DNA Sequence Analysis
|
|
|
- Bertram Holmes
- 9 years ago
- Views:
Transcription
1 DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide probe. Species-specific PCR primers. Fluorescent probes for real-time PCR. Fixed probes for binding PCR product to a membrane (e.g. a dot blot system) or a microarray chip. 1
2 Medical scientist now routinely use this sort of approach to screen for known genotypes (e.g., an allele associated with a disease). The more high-tech methods they have developed are starting to diffuse into forensic science Microarrays Silicon microchips can be constructed with a huge array (thousands) of attached probes. Hybridization can be enhanced (template molecules clamped on or kicked off) electronically. Detection is usually optical, e.g., fluorescentlylabeled PCR product. 2
3 The microarray has become a standard tool of medical and other biological research. A common use is to study gene expression using reverse transcriptase PCR product. Another screening approach: link to real-time measurement of PCR amplification. [Recall DNA extract quantitation by real time PCR. Also note potential confusion with acronym RT- PCR.] 3
4 These are methods for detecting a polymorphism within an amplicon. The signal that hybridization has occurred is a function of the amount of PCR product that has been produced. This is measured while the reaction cycles are taking place (real time) or when the program is complete. An exonuclease probe relies on the 5 nuclease activity of Taq. The signal of the attached fluorophore cannot be detected in close proximity to the quencher. They are separated when Taq chews up the probe. EXAMPLE: Various TaqMan products sold by Applied Biosystems A molecular beacon acts in a similar manner, however the probe is not destroyed 4
5 The oligonucleotide probe is designed to have a higher annealing temperature than the primers. Experimental conditions are such that the probe binds only if it is a perfect match. The amount of fluorescence is a function of the amount of PCR product that has been produced. The fluorescent agent can be one of the probe types just described. This makes it possible to do a multiplex reaction. A simpler alternative is to use a specific primer assay, i.e. the primer annealing site covers the polymorphic base position, and the primer will only bind if the allele of interest is present. For this one could use a general purpose dye such as SYBR green that only fluoresces when bound to dsdna. 5
6 The amount of product reaches the same plateau for a range of initial DNA copy numbers. Applied Biosystems Quantifiler kit. R n = normalized reporter signal Determination of a potentially novel allele sequence There are a variety of methods that involve information about the final nucleotide on each of a series of fragments separated according to length. 6
7 Cycle sequencing A process that resembles PCR (a primer, repeated temperature cycles, thermostable polymerase, etc.). One big difference is that only one primer is used therefore only one strand is copied. This produces an arithmetic rather than an exponential increase in product. Therefore PCR product is used as the template. If only a (secret) fraction of nucleotides are ddntps labeled with a dye, then all possible lengths of DNA copies will be made. Processed and electrophoresed molecules, with 3 nucleotide color-coded Template (actually the complement strand) Primer + AGTTTTGGCTCGAACACGTCACAGCCTTTAA AGTTTTGGCTCGAACACGTCACAGCCTTTAA AGTTTTGGCTCGAACACGTCACAGCCTTTA AGTTTTGGCTCGAACACGTCACAGCCTTT AGTTTTGGCTCGAACACGTCACAGCCTT AGTTTTGGCTCGAACACGTCACAGCCT AGTTTTGGCTCGAACACGTCACAGCC AGTTTTGGCTCGAACACGTCACAGC AGTTTTGGCTCGAACACGTCACAG AGTTTTGGCTCGAACACGTCACA AGTTTTGGCTCGAACACGTCAC AGTTTTGGCTCGAACACGTCA AGTTTTGGCTCGAACACGTC AGTTTTGGCTCGAACACGT etc. electropherogram-> 7
8 This can be done separately for each strand of the PCR product, e.g. forward and reverse. 377 sequencing gel image The standard cycle-sequencing reagent kit is one of the BigDye series sold by Applied Biosystems. 8
9 Applied Biosystems 310 instrument raw signal, before applying the dye matrix. same 310 signal following matrix analysis From commercial literature (Applied Biosystems pdf) selling an improved sequencing chemistry kit. Short repeats make for a difficult template. 9
10 In the old days, before fancy colors, the only way to do this was with four separate sequencing reactions, each with only one kind of ddntp. Technical aspects of the cyclesequencing electropherogram. The analysis software (usually): -applies a spectral calibration -determines approximate peak spacing -calls the color (=base) according to spacing expectation -returns an N if too little signal or conflicting signal 10
