What is a contig? What are the contig assembly programs?

Size: px
Start display at page:

Download "4.2.1. What is a contig? 4.2.2. What are the contig assembly programs?"

Transcription

1 Table of Contents 4.1. DNA Sequencing Trace Viewer in GCG SeqLab Table. Box. Select the editor mode in the SeqLab main window. Import sequencer trace files from the File menu. Select the trace files in ABI or SCF format. Open the traces window to display the traces. The trace viewer window and the editor window. IUB standard nucleotide codes and their implementation in GCG/Staden. Online resources 4.2. Contig Assembly What is a contig? What are the contig assembly programs? Workflow of contig assembly in GCG Strategy for correct contig assembly Box. Workflow of contig assembly in GCG Online resources References Simon Lin, M.D. Duke Bioinformatics Version:

2 4.1 Introduction of DNA Sequencing The ABI sequencer (PE-Applied Biosystems, Foster City, CA) is one of the automatic DNA sequencers routinely used in molecular biology labs. All modern DNA sequencing relies on the Sanger method of DNA replication with dideoxy chain termination. The ABI sequencer utilizes a scanning laser to detect the fluorescence-labeled products as they electrophorese through a denaturing polyacrylamide gel. The signals collected are plotted as a series of color peaks representing the nucleotide sequence and are called chromatogram or electrophorogram. The process of transforming the chromatogram into sequence is referred to as base calling. Usually, the base calling process is done at the sequencing facility. However, under some special circumstance such as SNP detection, you might want use specialized programs to process the chromatogram yourself. Phrap and PloyPhrap are such base calling programs Usually, the results from the sequencing facility contain two kinds of files: the sequences and the chromatograms. The sequence file is in text format and can be easily viewed and analyzed in any bioinformatics programs, whereas a trace viewer is needed to view the chromatogram in ABI format. An example of the data produced by an automated sequencer. The peaks in different color for each base are read directly from left to right to determine the sequence Trace Viewer in GCG SeqLab To use the trace viewer in SeqLab, you should have an X-windows emulator. A free X- windows emulator can be obtained at the Duke OIT software library.

3 Select the editor mode in the SeqLab main window. Import sequencer trace files from the File menu.

4 Select the trace files in ABI or SCF format. In this example, and are trace files from and ABI sequencer, whereas seq and seq are the nucleotide sequence files, respectively. Click OK to import the sequence trace into the editor. Repeat this process until all traces files you want are imported, then click Cancel to exit the file selection box.

5 Open the traces window to display the traces. From the Windows menu, choose Traces. Then the trace viewer window should appear.

6 The trace viewer window and the editor window. IUB/GCG Meaning Complement Staden/Sanger A A T A C C G C G G C G T or U T A T M A or C K M R A or G Y R W A or T W W S C or G S S Y C or T R Y K G or T M K V A or C or G B V H A or C or T D H D A or G or T H D B C or G or T V B X/N G or A or T or C X/N N. or ~ gap character./~ - Table. IUB standard nucleotide codes and their implementation in GCG / Staden.

7 Online Reference Chapter 3. Working with the Trace Viewer. GCG SeqLab Guide X-Windows emulator From the Duke OIT software Library Introduction of Contig Assembly Contig assembly is a critical step in genome sequencing projects. It puts the jigsaws of fragmented sequences together. As the shortgun sequencing strategy being adopted in many sequencing projects, contig assembly became an area of more active research. Although you might not work on a large sequencing project, your knowledge of bioinformatics would not be complete if you do not know the basic concepts of sequence assembly What is a contig? Contig stands for contiguous sequence. It was first used by Staden (1980). Dr. Roger Staden is a pioneer in the study of fragment assembly. His work remains the basis of most sequence assembly programs nowadays. A contig is a collection of overlapped fragments, which includes an assembled consensus sequence for the entire group and the information of each individual sequence fragment. Contig assembly program will detect the overlap of many small sequence fragments and form a longer, contiguous consensus sequences Contig Assembly Programs TIGR Assembler Has been used in a number of megabase microbial genome projects at TIGR. Sutton G., White, O., Adams, M., and Kerlavage, A. (1995) TIGR Assembler: A new tool for assembling large shotgun sequencing projects. Genome Science & Technology 1:9-19).

