MASTRs and somatic MASTRs for DNA derived from fresh frozen tissue (FFT), or a minimum of 20 ng for DNA derived from FFPE (formalin fixed paraffin embedded) material for somatic MASTRs. Next, the resulting amplicons are barcoded, pooled and sequenced using a MPS instrument according to the manufacturer s instructions. The resulting sequence read pairs are subsequently analyzed to identify variant positions compared with the reference sequence of the targeted gene(s). Comparing those variants with public and/or private databases and analyzing the predicted change on the protein level will allow the identification of mutations associated with health and disease. Moreover, a number of MASTR assays enable CNV analysis directly from MPS data. MASTR assays serve as front end amplification for sequence analysis on all commercially available bench top MPS instruments. The technology is based on target amplification. The principle of the MASTR assays relies on two key technologies: multiplex PCR amplification and Massively Parallel Sequencing (the detection method). In the first step, all target regions of the gene of interest are amplified in separate multiplex PCR amplification reactions (number of multiplex reactions is defined per MASTR assay) per individual, using a hot start DNA polymerase (Figure 1). The resulting amplicons of each multiplex are diluted 2,000 fold. Figure 1. First step: multiplex PCR Revision date: August 21, 2014 Page 3 of 9
4 For detailed workflow of this first step, please refer to the Instructions for Use Part I Multiplex PCR with amplicon specific primers: MASTR assays (IFU016). In the second step, a second round of PCR is performed enabling tagging of all the amplicons to incorporate MID and A and P1 adaptors required for Ion Torrent Sequencing (Figure 2). Figure 2. Second step: Universal PCR (example for Ion Torrent systems) The resulting tagged amplicons are mixed per individual applying a predefined assay specific mixing scheme. Each amplicon library is subsequently purified from small residual DNA fragments and the DNA concentration determined. For the detailed workflow of the second Universal PCR and subsequent mixing, purification and pooling steps please refer to the IFU Part II MID for Ion PGM TM System (IFU241 or IFU242). Next, these purified and individually tagged amplicon libraries are pooled equimolar, resulting in an amplicon pool or sequencing sample, which is then further processed with the Ion PGM TM Template OT2 400 Kit resulting in a template that is sequenced on an MPS Instrument according to the manufacturer s instructions. The positions of the Ion Torrent sequencing primers are indicated in Figure 3. Figure 3. Third step: Sequencing run. Revision date: August 21, 2014 Page 4 of 9
5 3. MATERIALS AND EQUIPMENT REQUIRED BUT NOT PROVIDED Equipment Analysis software for read counts and variant calling of the MPS data Recommendations/Comments Several software packages are commercially available. 4. FILES PROVIDED Table 1. Explanation of files supplied for data analysis File description MID sequences* (IFU333) PCR specific primers BED file Type and content General.pdf file listing the sequences of the MIDs present in the MID for Ion PGM TM System kits: for demultiplexing of reads (Section 5.3) MASTR specific.txt file listing the primers used for the amplification of the different amplicons: for sequence trimming (Section 5.4) MASTR specific.txt file listing the amplicon positions in Homo sapiens hg19 (MASTR specific primers are trimmed off): target info for data analysis in general format (Section 5.5) All files listed above can be downloaded from All documents mentioned above can be downloaded from using the KEY CODE printed on the box label of the specific MASTR kit (or MID for Ion PGM TM System kit*). 5. GENERAL CONSIDERATIONS 5.1. Data files For Ion Torrent sequencing, the Torrent Suite TM Software generates for each MID an SFF (Standard Flowgram Format) file or a FASTQ file containing all filter passed sequencing reads generated during the run Structure of the sequencing reads The structure of the sequencing reads is depicted in Figure 3: the reads start with the MID, followed by the universal tag sequence (Tag1 or Tag2), the PCR specific primer (Forward or Reverse) and the amplified region. Depending on the size of the amplified region and the length of the read, this sequence of the amplified region is further followed by the other PCR specific primer, universal tag and P1 adaptor Demultiplexing of the sequencing reads The MID sequences at the beginning and/or at the end of the reads are used to demultiplex the sequencing reads: to attribute the reads to one of the analysed samples or a no match residual category. Depending on the software tool used, the default being the Torrent Suite TM Software the number of allowed mismatches between the observed MID sequence and the expected MID sequences is an input parameter for the demultiplexing step. We advise to allow maximally 2 (tolerant) mismatches. Reducing the allowable mismatches reduces the risk for barcode misassignment; however, the number of reads assigned to a barcode will be reduced concomittantly. Revision date: August 21, 2014 Page 5 of 9