11 Sequencing requires no size standard. One simply notes the relative position of the peaks. The mobility files are software calibration settings that account for the fact that eletrophoretic mobility is a function of DNA fragment length, instrument parameters (e.g. polymer type) and the type of dye. Even a clean sequence data file will start with a few bases that are poorly resolved (peaks shifted and too broad). This is actually a mobility calibration problem. Do not expect to infer the sequence immediately adjacent to your sequencing primer. 11
12 Part of the initial mess can be signal from unincorporated ddntps (from This probably resulted from poor cleaning of the CS product (a process to remove small molecules). The underlying peaks might be manually called. Peaks in the middle should be sharp, not much different in height, evenly spaced with little overlap, and have little underlying noise (signal from colors other than the major peak). 12
13 Toward the downstream end, peaks will become broad and irregular in shape. In part this is simply a statistical phenomenon. Longer electrophoresis time means that random differences accumulate. However this doesn t explain everything, and this pattern is not completely understood. If the PCR product was short, this may affect only a few bases. Other potential problems. Underlying (minor) peaks. -if out of phase with the major peaks, it could be a variety of problems. -If in phase with the major peaks, it could be a poor spectral calibration, or reflect a mixture a sequences in your PCR product. 13
14 A homomeric stretch will cause strand slippage (during PCR, CS, or cell replication). Downstream of the position where 2 or more sequences are out of phase the electropherogram rapidly decays. Sequence toward the stretch from both directions. It may be that the homomeric stretch produced this replication error in the cell. (A) 16189T Good quality sequence (B) Poor quality sequence (two length variants out of phase) HV1 C-stretch (C) Primer strategies typically used with C-stretch containing samples C-stretch C-stretch Use of internal primers Double reactions from the same strand Figure 10.7, J.M. Butler (2005) Forensic DNA Typing, 2 nd Edition 2005 Elsevier Academic Press A so-called strong stop, in which peak height is suddenly reduced, is thought to result from template secondary structure inhibiting the polymerase. Sequence from both directions. 14
15 Too much sequencing product, sometimes a result of adding too much PCR product to the reaction, can lead to off-scale peaks. This can make it difficult to distinguish adjacent peaks of the same color. This problem may be unavoidable when sequencing a short amplicon, such as may be necessary for a degraded sample. Initially blobs of signal from unincorporated ddntps. Downstream just low level noise. The CS reaction was a failure. Do over. Sequence electropherogram software often includes a peak quality score generated by the program Phred* Probability that the Phred quality score base is called wrong 10 1 in 10 Common threshold for 20 1 in 100 accepting a base call 30 1 in 1, in 10, in 100,000 *Ewing et al Genome Res. 8:
16 en.wikipedia.org/wiki/file:phred_figure_1.jpg 16
17 Common cycle-sequence product electrophoresis technology is limited to a maximum read of about 1000 bp. This requires a longer capillary or acrylamide gel than is needed for STR analysis, and the electrophoresis time is longer as well. For example, with the 3100 line of Applied Biosystems genetic Analyzers, STR analysis works best* with a 36 cm capillary (~40 min), and sequencing with a 50 cm capillary (~2 hr). *There is some flexibility, i.e. one can get roughly 400 bases of sequence using a 36 cm capillary. Large scale sequencing: Genome projects. The availability of published whole genomes allows one, including forensic biologists, to search with a computer for new loci. 17
18 TO REPEAT... Common cycle-sequence product electrophoresis technology is limited to a maximum read of about 1000 bp. Genomes are huge, therefore a project to determine the entire sequence must somehow be obtained in short segments. The individual, overlapping, sequences are then assembled into the final contiguous sequence using a lot of computer power. This is done several ways. The first widespread method was Shotgun sequencing The DNA is fragmented with restriction enzymes. Fragments up to 150KB are then cloned. 18
19 Cloning a segment of DNA in a bacterial cell is relatively easy because a circular plasmid will be replicated by the cell. From NCBI web site. The fragments are ligated to a cloning vector DNA fragment, inserted in a bacterial cell for amplification (by cell division), then sequenced from the ends of the vector. Only ~1000 bp obtained in each direction. dimer.tamu.edu/young/genomics/images/index/image013.jpg Contig is the jargon term for the assembled sequence. 19
20 There are ambiguities in the data, because of both sequencing and assembly errors. The quality of a genome data set is indicated by the number of independent times each bases call has been replicated, i.e. 8X. The technology has advanced quickly. Speed is up and cost is down. The first draft of the human genome (2001) cost $300M, $3B for the current draft. Jan 2006, report of rhesus monkey genome for $22M. Right now we seem to be at ~$15K for a human-size genome. The Holy Grail is the $1000 genome. A couple of new technologies for massive sequencing have burst on the scene. One is based on pyrosequencing, and is sold by the 454 Life Sciences company. 20