8 Gel Assemble Chapter V. DNA Sequencing and Contig Assembly Phred/Phrap/Consed Including a base-caller, an assembler and an X-windows graphical interface, authored by Phil Green at Washington University. Staden Package Complete package for sequencing, mutation detection, and sequence management. With X-windows interface. (If you need any of the software above, please contact Simon Lin at ) GCG Package Fragment Assembly System (FAS) in GCG Workflow of contig assembly in GCG GelStart GelEnter FAS Database /archive /working /consensus /relation Gel Merge Gel Disassemble GelView Workflow of contig assembly in GCG

9 After creates the fragment assemble project by gelstart, gelenter inputs the fragments into the FAS database. Gelmerge is the automatic contig assembler. Gelassemble is the post-assembly editing tool to resolve the ambiguities and conflicts in the automatic process by manual inspection. Gelview generates an overall view of the current status of the assembly project. Use common sense when you edit the contigs. Three kinds of errors can be corrected by manual editing: uncertainties, substitution errors, and frame shift errors. Frame shift error is more serious since it will completely change the deduced protein sequence from the position of error forward. This kind of error can usually be corrected by inspecting the chromatogram of alignment fragments. To get the consensus sequence of the contig, go to the command mode of gelassemble. The command prettyout writes an aligned output of fragments and the consensus similar to that of the GCG program pretty. If only the consensus sequence is needed, the command seqout can be used to generate the output. The program geldisassemble unmelds all assembled contigs in the current project and rebuilds a database consisting of the unjoined fragments. Although the details might vary, this workflow in GCG is generally applicable to all contig assembly software Hints and Common Mistakes You must run gelstart once to create or delete the sequence assembly project. And, you must run Gelstart once every time you wish to work on the project. GCG utilize a fragment assembly system (FAS) database to handle each assemble project. All files and directories under the project directory are in FAS database format. Do not add or delete files yourself in these directories. It will cause the FAS database corrupted. Use gelenter to add more fragments, and gelmerge/ gelassemble/ geldisassemble to modify the file contents. Remember, do not manipulate any file in the database with a UNIX text editor! You can manually resolve the discrepancies and correct the assembly errors by using gelassemble. You can also revise the errors in base calling of fragments if you have a graphical printout of ABI traces in hand. References Staden, R A new computer method for the storage and manipulation of DNA gel reading data. Nucleic Acids Res. 8:

10 Sutton G., White, O., Adams, M., and Kerlavage, A. (1995) TIGR Assembler: A new tool for assembling large shotgun sequencing projects. Genome Science & Technology 1:9-19.

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]

More information

Geospiza s Finch-Server: A Complete Data Management System for DNA Sequencing

Geospiza s Finch-Server: A Complete Data Management System for DNA Sequencing KOO10 5/31/04 12:17 PM Page 131 10 Geospiza s Finch-Server: A Complete Data Management System for DNA Sequencing Sandra Porter, Joe Slagel, and Todd Smith Geospiza, Inc., Seattle, WA Introduction The increased

More information

Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne

Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne Sanger Sequencing and Quality Assurance Zbigniew Rudzki Department of Pathology University of Melbourne Sanger DNA sequencing The era of DNA sequencing essentially started with the publication of the enzymatic

More information

DNA Sequencing Overview

DNA Sequencing Overview DNA Sequencing Overview DNA sequencing involves the determination of the sequence of nucleotides in a sample of DNA. It is presently conducted using a modified PCR reaction where both normal and labeled

More information

Vector NTI Advance 11 Quick Start Guide

Vector NTI Advance 11 Quick Start Guide Vector NTI Advance 11 Quick Start Guide Catalog no. 12605050, 12605099, 12605103 Version 11.0 December 15, 2008 12605022 Published by: Invitrogen Corporation 5791 Van Allen Way Carlsbad, CA 92008 U.S.A.