6 5.4. Trimming of the sequencing reads The PCR specific primer part in the sequencing reads is by definition equal to the genomic reference sequence and thus independent of the individual sample that is sequenced. As depicted in Figure 4, when 2 amplicons overlap, failure to trim the PCR primer sequences from the reads can result in skewed variant allele frequencies. Since virtually all MASTR assays contain overlapping amplicons, primer trimming is a mandatory step in the data analysis. The sequences of PCR primers (Figure 4a Forward2 and Reverse2) should be removed from those reads generated directly with them (Figure 4a Amplicon2 reads), and should not be removed from reads generated with other PCR primers (ie, from overlapping amplicons; Figure 4a Amplicon1 reads). This discrimination can be made based on the fact that the sequences of the PCR primers are flanked by the universal tags (Tag1, AAGACTCGGCAGCATCTCCA, or Tag2, GCGATCGTCACTGTTCTCCA), while the same sequences in the overlapping amplicons are not. Figure 4. PCR Primer trimming. a) Illustration before PCR primer trimming: alignment of Amplicon1 and Amplicon2 reads with Forward and Reverse primers. b) Illustration after PCR primer trimming. Remark: During design, great care was taken to select primer binding sites avoiding regions with variants. In addition, a periodic review is performed to identify newly reported variants in those regions and to test their impact on amplification. It can however not be excluded that a variant in a binding site of a primer may be present in a sample, which may lead to the amplification of only one of the alleles, masking the presence of a clinically relevant mutation in the amplicon. If such a case is suspected, calculation of the dosage quotient of each amplicon can be used for confirmation (as desctibed in Section 5.7). For further support, contact customer services at customerservice@multiplicom.com Alignment to the reference sequence The sequence reads can be aligned to the targeted regions or to the entire human genomic sequence. To facilitate the transfer of assay specific information to the different analysis software packages, a BED file with the trimmed amplicon positions on hg19 is available for download at our website Variant calling Different parameters can be analyzed to discriminate true positive variants from false positive or background signals. Below, you find a non exhaustive list of parameters whose effect on the sensitivity and specificity of variant calling might be evaluated: Minimal coverage The coverage, or number of aligned reads, at the site of the variant has to reach a given threshold for confident variant detection. The minimal coverage recommended by Multiplicom for MASTRs in combination with an Ion PGM System is 100 reads for each position at the region of interest (50 reads per allele) for SNV analysis and 300 reads per amplicon for CNV analysis. It is advised that target regions that do not reach this minimal coverage are eliminated from the list of analysed target regions in the final variant calling report. Revision date: August 21, 2014 Page 6 of 9
7 In case of an amplicon library derived from a tumor tissue sample (FFPE or FFT) deeper sequencing might be needed to obtain the required minimal coverage of 50 reads per affected allele. Examples are when the sample contains clonal populations of tumor cells and/or has a lower percentage of tumor cells. In these cases the minimal numbers of reads should be recalculated accordingly (eg, 2 fold higher to identify positions with a variant allele frequency (VAF) of 25%, or for a sample with 50% tumor tissue content) Quality scores The quality of the aligned bases at the position of the potential variant has an effect on the confidence in the variant call. This quality is generally influenced by the position in the read (the overall quality decreases along the reads) and the genomic context (eg, homopolymer stretches have a negative impact on the quality of the following bases). This leads to two derived parameters: Presence in forward and reverse reads Since the quality decreases along the reads and forward and reverse reads start at opposite positions on an amplicon, the quality of the forward reads is highest where the quality of the reverse reads is the lowest (and vice versa). If all target positions are covered by both forward and reverse reads, the presence of a variant in both forward and reverse reads is a good predictor for a true positive variant call. Changes in/around homopolymeric stretches In view of the inherent difficulties of the Ion