21 Figures from454 web site. Each ssdna fragment with adaptor/primer site, is individually attached to a bead. The bead is isolated in a drop of oil floating in a aqueous solution. Each drop contains the reagents for PCR, so the result is a huge number of independent emulsion PCR (empcr) reactions in the same tube. The resulting PCR product sticks to the same bead. The DNA enriched beads are centrifuged into individual wells on a plate, and covered with smaller beads carrying the enzymes needed for pyrosequencing. 200,000 pyrosequencing reactions are detected at the same time. Supposedly millions of bases of sequencing data can be generated per hour, and one person could do a complete bacterial genome in a few days. 21
22 So what is pyrosequencing? PCR product is used as template for a sequencing reaction that requires only ~10 minutes (for short sequences) once the instrument is loaded. One primer is biotinylated for separation of one stand for the next step. The addition of each nucleotide during extension involves the release of a pyrophosphate. This is turn triggers a cascade of reactions that include a fluorescent step. The four different nucleotides are injected and then flushed from the reaction chamber in sequence. A pyrogram. Although reads of >70 bp are reported, until recently data quality often seemed to drop after about 20 bp. 22
23 Pyrosequencing is great for large genotype screening projects, but it s less attractive if a long read is needed. Also, this technique does not handle mixtures well. 23
Essentials of Real Time PCR. About Sequence Detection Chemistries
Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected
Introduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
Real-Time PCR Vs. Traditional PCR
Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives
Single Nucleotide Polymorphisms (SNPs)
Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded
Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne
Sanger Sequencing and Quality Assurance Zbigniew Rudzki Department of Pathology University of Melbourne Sanger DNA sequencing The era of DNA sequencing essentially started with the publication of the enzymatic
Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR
Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of
A Brief Guide to Interpreting the DNA Sequencing Electropherogram Version 3.0
A Brief Guide to Interpreting the DNA Sequencing Electropherogram Version 3.0 Plant-Microbe Genomics Facility The Ohio State University 484 W.12 th Ave., Columbus, OH 43210 Ph: 614/247-6204 FAX: 614/247-8696
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
Troubleshooting Sequencing Data
Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page
Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
DNA Detection. Chapter 13
DNA Detection Chapter 13 Detecting DNA molecules Once you have your DNA separated by size Now you need to be able to visualize the DNA on the gel somehow Original techniques: Radioactive label, silver
Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
DNA Sequencing Setup and Troubleshooting
DNA Sequencing Setup and Troubleshooting Lara Cullen, PhD Scientific Applications Specialist Australia and New Zealand Reviewing Sequencing Data Review the Electropherogram Review the Raw Data (Signal
Sanger Sequencing. Troubleshooting Guide. Failed sequence
Sanger Sequencing Troubleshooting Guide Below are examples of the main problems experienced in ABI Sanger sequencing. Possible causes for failure and their solutions are listed below each example. The
Co Extra (GM and non GM supply chains: Their CO EXistence and TRAceability) Outcomes of Co Extra
GM and non GM supply chains: Their CO EXistence and TRAceability Outcomes of Co Extra Comparison of different real time PCR chemistries and their suitability for detection and quantification of genetically
Introduction. Preparation of Template DNA
Procedures and Recommendations for DNA Sequencing at the Plant-Microbe Genomics Facility Ohio State University Biological Sciences Building Room 420, 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204;
QPCR Applications using Stratagene s Mx Real-Time PCR Platform
QPCR Applications using Stratagene s Mx Real-Time PCR Platform Dan Schoeffner, Ph.D Field Applications Scientist [email protected] Tech. Services 800-894-1304 Polymerase Chain Reaction Melt
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
July 7th 2009 DNA sequencing
July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer
An Overview of DNA Sequencing
An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure
Dye-Blob message: Example: Generally, this is due to incomplete excess dye removal of the cycle sequence reaction.