More information

DNA sequencing is the process of determining the precise order of the nucleotide bases in a particular DNA molecule. In 1974, two methods of DNA

DNA sequencing is the process of determining the precise order of the nucleotide bases in a particular DNA molecule. In 1974, two methods of DNA BIO440 Genetics Laboratory DNA sequencing DNA sequencing is the process of determining the precise order of the nucleotide bases in a particular DNA molecule. In 1974, two methods of DNA sequencing were

More information

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each

More information

User Guide for the Genetic Analysis Lab Information Management System (dnalims)

User Guide for the Genetic Analysis Lab Information Management System (dnalims) UNIVERSITY CORE DNA SERVICES University Core Genetic Analysis Laboratory Faculty of Medicine Health Sciences Centre, Rm. B104A Tel: (403) 220-4503, Fax: (403) 283-4907, Email: [email protected] www.ucalgary.ca/dnalab

More information

Version 5.0 Release Notes

Version 5.0 Release Notes Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com

More information

Introduction to GCG and SeqLab

Introduction to GCG and SeqLab Oxford University Bioinformatics Centre Introduction to GCG and SeqLab 31 July 2001 Oxford University Bioinformatics Centre, 2001 Sir William Dunn School of Pathology South Parks Road Oxford, OX1 3RE Contents

More information

Clone Manager. Getting Started

Clone Manager. Getting Started Clone Manager for Windows Professional Edition Volume 2 Alignment, Primer Operations Version 9.5 Getting Started Copyright 1994-2015 Scientific & Educational Software. All rights reserved. The software

More information

LESSON 9. Analyzing DNA Sequences and DNA Barcoding. Introduction. Learning Objectives

LESSON 9. Analyzing DNA Sequences and DNA Barcoding. Introduction. Learning Objectives 9 Analyzing DNA Sequences and DNA Barcoding Introduction DNA sequencing is performed by scientists in many different fields of biology. Many bioinformatics programs are used during the process of analyzing

More information

An Overview of DNA Sequencing

An Overview of DNA Sequencing An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure

More information

Searching Nucleotide Databases

Searching Nucleotide Databases Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames

More information

UGENE Quick Start Guide

UGENE Quick Start Guide Quick Start Guide This document contains a quick introduction to UGENE. For more detailed information, you can find the UGENE User Manual and other special manuals in project website: http://ugene.unipro.ru.

More information

Software review. Vector NTI, a balanced all-in-one sequence analysis suite

Software review. Vector NTI, a balanced all-in-one sequence analysis suite Vector NTI, a balanced all-in-one sequence analysis suite Keywords: sequence analysis, software package, database, virtual cloning, sequence assembly Abstract Vector NTI is a well-balanced desktop application

More information

AS4.1 190509 Replaces 260806 Page 1 of 50 ATF. Software for. DNA Sequencing. Operators Manual. Assign-ATF is intended for Research Use Only (RUO):

AS4.1 190509 Replaces 260806 Page 1 of 50 ATF. Software for. DNA Sequencing. Operators Manual. Assign-ATF is intended for Research Use Only (RUO): Replaces 260806 Page 1 of 50 ATF Software for DNA Sequencing Operators Manual Replaces 260806 Page 2 of 50 1 About ATF...5 1.1 Compatibility...5 1.1.1 Computer Operator Systems...5 1.1.2 DNA Sequencing

More information

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want 1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very

More information

Working with AppleScript

Working with AppleScript Tutorial for Macintosh Working with AppleScript 2016 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Analysis of ChIP-seq data in Galaxy

Analysis of ChIP-seq data in Galaxy Analysis of ChIP-seq data in Galaxy November, 2012 Local copy: https://galaxy.wi.mit.edu/ Joint project between BaRC and IT Main site: http://main.g2.bx.psu.edu/ 1 Font Conventions Bold and blue refers