Torrent sequencing technology to call the actual length of homopolymer stretches, special care has to be taken when calling variants in or flanking a homopolymeric stretch. Based on our experience, homopolymeric stretches with a length of 4 bp or more require special care. Remark: for specific MASTR assays, we offer a complementary homopolymer (HP) kit. For an overview of all available HP kits, please refer to the Products section on Multiplicom s website ( CNV analysis CNV analysis is possible for a selected number of MASTR assays. These MASTR assays contain a separate set of control amplicons for each plex (located on chromosomes different from the target genes), which are amplified, tagged and sequenced in parallel with the targeted region. Only MASTRs listing such control amplicons on their GS Reference Pattern are suited for CNV analysis. Remark: Excel template sheets are available upon request (at customerservice@multiplicom.com) for the specific MASTR assays enabling CNV analysis. To use these sheets, the read counts (number of reads) of all amplicons in all samples should be extracted from the sequencing data. For CNV analysis using MPS data, read count comparison between target and control amplicons is performed to calculate the Dosage Quotient (DQ) as described: Read count of the amplicon of interest is divided by the sum of read counts of control amplicons of that plex (in other words: normalize on sum of control amplicons) = normalized read count The average of the normalized read counts of that amplicon for all samples is calculated = reference normalized read count The normalized read count is divided by the reference normalized read count = DQ When the DQ 1.3, the corresponding genomic fragment is considered to be present in 3 copies (duplication of one allele); when the DQ 0.7, the genomic fragment is considered to be present in only 1 copy (deletion of one allele). Revision date: August 21, 2014 Page 7 of 9
8 Remarks: (1) CNV analysis calculations always need to be made within a plex. (2) For the proper calculation of the reference normalized read count (in the calculation of the DQ as described above), the set of samples should meet the following requirements: o When using a set of known samples as references (no CNVs), the libraries of these samples should be constructed together with the unknown samples. o When using the other unknown samples of your run as references, only a 40% of samples from the total set is allowed to have a CNV. (3) Since polymorphisms in primer sites may lead to amplification of only one of the alleles, resulting in a false positive DQ 0.5, a detected CNV is only considered to be valid when 2 adjacent amplicons show a significantly altered DQ and/or when confirmed by an independent method. (4) Compared to variant analysis deeper sequencing is required for CNV analysis. For the precise list of amplicons that will be amplified using a certain PCR Mix, refer to the MASTR specific GS Reference Pattern, which can be obtained from using the KEY CODE printed on the box label of the used MASTR kit. 6. SPECIFIC INSTRUCTIONS Data analysis can be performed using a variety of analysis software packages. Below we provide some specific instructions for the use of the Torrent Suite TM software of Life Technologies (Section 6.1), and the dropgen application of the Integrated Clinical NGS Dry Lab Service of Sophia Genetics 6.2) Torrent Suite TM software Life Technologies advises to align the generated sequences using the Torrent Suite Software and analyse the generated BAM files with the Torrent Variant Caller. One step in this process is the definition of the target regions. For this, the BED file mentioned in Table 1 should be used. More detailed information on these software solutions can be found on the Ion Community website ( dropgen instructions The dropgen application should be used according to manufacturer s instructions. To access and use Sophia Genetics' service, laboratories shall request the creation of an account on the dropgen application by contacting Sophia Genetics directly: Revision date: August 21, 2014 Page 8 of 9
9 7. LIST OF ABBREVIATIONS CNV: DNA: FFPE: IFU: MASTR: MID: MPS: PCR: Plex: ROI: SFF: TTC: VAF: Copy Number Variant Deoxyribonucleic acid formalin fixed paraffin embedded Instructions For Use Multiplex Amplification of Specific Target for Resequencing Molecular Identifiers Massively Parallel Sequencing Polymerase Chain Reaction Set of MASTR derived amplicons Region of Interest Standard Flowgram Format Tumor Tissue Content Variant Allele Frequency Revision date: August 21, 2014 Page 9 of 9
SEQUENCING. From Sample to Sequence-Ready
SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major
More informationIntroduction to next-generation sequencing data
Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS
More informationBRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls?
BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? Giovanni Luca Scaglione, PhD ------------------------ Laboratory of Clinical Molecular Diagnostics and Personalized Medicine, Institute
More informationThe Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics
The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long
More informationPreciseTM Whitepaper
Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis
More informationIntroduction to NGS data analysis
Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High
More informationTruSeq Custom Amplicon v1.5
Data Sheet: Targeted Resequencing TruSeq Custom Amplicon v1.5 A new and improved amplicon sequencing solution for interrogating custom regions of interest. Highlights Figure 1: TruSeq Custom Amplicon Workflow
More informationTargeted. sequencing solutions. Accurate, scalable, fast TARGETED
Targeted TARGETED Sequencing sequencing solutions Accurate, scalable, fast Sequencing for every lab, every budget, every application Ion Torrent semiconductor sequencing Ion Torrent technology has pioneered
More informationNext Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
More informationNazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office
2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation
More informationAdvances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage
Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application
More informationSingle-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation
PN 100-9879 A1 TECHNICAL NOTE Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation Introduction Cancer is a dynamic evolutionary process of which intratumor genetic and phenotypic
More informationSingle-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples
DATA Sheet Single-Cell DNA Sequencing with the C 1 Single-Cell Auto Prep System Reveal hidden populations and genetic diversity within complex samples Single-cell sensitivity Discover and detect SNPs,
More informationApplication Guide... 2
Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied
More informationGenetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
More informationIntroduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
More informationFocusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
More informationGenome Sequencer System. Amplicon Sequencing. Application Note No. 5 / February 2007. www.roche-applied-science.com
Genome Sequencer System Application Note No. 5 / February 2007 Amplicon Sequencing www.roche-applied-science.com 1 Amplicon Sequencing Corresponding author: Tom Jarvie, 454 Life Sciences Corporation, Branford,
More informationDNA and Forensic Science
DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief
More informationHow many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
More informationNext Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took
More informationBioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing
STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAAC GTGCAC GTGAAC Wouter Coppieters Head of the genomics core facility GIGA center, University of Liège Bioruptor NGS: Unbiased DNA
More informationHow is genome sequencing done?
How is genome sequencing done? Using 454 Sequencing on the Genome Sequencer FLX System, DNA from a genome is converted into sequence data through four primary steps: Step One DNA sample preparation; Step
More informationNext generation DNA sequencing technologies. theory & prac-ce
Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing
More informationTechnical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR
Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene
More informationAssuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice. Supplementary Guidelines
Assuring the Quality of Next-Generation Sequencing in Clinical Laboratory Practice Next-generation Sequencing: Standardization of Clinical Testing (Nex-StoCT) Workgroup Principles and Guidelines Supplementary
More information360 Master Mix. , and a supplementary 360 GC Enhancer.
Product Bulletin AmpliTaq Gold 360 Master Mix and 360 DNA Polymerase AmpliTaq Gold 360 Master Mix AmpliTaq Gold 360 DNA Polymerase 360 Coverage for a Full Range of Targets AmpliTaq Gold 360 Master Mix
More informationDevelopment of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples
Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples Sudhir K. Sinha, Ph.D.*, Anne H. Montgomery, M.S., Gina Pineda, M.S., and Hiromi Brown, Ph.D.
More informationChapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
More informationEssentials of Real Time PCR. About Sequence Detection Chemistries
Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected
More informationPNA BRAF Mutation Detection Kit
- PNA BRAF Mutation Detection Kit Catalog Number KA2102 50 tests/kit Version: 01 Intended for research use only www.abnova.com Introduction and Background Intended use The PNA BRAF Mutation Detection Kit
More information14/12/2012. HLA typing - problem #1. Applications for NGS. HLA typing - problem #1 HLA typing - problem #2
www.medical-genetics.de Routine HLA typing by Next Generation Sequencing Kaimo Hirv Center for Human Genetics and Laboratory Medicine Dr. Klein & Dr. Rost Lochhamer Str. 9 D-8 Martinsried Tel: 0800-GENETIK
More informationMUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
More informationFOR REFERENCE PURPOSES
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
More information2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
More informationForensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
More informationBacReady TM Multiplex PCR System
BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental
More informationThe author(s) shown below used Federal funds provided by the U.S. Department of Justice and prepared the following final report:
The author(s) shown below used Federal funds provided by the U.S. Department of Justice and prepared the following final report: Document Title: Author(s): Resolution of DNA Mixtures and Analysis of Degraded
More informationMultiplex your most important
Multiplex your most important genetic assays on one platform GenomeLab GeXP Genetic Analysis System Blood Banking Capillary Electrophoresis Centrifugation Flow Cytometry Genomics Lab Automation Lab Tools
More informationJuly 7th 2009 DNA sequencing
July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer
More informationMethylation Analysis Using Methylation-Sensitive HRM and DNA Sequencing
APPLICATION NOTE Methylation Analysis Using Methylation-Sensitive HRM and DNA Sequencing Methylation Analysis Using Methylation Sensitive HRM and DNA Sequencing Abstract DNA methylation is a key epigenetic
More informationLecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
More informationChapter 6 DNA Replication
Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore
More informationDNA Sequence Analysis
DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide
More informationOverview of Next Generation Sequencing platform technologies
Overview of Next Generation Sequencing platform technologies Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Outline 1. Technologies
More informationReal-time quantitative RT -PCR (Taqman)
Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR
More informationOncology Insights Enabled by Knowledge Base-Guided Panel Design and the Seamless Workflow of the GeneReader NGS System
White Paper Oncology Insights Enabled by Knowledge Base-Guided Panel Design and the Seamless Workflow of the GeneReader NGS System Abstract: This paper describes QIAGEN s philosophy and process for developing
More informationBiology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA
Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns
More informationValidation parameters: An introduction to measures of
Validation parameters: An introduction to measures of test accuracy Types of tests All tests are fundamentally quantitative Sometimes we use the quantitative result directly However, it is often necessary
More informationRapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR
Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR BioTechniques 25:415-419 (September 1998) ABSTRACT The determination of unknown DNA sequences around
More informationCore Facility Genomics
Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray
More informationCommonly Used STR Markers
Commonly Used STR Markers Repeats Satellites 100 to 1000 bases repeated Minisatellites VNTR variable number tandem repeat 10 to 100 bases repeated Microsatellites STR short tandem repeat 2 to 6 bases repeated
More informationSeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications
Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each
More informationDNA Sequencing Troubleshooting Guide
DNA Sequencing Troubleshooting Guide Successful DNA Sequencing Read Peaks are well formed and separated with good quality scores. There is a small area at the beginning of the run before the chemistry
More informationGene Expression Assays
APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency
More informationDNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE
DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE We recommend for the sequence visualization the use of software that allows the examination of raw data in order to determine quantitatively how good has
More informationDelivering the power of the world s most successful genomics platform
Delivering the power of the world s most successful genomics platform NextCODE Health is bringing the full power of the world s largest and most successful genomics platform to everyday clinical care NextCODE
More informationImproved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix
CLONING & MAPPING DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix LIBRARY PREP FOR NET GEN SEQUENCING PROTEIN
More informationIllumina TruSeq DNA Adapters De-Mystified James Schiemer
1 of 5 Illumina TruSeq DNA Adapters De-Mystified James Schiemer The key to sequencing random fragments of DNA is by the addition of short nucleotide sequences which allow any DNA fragment to: 1) Bind to
More informationDescription: Molecular Biology Services and DNA Sequencing
Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:
More informationGenScript BloodReady TM Multiplex PCR System
GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI
More informationAccurate and sensitive mutation detection and quantitation using TaqMan Mutation Detection Assays for disease research
PPLICTION NOTE Mutation Detection ssays ccurate and sensitive mutation detection and quantitation using Mutation Detection ssays for disease research In this research study, we addressed the feasibility
More informationSystematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh
More informationAutomated DNA sequencing 20/12/2009. Next Generation Sequencing
DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing
More informationReal-Time PCR Vs. Traditional PCR
Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives
More informationEU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità
Identification and characterization of Verocytotoxin-producing Escherichia coli (VTEC) by Real Time PCR amplification of the main virulence genes and the genes associated with the serogroups mainly associated
More informationHistory of DNA Sequencing & Current Applications
History of DNA Sequencing & Current Applications Christopher McLeod President & CEO, 454 Life Sciences, A Roche Company IMPORTANT NOTICE Intended Use Unless explicitly stated otherwise, all Roche Applied
More informationGetting Started Guide
Primer Express Software Version 3.0 Getting Started Guide Before You Begin Designing Primers and Probes for Quantification Assays Designing Primers and Probes for Allelic Discrimination Assays Ordering
More informationReal-time PCR: Understanding C t
APPLICATION NOTE Real-Time PCR Real-time PCR: Understanding C t Real-time PCR, also called quantitative PCR or qpcr, can provide a simple and elegant method for determining the amount of a target sequence
More informationSingle Nucleotide Polymorphisms (SNPs)
Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded
More informationSequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website
Biomolecular Core Facility AI Dupont Hospital for Children, Rockland Center One, Room 214 Core: (302) 651-6712, Office: (302) 651-6707, mbcore@nemours.org Katia Sol-Church, Ph.D., Director Jennifer Frenck
More informationMolecular and Cell Biology Laboratory (BIOL-UA 223) Instructor: Ignatius Tan Phone: 212-998-8295 Office: 764 Brown Email: ignatius.tan@nyu.
Molecular and Cell Biology Laboratory (BIOL-UA 223) Instructor: Ignatius Tan Phone: 212-998-8295 Office: 764 Brown Email: ignatius.tan@nyu.edu Course Hours: Section 1: Mon: 12:30-3:15 Section 2: Wed: 12:30-3:15
More informationPATHOGEN DETECTION SYSTEMS BY REAL TIME PCR. Results Interpretation Guide
PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR Results Interpretation Guide Pathogen Detection Systems by Real Time PCR Microbial offers real time PCR based systems for the detection of pathogenic bacteria
More informationINTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
More informationFactors Influencing Multiplex Real-Time PCR
APPLICATION NOTE Multiplex Real-Time PCR Factors Influencing Multiplex Real-Time PCR Introduction Multiplex PCR is the simultaneous amplification of more than one target sequence in a single reaction [1].
More informationSequencing and microarrays for genome analysis: complementary rather than competing?
Sequencing and microarrays for genome analysis: complementary rather than competing? Simon Hughes, Richard Capper, Sandra Lam and Nicole Sparkes Introduction The human genome is comprised of more than
More informationGenomic DNA Extraction Kit INSTRUCTION MANUAL
Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview
More informationEuropean Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
More informationRapid Aneuploidy and CNV Detection in Single Cells using the MiSeq System
i Technical Note: Reproductive Health Rapid Aneuploidy and CNV Detection in Single Cells using the MiSeq System Comparison between data generated from single cells using 24sure array-based screening and
More informationTroubleshooting for PCR and multiplex PCR
Page 1 of 5 Page designed and maintained by Octavian Henegariu (Email: Tavi's Yale email or Tavi's Yahoo email). As I am currently pursuing a new junior faculty position, the Yale URL and email may change
More information510K Summary. This summary of 510(k) safety and effectiveness information is being submitted in accordance with the requirements of 21 CFR 807.92.