When sequence data is uploaded to ilab, an email is sent notifying the user that data is ready. The staff of the DNA facility has the ability to edit this message to include specific remarks about how
VLLM0421c Medical Microbiology I, practical sessions. Protocol to topic J10
Topic J10+11: Molecular-biological methods + Clinical virology I (hepatitis A, B & C, HIV) To study: PCR, ELISA, your own notes from serology reactions Task J10/1: DNA isolation of the etiological agent
Mitochondrial DNA Analysis
Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)
Procedures For DNA Sequencing
Procedures For DNA Sequencing Plant-Microbe Genomics Facility (PMGF) Ohio State University 420 Biological Sciences Building 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204 FAX: 614/292-6337
DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE
DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE We recommend for the sequence visualization the use of software that allows the examination of raw data in order to determine quantitatively how good has
Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website
Biomolecular Core Facility AI Dupont Hospital for Children, Rockland Center One, Room 214 Core: (302) 651-6712, Office: (302) 651-6707, [email protected] Katia Sol-Church, Ph.D., Director Jennifer Frenck
Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR
Protocol Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Copyright 2008, 2010 Applied Biosystems. All rights reserved. Ambion and Applied Biosystems products are for Research Use Only.
Quantitative Real Time PCR Protocol. Stack Lab
Quantitative Real Time PCR Protocol Stack Lab Overview Real-time quantitative polymerase chain reaction (qpcr) differs from regular PCR by including in the reaction fluorescent reporter molecules that
DNA Sequencing Troubleshooting Guide.
DNA Sequencing Troubleshooting Guide. There are a number of factors that can lead to less than perfect DNA sequencing results. In this guide, we explain some of the common problems encountered, and outline
Methods and Application Guide. Introduction to Quantitative PCR
Methods and Application Guide Introduction to Quantitative PCR Introduction to Quantitative PCR Methods and Application Guide Stratagene USA and Canada Order: 800-424-5444 x3 Technical Services: 800-894-1304
Application Guide... 2
Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
Introduction to Quantitative PCR
Introduction to Quantitative PCR Methods and Applications Guide Introduction to Quantitative PCR Methods and Applications Guide IN 70200 D US and Canada Orders: 800-227-9770 x3 Technical Service: 800-227-9770
Introduction to next-generation sequencing data
Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS
Universidade Estadual de Maringá
Universidade Estadual de Maringá Disciplina: Biologia Molecular Sequenciamento de ácidos nucléicos Profa. Dra. Maria Aparecida Fernandez Maxan e Gilbert - quebra química Berg, Gilbert and Sanger dideoxinucleotideos
Artisan Scientific is You~ Source for: Quality New and Certified-Used/Pre:-awned ECJuiflment
Looking for more information? Visit us on the web at http://www.artisan-scientific.com for more information: Price Quotations Drivers Technical Specifications. Manuals and Documentation Artisan Scientific
Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation.
Introduction to SMRTbell Template Preparation 100 338 500 01 1. SMRTbell Template Preparation 1.1 Introduction to SMRTbell Template Preparation Welcome to Pacific Biosciences' Introduction to SMRTbell
Molecular Diagnostics in the Clinical Microbiology Laboratory
Molecular Diagnostics in the Clinical Microbiology Laboratory Patrick Tang, MD, PhD, FRCPC B.C. Centre for Disease Control University of British Columbia Molecular Diagnostics in the Clinical Microbiology
Validating Microarray Data Using RT 2 Real-Time PCR Products
Validating Microarray Data Using RT 2 Real-Time PCR Products Introduction: Real-time PCR monitors the amount of amplicon as the reaction occurs. Usually, the amount of product is directly related to the
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
DNA Sequencing Troubleshooting Guide
DNA Sequencing Troubleshooting Guide Successful DNA Sequencing Read Peaks are well formed and separated with good quality scores. There is a small area at the beginning of the run before the chemistry
Next Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
Beginner s Guide to Real-Time PCR
Beginner s Guide to Real-Time PCR 02 Real-time PCR basic principles PCR or the Polymerase Chain Reaction has become the cornerstone of modern molecular biology the world over. Real-time PCR is an advanced
How is genome sequencing done?