More information

Data Analysis Software

Data Analysis Software Data Analysis Software for VISION, BioCAD 700E, SPRINT, and INTEGRAL Workstations Version 3 Series Software Getting Started Guide DRAFT August 10, 2001 2:47 pm DASgsg_Title.fm Copyright 1998, 2001, Applied

More information

RESTRICTION DIGESTS Based on a handout originally available at

RESTRICTION DIGESTS Based on a handout originally available at RESTRICTION DIGESTS Based on a handout originally available at http://genome.wustl.edu/overview/rst_digest_handout_20050127/restrictiondigest_jan2005.html What is a restriction digests? Cloned DNA is cut

More information

Reading DNA Sequences:

Reading DNA Sequences: Reading DNA Sequences: 18-th Century Mathematics for 21-st Century Technology Michael Waterman University of Southern California Tsinghua University DNA Genetic information of an organism Double helix,

More information

Surveyor. DNA Variant Analysis Software. Mutation. SoftGenetics LLC. v 3.1. 200 Innovation Blvd, Suite 235 State College PA 16803 USA 814/237/9340

Surveyor. DNA Variant Analysis Software. Mutation. SoftGenetics LLC. v 3.1. 200 Innovation Blvd, Suite 235 State College PA 16803 USA 814/237/9340 Mutation Surveyor DNA Variant Analysis Software v 3.1 SoftGenetics LLC 200 Innovation Blvd, Suite 235 State College PA 16803 USA 814/237/9340 email: [email protected] technical service: [email protected]

More information

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

Module 10: Bioinformatics

Module 10: Bioinformatics Module 10: Bioinformatics 1.) Goal: To understand the general approaches for basic in silico (computer) analysis of DNA- and protein sequences. We are going to discuss sequence formatting required prior

More information

Monitor file integrity using MultiHasher

Monitor file integrity using MultiHasher Monitor file integrity using MultiHasher Keep Research Data Securely Integrity Monitoring Beginner Introduction This guide describes the use of MultiHasher, an integrity monitoring tool for Microsoft Windows

More information

Description: Molecular Biology Services and DNA Sequencing

Description: Molecular Biology Services and DNA Sequencing Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:

More information

A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques

A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques Proceedings of the 2007 WSEAS International Conference on Computer Engineering and Applications, Gold Coast, Australia, January 17-19, 2007 402 A Multiple DNA Sequence Translation Tool Incorporating Web

More information

Sequencing Analysis Software Version 5.1

Sequencing Analysis Software Version 5.1 Applied Biosystems DNA Sequencing Analysis Software Sequencing Analysis Software Version 5.1 The Applied Biosystems DNA Sequencing Analysis Software v5.1 is designed to analyze, display, edit, save, and

More information

Learning Objectives:

Learning Objectives: Proteomics Methodology for LC-MS/MS Data Analysis Methodology for LC-MS/MS Data Analysis Peptide mass spectrum data of individual protein obtained from LC-MS/MS has to be analyzed for identification of

More information

Module 1. Sequence Formats and Retrieval. Charles Steward

Module 1. Sequence Formats and Retrieval. Charles Steward The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.

More information

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Focusing on results not data comprehensive data analysis for targeted next generation sequencing Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes

More information

Mentor Tools tutorial Bold Browser Design Manager Design Architect Library Components Quicksim Creating and Compiling the VHDL Model.

Mentor Tools tutorial Bold Browser Design Manager Design Architect Library Components Quicksim Creating and Compiling the VHDL Model. Mentor Tools tutorial Bold Browser Design Manager Design Architect Library Components Quicksim Creating and Compiling the VHDL Model. Introduction To Mentor Graphics Mentor Graphics BOLD browser allows

More information

Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation.

Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation. Introduction to SMRTbell Template Preparation 100 338 500 01 1. SMRTbell Template Preparation 1.1 Introduction to SMRTbell Template Preparation Welcome to Pacific Biosciences' Introduction to SMRTbell

More information

Molecular Visualization. Introduction

Molecular Visualization. Introduction Molecular Visualization Jeffry D. Madura Department of Chemistry & Biochemistry Center for Computational Sciences Duquesne University Introduction Assessments of change, dynamics, and cause and effect

More information

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold

More information

A data management framework for the Fungal Tree of Life

A data management framework for the Fungal Tree of Life Web Accessible Sequence Analysis for Biological Inference A data management framework for the Fungal Tree of Life Kauff F, Cox CJ, Lutzoni F. 2007. WASABI: An automated sequence processing system for multi-gene

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University [email protected] http://tandem.bu.edu/ The Human Genome Project took

More information

Memory Management Simulation Interactive Lab

Memory Management Simulation Interactive Lab Memory Management Simulation Interactive Lab The purpose of this lab is to help you to understand deadlock. We will use a MOSS simulator for this. The instructions for this lab are for a computer running

More information

Modified Genetic Algorithm for DNA Sequence Assembly by Shotgun and Hybridization Sequencing Techniques

Modified Genetic Algorithm for DNA Sequence Assembly by Shotgun and Hybridization Sequencing Techniques International Journal of Electronics and Computer Science Engineering 2000 Available Online at www.ijecse.org ISSN- 2277-1956 Modified Genetic Algorithm for DNA Sequence Assembly by Shotgun and Hybridization

More information

The Biotechnology Education Company

The Biotechnology Education Company EDVTEK P.. Box 1232 West Bethesda, MD 20827-1232 The Biotechnology 106 EDV-Kit # Principles of DNA Sequencing Experiment bjective: The objective of this experiment is to develop an understanding of DNA

More information

Pro/E Design Animation Tutorial*

Pro/E Design Animation Tutorial* MAE 377 Product Design in CAD Environment Pro/E Design Animation Tutorial* For Pro/Engineer Wildfire 3.0 Leng-Feng Lee 08 OVERVIEW: Pro/ENGINEER Design Animation provides engineers with a simple yet powerful

More information

(A GUIDE for the Graphical User Interface (GUI) GDE)

(A GUIDE for the Graphical User Interface (GUI) GDE) The Genetic Data Environment: A User Modifiable and Expandable Multiple Sequence Analysis Package (A GUIDE for the Graphical User Interface (GUI) GDE) Jonathan A. Eisen Department of Biological Sciences

More information

DNA Sequence Analysis

DNA Sequence Analysis DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide

More information

Gene Synthesis & Protein Engineering News by DNA2.0 Inc. SEPTEMBER 2005

Gene Synthesis & Protein Engineering News by DNA2.0 Inc. SEPTEMBER 2005 IN THIS ISSUE My DNA2.0 Account New Tool Gene Designer Software Free and ready to use Download Meet Louise Louise Rafty, Ph.D. Technical Sales Representative DNA-2-Day Gene Synthesis Rush Order DNA-2-Day

More information

Tera Term Telnet. Introduction

Tera Term Telnet. Introduction Tera Term Telnet Introduction Starting Telnet Tera Term is a terminal emulation program that enables you to log in to a remote computer, provided you have a registered account on that machine. To start

More information

Next generation sequencing (NGS)

Next generation sequencing (NGS) Next generation sequencing (NGS) Vijayachitra Modhukur BIIT [email protected] 1 Bioinformatics course 11/13/12 Sequencing 2 Bioinformatics course 11/13/12 Microarrays vs NGS Sequences do not need to be known

More information

- In 1976 1977, Allan Maxam and walter Gilbert devised the first method for sequencing DNA fragments containing up to ~ 500 nucleotides.