510K Summary This summary of 510(k) safety and effectiveness information is being submitted in accordance with the requirements of 21 CFR 807.92. Submitter: Contact: One Lambda, Incorporated 21001 Kittridge
More informationMitochondrial DNA Analysis
Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)
More informationGene Mapping Techniques
Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction
More informationIllumina Sequencing Technology
Illumina Sequencing Technology Highest data accuracy, simple workflow, and a broad range of applications. Introduction Figure 1: Illumina Flow Cell Illumina sequencing technology leverages clonal array
More informationPCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI,
Supplemental Text/Tables PCR Amplification and Sequencing PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Foster City, CA). Each PCR reaction contained 20 ng genomic
More informationComplete Genomics Sequencing
TECHNOLOGY OVERVIEW Complete Genomics Sequencing Introduction With advances in nanotechnology, high-throughput instruments, and large-scale computing, it has become possible to sequence a complete human
More informationNext Generation Sequencing for DUMMIES
Next Generation Sequencing for DUMMIES Looking at a presentation without the explanation from the author is sometimes difficult to understand. This document contains extra information for some slides that
More informationHow To Use An Enzymatics Spark Dna Sample Prep Kit For Ion Torrent
SPARK DNA Sample Prep Kit Ion Torrent (SPK0002-V08) Frequently Asked Questions Under what circumstances would I use SPARK DNA Sample Prep Kit for Ion Torrent? Enzymatics SPARK DNA Sample Prep Kit for Ion
More informationLectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling
Lectures 1 and 8 15 February 7, 2013 This is a review of the material from lectures 1 and 8 14. Note that the material from lecture 15 is not relevant for the final exam. Today we will go over the material
More informationDNA: A Person s Ultimate Fingerprint
A partnership between the UAB Center for Community Outreach Development and McWane Center DNA: A Person s Ultimate Fingerprint This project is supported by a Science Education Partnership Award (SEPA)
More informationPrimePCR Assay Validation Report
Gene Information Gene Name sorbin and SH3 domain containing 2 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SORBS2 Human Arg and c-abl represent the mammalian
More informationHighly specific and sensitive quantitation
PRODUCT ULLETIN SYR Select Master Mix SYR Select Master Mix Highly specific and sensitive quantitation SYR Select Master Mix offers advanced performance at an affordable price. SYR Select Master Mix is
More informationSanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne
Sanger Sequencing and Quality Assurance Zbigniew Rudzki Department of Pathology University of Melbourne Sanger DNA sequencing The era of DNA sequencing essentially started with the publication of the enzymatic
More informationComparing Methods for Identifying Transcription Factor Target Genes
Comparing Methods for Identifying Transcription Factor Target Genes Alena van Bömmel (R 3.3.73) Matthew Huska (R 3.3.18) Max Planck Institute for Molecular Genetics Folie 1 Transcriptional Regulation TF
More informationAnnex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005
Deutsche Akkreditierungsstelle GmbH German Accreditation Body Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Period of validity: 26.03.2012 to 25.03.2017
More informationGenotyping by sequencing and data analysis. Ross Whetten North Carolina State University
Genotyping by sequencing and data analysis Ross Whetten North Carolina State University Stein (2010) Genome Biology 11:207 More New Technology on the Horizon Genotyping By Sequencing Timeline 2007 Complexity
More informationAmazing DNA facts. Hands-on DNA: A Question of Taste Amazing facts and quiz questions
Amazing DNA facts These facts can form the basis of a quiz (for example, how many base pairs are there in the human genome?). Students should be familiar with most of this material, so the quiz could be
More informationIntended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers.
Unzipping Genes MBPCR014 Beta-Thalassemia Detection Kit P r o d u c t I n f o r m a t i o n Description: Thalassemia is a group of genetic disorders characterized by quantitative defects in globin chain
More informationChIP TROUBLESHOOTING TIPS
ChIP TROUBLESHOOTING TIPS Creative Diagnostics Abstract ChIP dissects the spatial and temporal dynamics of the interactions between chromatin and its associated factors CD Creative Diagnostics info@creative-
More information