How is genome sequencing done? Using 454 Sequencing on the Genome Sequencer FLX System, DNA from a genome is converted into sequence data through four primary steps: Step One DNA sample preparation; Step
Fluorescent dyes for use with the
Detection of Multiple Reporter Dyes in Real-time, On-line PCR Analysis with the LightCycler System Gregor Sagner, Cornelia Goldstein, and Rob van Miltenburg Roche Molecular Biochemicals, Penzberg, Germany
SERVICES CATALOGUE WITH SUBMISSION GUIDELINES
SERVICES CATALOGUE WITH SUBMISSION GUIDELINES 3921 Montgomery Road Cincinnati, Ohio 45212 513-841-2428 www.agctsequencing.com CONTENTS Welcome Dye Terminator Sequencing DNA Sequencing Services - Full Service
quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476
BioScience quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 This method describes a Real-time semi-quantitative TaqMan PCR procedure for the determination of
DNA FRAGMENT ANALYSIS by Capillary Electrophoresis
DNA FRAGMENT ANALYSIS by Capillary Electrophoresis USER GUIDE DNA Fragment Analysis by Capillary Electrophoresis Publication Number 4474504 Rev. A Revision Date September 2012 For Research Use Only. Not
Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit
Product Bulletin Human Identification Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit The Quantifiler kits produce reliable and reproducible results, helping to
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
DNA and Forensic Science
DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief
DNA Core Facility: DNA Sequencing Guide
DNA Core Facility: DNA Sequencing Guide University of Missouri-Columbia 216 Life Sciences Center Columbia, MO 65211 http://biotech.missouri.edu/dnacore/ Table of Contents 1. Evaluating Sequencing Data..
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.
Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2013, B. J. MacLennan, EECS, University of Tennessee,
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
Biotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
360 Master Mix. , and a supplementary 360 GC Enhancer.
Product Bulletin AmpliTaq Gold 360 Master Mix and 360 DNA Polymerase AmpliTaq Gold 360 Master Mix AmpliTaq Gold 360 DNA Polymerase 360 Coverage for a Full Range of Targets AmpliTaq Gold 360 Master Mix
BacReady TM Multiplex PCR System
BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental
Nucleic Acid Techniques in Bacterial Systematics
Nucleic Acid Techniques in Bacterial Systematics Edited by Erko Stackebrandt Department of Microbiology University of Queensland St Lucia, Australia and Michael Goodfellow Department of Microbiology University
The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics
The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long
Technical Note. Roche Applied Science. No. LC 19/2004. Color Compensation
Roche Applied Science Technical Note No. LC 19/2004 Purpose of this Note Color The LightCycler System is able to simultaneously detect and analyze more than one color in each capillary. Due to overlap
CompleteⅡ 1st strand cdna Synthesis Kit
Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:
Application Note. Biotechnology Explorer Crime Scene Investigator PCR Basics. Kit: A Real-Time PCR Extension
Biotechnology Explorer Crime Scene Investigator PCR Basics Kit: Table of Contents Introduction.............................................. 2 Learning Objectives......................................
Gene Mapping Techniques
Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction
RevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
Troubleshooting Overview
Overview This chapter provides information for troubleshooting automated DNA sequencing results from capillary electrophoresis runs. Assumptions Using Controls suggestions listed in this chapter assume
Design of conditional gene targeting vectors - a recombineering approach
Recombineering protocol #4 Design of conditional gene targeting vectors - a recombineering approach Søren Warming, Ph.D. The purpose of this protocol is to help you in the gene targeting vector design
User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube
User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally
Applications Guide. Real-Time PCR Applications Guide
Applications Guide Real-Time PCR Applications Guide table of contents Table of Contents 1. Overview of Real-Time PCR 2 1.1 Key Concepts of Real-Time PCR 2 1.1.1 What Is Real-Time PCR? 2 1.1.2 How Real-Time
DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA
DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Susan Carson Heather B. Miller D.Scott Witherow ELSEVIER AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN
TaqMan Fast Advanced Master Mix. Protocol
TaqMan Fast Advanced Master Mix Protocol For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. APPLIED
Reliable PCR Components for Molecular Diagnostic Assays
Reliable PCR Components for Molecular Diagnostic Assays Terri McDonnell, MBA, PMP Senior Program Manager, Molecular Diagnostics March 2014 In this webinar we will: Discuss requirements for amplification