- In 1976 1977, Allan Maxam and walter Gilbert devised the first method for sequencing DNA fragments containing up to ~ 500 nucleotides. DNA Sequencing - DNA sequencing includes several methods and technologies that are used for determining the order of the nucleotide bases adenine, guanine, cytosine, and thymine in a molecule of DNA. -

More information

Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University

Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University Genotyping by sequencing and data analysis Ross Whetten North Carolina State University Stein (2010) Genome Biology 11:207 More New Technology on the Horizon Genotyping By Sequencing Timeline 2007 Complexity

More information

Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6

Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6 Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6 In the last lab, you learned how to perform basic multiple sequence alignments. While useful in themselves for determining conserved residues

More information

Basics Series-4006 Email Basics Version 9.0

Basics Series-4006 Email Basics Version 9.0 Basics Series-4006 Email Basics Version 9.0 Information in this document is subject to change without notice and does not represent a commitment on the part of Technical Difference, Inc. The software product

More information

Software review. Analysis for free: Comparing programs for sequence analysis

Software review. Analysis for free: Comparing programs for sequence analysis Analysis for free: Comparing programs for sequence analysis Keywords: sequence comparison tools, alignment, annotation, freeware, sequence analysis Abstract Programs to import, manage and align sequences

More information

CHAPTER 6: SEARCHING AN ONLINE DATABASE

CHAPTER 6: SEARCHING AN ONLINE DATABASE CHAPTER 6: SEARCHING AN ONLINE DATABASE WHAT S INSIDE Searching an Online Database... 6-1 Selecting a Display Mode... 6-1 Searching a Database... 6-1 Reviewing References... 6-2 Finding Full Text for a

More information

PyRy3D: a software tool for modeling of large macromolecular complexes MODELING OF STRUCTURES FOR LARGE MACROMOLECULAR COMPLEXES

PyRy3D: a software tool for modeling of large macromolecular complexes MODELING OF STRUCTURES FOR LARGE MACROMOLECULAR COMPLEXES MODELING OF STRUCTURES FOR LARGE MACROMOLECULAR COMPLEXES PyRy3D is a method for building low-resolution models of large macromolecular complexes. The components (proteins, nucleic acids and any other

More information

HOW TO MAKE YOUR WEBSITE

HOW TO MAKE YOUR WEBSITE HOW TO MAKE YOUR WEBSITE Use Netscape Composer to make your web page presentation of a 3D structure of your choosing. You will need to download a few template web pages from the biochemistry website, and

More information

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova New generation sequencing: current limits and future perspectives Giorgio Valle CRIBI Università di Padova Around 2004 the Race for the 1000$ Genome started A few questions... When? How? Why? Standard

More information

DNA Sequencing & The Human Genome Project

DNA Sequencing & The Human Genome Project DNA Sequencing & The Human Genome Project An Endeavor Revolutionizing Modern Biology Jutta Marzillier, Ph.D Lehigh University Biological Sciences November 13 th, 2013 Guess, who turned 60 earlier this

More information

14.3 Studying the Human Genome

14.3 Studying the Human Genome 14.3 Studying the Human Genome Lesson Objectives Summarize the methods of DNA analysis. State the goals of the Human Genome Project and explain what we have learned so far. Lesson Summary Manipulating

More information

SUBJECT: New Features in Version 5.3

SUBJECT: New Features in Version 5.3 User Bulletin Sequencing Analysis Software v5.3 July 2007 SUBJECT: New Features in Version 5.3 This user bulletin includes the following topics: New Features in v5.3.....................................

More information

How Sequencing Experiments Fail

How Sequencing Experiments Fail How Sequencing Experiments Fail v1.0 Simon Andrews [email protected] Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine

More information

GENE CONSTRUCTION KIT 4

GENE CONSTRUCTION KIT 4 GENE CONSTRUCTION KIT 4 Tutorials & User Manual from Textco BioSoftware, Inc. September 2012, First Edition Gene Construction Kit 4 Manual is Copyright Textco Bio- Software, Inc. 2003-2012. All rights

More information

Sequencing the Human Genome

Sequencing the Human Genome Revised and Updated Edvo-Kit #339 Sequencing the Human Genome 339 Experiment Objective: In this experiment, students will read DNA sequences obtained from automated DNA sequencing techniques. The data