Speed Matters - Fast ways from template to result
qpcr Symposium 2007 - Weihenstephan Speed Matters - Fast ways from template to result March 28, 2007 Dr. Thorsten Traeger Senior Scientist, Research and Development - 1 - Overview Ạgenda Fast PCR The Challenges
Real-time PCR handbook
Real-time PCR handbook Single-tube assays 96- and 384-well plates 384-well TaqMan Array cards OpenArray plates The image on this cover is of an OpenArray plate which is primarily used for mid-density real-time
Illumina TruSeq DNA Adapters De-Mystified James Schiemer
1 of 5 Illumina TruSeq DNA Adapters De-Mystified James Schiemer The key to sequencing random fragments of DNA is by the addition of short nucleotide sequences which allow any DNA fragment to: 1) Bind to
DNA Separation Methods. Chapter 12
DNA Separation Methods Chapter 12 DNA molecules After PCR reaction produces many copies of DNA molecules Need a way to separate the DNA molecules from similar sized molecules Only way to genotype samples
Real-time quantitative RT -PCR (Taqman)
Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR
Commonly Used STR Markers
Commonly Used STR Markers Repeats Satellites 100 to 1000 bases repeated Minisatellites VNTR variable number tandem repeat 10 to 100 bases repeated Microsatellites STR short tandem repeat 2 to 6 bases repeated
Stratagene QPCR Mouse Reference Total RNA
Stratagene QPCR Mouse Reference Total RNA Instruction Manual Catalog #750600 Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 750600-12 LIMITED PRODUCT WARRANTY This warranty limits
Description: Molecular Biology Services and DNA Sequencing
Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:
TIANquick Mini Purification Kit
TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer
Methylation Analysis Using Methylation-Sensitive HRM and DNA Sequencing
APPLICATION NOTE Methylation Analysis Using Methylation-Sensitive HRM and DNA Sequencing Methylation Analysis Using Methylation Sensitive HRM and DNA Sequencing Abstract DNA methylation is a key epigenetic
1/12 Dideoxy DNA Sequencing
1/12 Dideoxy DNA Sequencing Dideoxy DNA sequencing utilizes two steps: PCR (polymerase chain reaction) amplification of DNA using dideoxy nucleoside triphosphates (Figures 1 and 2)and denaturing polyacrylamide
ZR DNA Sequencing Clean-up Kit
INSTRUCTION MANUAL ZR DNA Sequencing Clean-up Kit Catalog Nos. D40 & D4051 Highlights Simple 2 Minute Bind, Wash, Elute Procedure Flexible 6-20 µl Elution Volumes Allow for Direct Loading of Samples with
DNA: A Person s Ultimate Fingerprint
A partnership between the UAB Center for Community Outreach Development and McWane Center DNA: A Person s Ultimate Fingerprint This project is supported by a Science Education Partnership Award (SEPA)
Mir-X mirna First-Strand Synthesis Kit User Manual
User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.
Factors Influencing Multiplex Real-Time PCR
APPLICATION NOTE Multiplex Real-Time PCR Factors Influencing Multiplex Real-Time PCR Introduction Multiplex PCR is the simultaneous amplification of more than one target sequence in a single reaction [1].
Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination
DNA Sequencing Handbook
Genomics Core 147 Biotechnology Building Ithaca, New York 14853-2703 Phone: (607) 254-4857; Fax (607) 254-4847 Web: http://cores.lifesciences.cornell.edu/brcinfo/ Email: [email protected] DNA Sequencing
Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples
Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples Sudhir K. Sinha, Ph.D.*, Anne H. Montgomery, M.S., Gina Pineda, M.S., and Hiromi Brown, Ph.D.
Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005
Deutsche Akkreditierungsstelle GmbH German Accreditation Body Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Period of validity: 26.03.2012 to 25.03.2017
ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053
INSTRUCTION MANUAL ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053 Highlights Simple 10 Minute Bind, Wash, Elute Procedure Flexible 15-20 µl Elution Volumes Allow for Direct Loading of Samples
Concepts and methods in sequencing and genome assembly
BCM-2004 Concepts and methods in sequencing and genome assembly B. Franz LANG, Département de Biochimie Bureau: H307-15 Courrier électronique: [email protected] Outline 1. Concepts in DNA and RNA
Reagent Guide. Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems
Reagent Guide Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems Reagent Guide Copyright 2008, 2010 Applied Biosystems. All
Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University
Genotyping by sequencing and data analysis Ross Whetten North Carolina State University Stein (2010) Genome Biology 11:207 More New Technology on the Horizon Genotyping By Sequencing Timeline 2007 Complexity
Next Generation Sequencing for DUMMIES
Next Generation Sequencing for DUMMIES Looking at a presentation without the explanation from the author is sometimes difficult to understand. This document contains extra information for some slides that
PrimeSTAR HS DNA Polymerase
Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction