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

DNA sequencing. Dideoxy-terminating sequencing or Sanger dideoxy sequencing

DNA sequencing. Dideoxy-terminating sequencing or Sanger dideoxy sequencing DNA sequencing Dideoxy-terminating sequencing or Sanger dideoxy sequencing Tools DNA template (single stranded) Specific primer (usually 17-23 mer, free 3 -OH) dntps DNA polymerase capacity of polymerizing

More information

Genome Explorer For Comparative Genome Analysis

Genome Explorer For Comparative Genome Analysis Genome Explorer For Comparative Genome Analysis Jenn Conn 1, Jo L. Dicks 1 and Ian N. Roberts 2 Abstract Genome Explorer brings together the tools required to build and compare phylogenies from both sequence

More information

Overview of Genome Assembly Techniques

Overview of Genome Assembly Techniques 6 Overview of Genome Assembly Techniques Sun Kim and Haixu Tang The most common laboratory mechanism for reading DNA sequences (e.g., gel electrophoresis) can determine sequence of up to approximately

More information

Structure Tools and Visualization

Structure Tools and Visualization Structure Tools and Visualization Gary Van Domselaar University of Alberta [email protected] Slides Adapted from Michel Dumontier, Blueprint Initiative 1 Visualization & Communication Visualization

More information

IBM SPSS Statistics 20 Part 1: Descriptive Statistics

IBM SPSS Statistics 20 Part 1: Descriptive Statistics CALIFORNIA STATE UNIVERSITY, LOS ANGELES INFORMATION TECHNOLOGY SERVICES IBM SPSS Statistics 20 Part 1: Descriptive Statistics Summer 2013, Version 2.0 Table of Contents Introduction...2 Downloading the

More information

Analyzing A DNA Sequence Chromatogram

Analyzing A DNA Sequence Chromatogram LESSON 9 HANDOUT Analyzing A DNA Sequence Chromatogram Student Researcher Background: DNA Analysis and FinchTV DNA sequence data can be used to answer many types of questions. Because DNA sequences differ

More information

Biological Sequence Data Formats

Biological Sequence Data Formats Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA

More information

BIOLOMICS SOFTWARE & SERVICES GENERAL INFORMATION DOCUMENT

BIOLOMICS SOFTWARE & SERVICES GENERAL INFORMATION DOCUMENT BIOLOMICS SOFTWARE & SERVICES GENERAL INFORMATION DOCUMENT BIOAWARE SA NV - VERSION 2.0 - AUGUST 2013 BIOLOMICS SOFTWARE DYNAMIC CREATION AND MODIFICATION OF DATABASES Create simple or complex databases

More information

How To Use Syntheticys User Management On A Pc Or Mac Or Macbook Powerbook (For Mac) On A Computer Or Mac (For Pc Or Pc) On Your Computer Or Ipa (For Ipa) On An Pc Or Ipad

How To Use Syntheticys User Management On A Pc Or Mac Or Macbook Powerbook (For Mac) On A Computer Or Mac (For Pc Or Pc) On Your Computer Or Ipa (For Ipa) On An Pc Or Ipad SYNTHESYS MANAGEMENT User Management Synthesys.Net User Management 1 SYNTHESYS.NET USER MANAGEMENT INTRODUCTION...3 STARTING SYNTHESYS USER MANAGEMENT...4 Viewing User Details... 5 Locating individual

More information

Introduction to next-generation sequencing data

Introduction to next-generation sequencing data Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS

More information

Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data

Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data The Illumina TopHat Alignment and Cufflinks Assembly and Differential Expression apps make RNA data analysis accessible to any user, regardless

More information

454 Sequencing System Software Manual Version 2.6

454 Sequencing System Software Manual Version 2.6 454 Sequencing System Software Manual Version 2.6 Part C: May 2011 Instrument / Kit GS Junior / Junior GS FL+ / L+ GS FL+ / LR70 GS FL / LR70 For life science research only. Not for use in diagnostic procedures.

More information

DNA Core Facility: DNA Sequencing Guide

DNA Core Facility: DNA Sequencing Guide DNA Core Facility: DNA Sequencing Guide University of Missouri-Columbia 216 Life Sciences Center Columbia, MO 65211 http://biotech.missouri.edu/dnacore/ Table of Contents 1. Evaluating Sequencing Data..

More information

DNA Insertions and Deletions in the Human Genome. Philipp W. Messer

DNA Insertions and Deletions in the Human Genome. Philipp W. Messer DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.

More information

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:

More information

SPSS: Getting Started. For Windows

SPSS: Getting Started. For Windows For Windows Updated: August 2012 Table of Contents Section 1: Overview... 3 1.1 Introduction to SPSS Tutorials... 3 1.2 Introduction to SPSS... 3 1.3 Overview of SPSS for Windows... 3 Section 2: Entering

More information

Chapter 11 Sharing and Reviewing Documents

Chapter 11 Sharing and Reviewing Documents Calc Guide Chapter 11 Sharing and Reviewing Documents This PDF is designed to be read onscreen, two pages at a time. If you want to print a copy, your PDF viewer should have an option for printing two

More information

Viewing and editing of Typhoon scanner images from 1D, 2D, and DiGE experiments at CIAN

Viewing and editing of Typhoon scanner images from 1D, 2D, and DiGE experiments at CIAN Viewing and editing of Typhoon scanner images from 1D, 2D, and DiGE experiments at CIAN Note: This document summarizes some background information and short protocols for image manipulation of Typhoon

More information

MiSeq: Imaging and Base Calling

MiSeq: Imaging and Base Calling MiSeq: Imaging and Page Welcome Navigation Presenter Introduction MiSeq Sequencing Workflow Narration Welcome to MiSeq: Imaging and. This course takes 35 minutes to complete. Click Next to continue. Please

More information

Committee on WIPO Standards (CWS)

Committee on WIPO Standards (CWS) E CWS/1/5 ORIGINAL: ENGLISH DATE: OCTOBER 13, 2010 Committee on WIPO Standards (CWS) First Session Geneva, October 25 to 29, 2010 PROPOSAL FOR THE PREPARATION OF A NEW WIPO STANDARD ON THE PRESENTATION

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR

Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR BioTechniques 25:415-419 (September 1998) ABSTRACT The determination of unknown DNA sequences around

More information

Exercises for the UCSC Genome Browser Introduction

Exercises for the UCSC Genome Browser Introduction Exercises for the UCSC Genome Browser Introduction 1) Find out if the mouse Brca1 gene has non-synonymous SNPs, color them blue, and get external data about a codon-changing SNP. Skills: basic text search;

More information

CHAPTER 20. GEOPAK Road > 3D Tools > 3D Modeling

CHAPTER 20. GEOPAK Road > 3D Tools > 3D Modeling CHAPTER 20 3D Modeling 20.1 Introduction Objectives Project Manager - Create 3D cross sections from 2D cross sections - Interpolate between 3D cross sections to create B-spline surfaces. - Use Drive Through

More information

Access Control and Audit Trail Software

Access Control and Audit Trail Software Varian, Inc. 2700 Mitchell Drive Walnut Creek, CA 94598-1675/USA Access Control and Audit Trail Software Operation Manual Varian, Inc. 2002 03-914941-00:3 Table of Contents Introduction... 1 Access Control

More information

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long

More information

Getting Started Guide

Getting Started Guide Primer Express Software Version 3.0 Getting Started Guide Before You Begin Designing Primers and Probes for Quantification Assays Designing Primers and Probes for Allelic Discrimination Assays Ordering

More information

Data formats and file conversions

Data formats and file conversions Building Excellence in Genomics and Computational Bioscience s Richard Leggett (TGAC) John Walshaw (IFR) Common file formats FASTQ FASTA BAM SAM Raw sequence Alignments MSF EMBL UniProt BED WIG Databases

More information